(SIB) et Vital-IT - Université de Fribourg

yokeenchantingBiotechnology

Sep 29, 2013 (3 years and 8 months ago)

97 views


SIB Institut Suisse de Bioinformatique
et Vital-IT:
un pont entre données et santé humaine
Vital-IT /Swiss-Prot groups

Prof. Ioannis Xenarios
Center for Integrative Genomics
University of Lausanne
SIB Swiss Institute of Bioinformatics
©
2012
SIB

2
SIB Swiss Institute of Bioinformatics
©
2012
SIB

3
©
2012
SIB

4
La plupart des projets que SIB supporte nécessite
différentes expertises

Biologists

MDs
Biocurators
Bio/ -staticians
Bioinformaticians
Computational infrastructure
IT specialists/
Computer Scientists
Project
based
©
2012
SIB

5
gggtctctcttgttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctgatagctagagatcccttc
agaccaaatttagtcagtgtgaaaaatctctagcagtggcgcctgaacagggacttgaaagcgaaagagaaaccagagaagctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggacggcgactggtg
agtacgccaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcgtcgatattaagcgggggaggattagatagatgggaaaaaattcggttaaggccagggggaaagaaaaaatatagattaaaacatttagtat
gggcaagcagggagctagaacgattcgcagtcaatcctggcctattagaaacatcagaaggttgtagacaaatactgggacaactacaaccagcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccct
ctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgacacaggaaatagcagccaggtcagccaaaattaccccata
gtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaatgcatgggtaaaagtagtagaagagaaggctttcagcccagaagtaatacccatgttttcagcattatcagaaggagccaccccacaagatt
taaacaccatgctaaacacagtggggggacatcaagcagccatgcaaatgttaaaagagaccatcaatgaggaagctgcagaatgggatagattgcatccagtgcatgcagggcctcatccaccaggccagatgagagaaccaagggg
aagtgacatagcaggaactactagtacccttcaggaacaaatagcatggatgacaaataatccacctatcccagtaggagaaatctataagagatggataatcctgggattaaataaaatagtaaggatgtatagccctaccagcatt
ctggacataaaacaaggaccaaaggaaccctttagagactatgtagaccggttctataagactctaagagccgagcaagcttcacaggaggtaaaaaattggatgacagaaaccttgttggtccaaaatgcgaacccagattgtaaga
ctattttaaaagcattgggaccagcagctacactagaagaaatgatgacagcatgtcagggagtgggaggacccggccataaagcaagagttttggcagaagcaatgagccaagtaacaaattcagctaccataatgatgcagaaagg
caattttaggaaccaaagaaaaattgttaagtgtttcaattgtggcaaagaagggcacatagccaaaaattgcagggcccctaggaaaaggggctgttggaaatgtggaaaggagggacaccaaatgaaagattgtactgagagacag
gctaattttttagggaaaatctggccttcccacaggggaaggccagggaattttcctcagaacagactagagccaacagccccaccagccccaccagaagagagcttcaggtttggggaagagacaacaactccctctcagaagcagg
agctgatagacaaggaactgtatccttcagcttccctcaaatcactctttggcaacgaccccttgtcacaataaagataggggggcaactaaaggaagctctattagatacaggagcagatgatacagtattagaagaaataaatttg
ccaggaagatggaaaccaaaaatgatagggggaattggaggttttatcaaagtaagacagtatgatcaaatactcgtagaaatctgtggacataaagctataggtacagtattagtaggacctacacctgtcaacataattggaagaa
atctgttgactcagattggttgcactttaaattttcccattagtcctattgaaactgtaccagtaaaattaaagccaggaatggatggcccaaaagttaaacaatggccattgacagaagaaaaaataaaagcattagtagaaatctg
tacagaaatggaaaaggaaggaaaaatttcaaaaatcgggcctgaaaatccatataatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagtagatttcagagaacttaataagaaaactcaagacttc
tgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccttagataaagaattcaggaagtacactgcatttaccatacctagtataaaca
atgagacaccagggattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaaagcagcatgacaaaaatcttagagccttttagaaaacaaaatccagacatagttatctatcaatacatggacga
tttgtatgtaggatctgacttagaaatagggcagcatagaacaaaaatagaggaactgagacaacatctgttgaagtggggatttaccacaccagacaaaaaacatcagaaagaacctccattcctttggatgggttatgaactccat
cctgataaatggacagtacagcctatagtgctgccagaaaaggacagctggactgtcaatgacatacagaagttagtgggaaaattgaattgggcaagtcagatttacccagggattaaagtaaagcaattatgtagactccttaggg
gaaccaaggcactaacagaagtaataccactaacaaaagaagcagagctagaactggcagaaaacagggaaattctaaaagaaccagtacatggagtgtattatgacccatcaaaagacttaatagcggaaatacagaagcaggggca
aggtcaatggacatatcaaatttatcaagagccatttaaaaatctgaaaacaggaaaatatgcaagaatgaggggtgcccacactaatgatgtaaaacaattaacagaggcagtgcaaaaaataaccacagaaagcatagtaatatgg
ggaaagactcctaaatttaaactacccatacaaaaagaaacatgggaaacatggtggacagagtattggcaagccacctggattcctgagtgggagtttgtcaatacccctcccttagtaaaattatggtaccagttagagaaagaac
ccataataggagcagaaactttctatgtagatggggcagctaacagggagactaaattaggaaaagcaggatatgttactaacaaagggagacaaaaagttgtctccataactgacacaacaaatcagaagactgagttacaagcaat
tcttctagcattacaggattctggattagaagtaaacatagtaacagactcacaatatgcattaggaatcattcaagcacaaccagataaaagtgaatcagagatagtcagtcaaataatagagcagttaataaaaaaagaaaaggtc
tacctgacatgggtaccagcgcacaaaggaattggaggaaatgaacaagtagataaattagtcagtactggaatcaggaaagtactctttttagatggaatagataaagcccaagaagaacatgaaaaatatcacagtaattggaggg
caatggctagtgattttaacctgccacctgtggtagcaaaagagatagtagccagctgtgataaatgtcagctaaaaggagaagccatgcatggacaagtagactgtagtccaggaatatggcaactagattgtacacatttagaagg
aaaaattatcctggtagcagttcatgtagccagtggatatatagaagcagaagttattccagcagaaacagggcaggaaacagcatactttctcttaaaattagcaggaagatggccagtaaaaacagtacatacagacaatggcagc
aatttcaccagtactacagttaaggccgcctgttggtgggcaggaatcaagcaggaatttggcattccctacaatccccaaagtcaaggagtagtagaatctataaataaagaattaaagaaagttataggacagataagagatcagg
ctgaacatcttaagacagcagtacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggtacagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaactacaaaaacaaattac
aaaaattcaaaattttcgggtttattacagggacagcagagatccactttggaaaggaccagcaaagcttctctggaaaggtgaaggggcagtagtaatacaagataatagtgacataaaagtagtgccaagaagaaaagcaaagatc
attagggattatggaaaacagatggcaggtgatgattgtgtggcaagtagacaggatgaggattagaacatggaaaagtttagtaaaacaccatatgtatgtttcaaggaaagctaagggatggttttatagacatcactatgaaagt
actcatccgagaataagttcagaagtacacatcccactagggaatgcaaaattggtaataacaacatattggggtctacatacaggagaaagagactggcatttgggtcaaggag
©
2012
SIB

