Tumor-Genome-Directed Anti-Cancer Therapy

wildlifeplaincityManagement

Nov 6, 2013 (3 years and 9 months ago)

77 views

Vanderbilt
-
Ingram Cancer Center


Tumor
-
Genome
-
Directed Anti
-
Cancer
Therapy: Using Lung Cancer and
Melanoma as a Paradigm


NCI Workshop on “
Next
-
Generation
DNA Sequencing as a Tool for
Clinical Decision
-
making in Cancer Patient
Management”


May 4, 2012

Bethesda, MD


William Pao, MD, PhD

Professor of Medicine

Director, Personalized Cancer Medicine

Director, Division of Hematology/Oncology

Vanderbilt
-
Ingram Cancer Center

Nashville, TN

Vanderbilt
-
Ingram Cancer Center

Disclosure Information

I have the following financial relationships to disclose:




Patent licensed to
MolecularMD

for EGFR T790M testing




(got total of $500.00 and no royalties)




Consulting for
MolecularMD
, BMS, AstraZeneca,






Symphony Evolution, Clovis Oncology




Research funding from
Xcovery
,
Enzon
, AstraZeneca,
Symphogen

Vanderbilt
-
Ingram Cancer Center

Traditional View of Cancer

Adeno
-

carcinoma

Squamous

Large

Small

Lung Cancer

Melanoma

Vanderbilt
-
Ingram Cancer Center

Oncogenic Driver Mutations Impact
Anticancer Therapy in Humans

IPASS NEJM ‘09

Ph II Trial PLX
-
4032 PASCO ‘09

Lung Cancer

Melanoma

Vanderbilt
-
Ingram Cancer Center

Pao and Girard ’11

Evolution of Knowledge About ‘Driver
Mutations’ in Non
-
Small Cell Lung
Cancer

Vanderbilt
-
Ingram Cancer Center

Li et al ‘11

Spectrum of ‘Driver Mutations’ in
202

East Asian Never
Smokers with Lung
Adenocarcinoma

Vanderbilt
-
Ingram Cancer Center

Molecular Subsets


偲潧牥P猠

Year

Reference

Criteria

OS (
mos
)

Notes

Lung

Cancer

1976

Hansen

Lung ca

7

SCLC,
adeno

2002

Schiller

NSCLC

7.9

Platinum

dblts

2006

Sandler

Non
-
squamous

NSCLC

12.3

Bevacizumab

2009

Mok

E Asian never

light smoker/
adenoca

18.6

Gefitinib

arm

2009

Rosell

Spanish

EGFR
mutant NSCLC

27

Erlotinib

2009

Mitsudomi

Japanese

EGFR
mutant NSCLC

30+

Gefitinib

2010

Maemondo

Japanese

EGFR
mutant NSCLC

30.5

Gefitinib

2010

Janne

US
EGFR
mutant NSCLC

27.6

Erlotinib

Melanoma

1999

Chapman

Melanoma

7

Dacarbazine

2011

Sosman

BRAF

mutant melanoma

16

Vemurafenib

Goals of the VICC PCMI
-

2009


To establish ‘reflex’ testing of ‘common’ clinically
relevant genetic alterations in lung cancers and
melanomas


To develop a clinically
-
applicable high
-
throughput molecular genotyping facility for
‘rarer’ genetic variants


To develop
bioinformatic

algorithms to report
genetic results in the electronic medical record
in ways that are clinically useful for practicing
oncologists



Collaboration among
Depts

of Medicine,
Pathology,
BioInformatics
, and VICC

Vanderbilt
-
Ingram Cancer Center

What Test? What Should Be in the Test?


Which platform?


SNaPshot

(ABI 3730)
vs

new technology (
Sequenom
)


Ease of calls


High sensitivity


One panel for all cancers? Or tumor
-
specific panels?


Feasibility vs. wide
-
applicability


How often does one really find an ‘actionable’ mutation (e.g.
EGFR kinase domain mutation in a melanoma)?


Which mutations?


Occurs in the cancer


Occurs with frequency
>
1%


Has relevance to existing or emerging targeted therapy

Vanderbilt
-
Ingram Cancer Center

How to Implement?