6
©
2012
SIB

7
Site de recherche et production de Vital-IT
Total Vital-IT infrastructure

HPC: 3’000 CPU

Storage:
Used space: 1.2 PetaBytes (2.2PB installed)
>120 Mio files
©
2012
SIB

8
La révolution du séquençage à haut débit
Centre de séquençage (core facility @UNIL/@UNIGE)
Le séquençage de DNA est devenu très accessible
- Des universités et des laboratoires peuvent installer des
séquenceurs (le personnel étant un point essentiel)
- Ceux-ci produisent de plus en plus de données
Evolution de la quantité des données de séquençage
managée par Vital-IT – chaque semaine

- 2007: 1 Terabytes of data / semaine
- 2008: 2.5 Terabytes of data / semaine
- 2009: 7 Terabytes of data / semaine
- 2012 14 Terabytes of data/ semaine
©
2012
SIB

9
CISH@Fribourg – Vital-IT – Human-IT
L’augmentation de données et de connaissances croit chaque jour
Notre capacité à l’assembler et à la visualiser est essentielle
pour pouvoir l’interpréter et communiquer les connaissances
Schaadt EE, PLOS Biol 2008
©
2012
SIB

10
Connaissances (KM) / données / expertise en bioinformatique
VITAL-IT/SWISS-PROT
(SIB)
Informatique
-
Interface
Humain
Machine
(e.g. Ingold)
Mathématique
et
Transformation
de données
(e.g. Mazza)
CISH@Fribourg – Vital-IT – Human-IT
CISH
©
2012
SIB

11
Les coulisses de Swiss-Prot et Vital-IT