Molecular diagnostics


Assays developed in Pao Lab as collaboration with CLIA
-
lab


Assays transferred to/re
-
validated by CLIA
-
lab


Bioinformatics


Monthly meetings among Bioinformatics, Pathology


Input from practicing clinicians


Pathology workflow


Re
-
organization/tissue librarian


Education


Consent


Lung


reflex


Melanoma


consent form

Vanderbilt
-
Ingram Cancer Center

One Size Does Not Fit All:

Melanoma/Lung
Ca

Molecular Profiling
Results

Melanoma Panel: 538 Samples

Lung Panel: 451 Samples







7/1/10
-
12/31/11

Cindy Vnencak
-
Jones

First 150 Patients: 20% of BRAF V600 Mutations
Would Be Missed by Allele
-
Specific PCR


Lovly, Dahlman, Fohn, Su et al

‘12

Lovly, Dahlman, Fohn, Su et al

‘12

First 150 Patients: 20% of BRAF V600 Mutations
Would Be Missed by Allele
-
Specific PCR


Vanderbilt
-
Ingram Cancer Center

Lovly, Dahlman, Fohn, Su et al

‘12

First 150 Patients:

40% of
Pts

with Mutant Metastatic Disease


䝥湯瑹灥
-
䑲楶敮e
T牥慴a敮e

Gene

# of metastatic cases

#

patents placed on a genotype
-
driven clinical trial (%)

BRAF

32

12 (38%)

CTNNB1

1*

1 (100%)

GNAQIGNA11

6

3 (50%)

KIT

1

1 (100%)

NRAS

15

4 (27%)

No mutation detected

28

N/A

Total cases

82

21/54 (39%)

*This CTNNB1 mutation (CTNNB1 S45P) occurred concurrently with an NRAS Q61L mutation.

Vanderbilt
-
Ingram Cancer Center

# amino acids to fusion

Kinase Fusions in Human Cancers

JAK2

ALK

ROS1

ABL1

PDGFR


43
-
350

GXGXXG

PDGFR


䙇䙒F


-


GXGXXG

70
-
201

GXGXXG

56

GXGXXG

15
-
33

GXGXXG

44
-
64

GXGXXG

222

GXGXXG

NTRK1

117

GXGXXG

BRAF

83

GXGXXG

RET

18
-
62

GXGXXG

NTRK3

15

GXGXXG

Chmielecki et al ’10; Chmielecki et al ‘11

Exon (
-
1)

Exon*

Exon (
-
2)

intron (
-
3)

intron (
-
2)

intron (
-
1)

*encodes GXGXXG motif

Vanderbilt
-
Ingram Cancer Center

Obtain tumor
specimen
Extract genomic DNA
Shear DNA* (
300
-
500bps; 200
-
220bps);
Ligate
sequencing
adaptors;
PCR amplify
Capture TK DNA with biotinylated RNA oligo ‘baits’
(capture onto streptavidin
-
labeled magnetic beads)
Elute captured DNA
(*
TK DNA
,
Other DNA,
5’ fusion fragment DNA
)
Perform
next
-
gen sequencing
Analyze sequences;
PCR validate fusions
with breakpoint spanning primers
wild type
TK
wild type TK
50mer
35mer
wild type
TK
wild type TK
wild type
TK
wild type TK
wild type
TK
Novel 5’ partner
wild type
TK
wild type TK
200
-
220bps
wild type TK
novel 5’ partner
TK
wild type TK
wild type TK
wild type TK
~200 bps
Short read PE sequencing (
SOLiD
)
Long read sequencing (454)
Using NGS to Detect Kinase Fusions
Systematically

Chmielecki et al ’10; Chmielecki et al ‘11

Vanderbilt
-
Ingram Cancer Center

GIO9Q0C04HZ8XI length=532
TTTCAAAGTAATTAAACCACTATTGCTACTAACAATAAAAACCACAGAGTGAGGTTCAAAGTTACTTTTTAGTTCTTTTTATCCTTGGAATAAATCTCATTATAGAAAAATAC
AGGCTGGGTATGGTGGCTCACACCTGTAATCCTAATACTTTGTTTTGGGAAC
CTGAGG
GGGG
TGTGAT
TCTACTGAAATGCATTCTGATCCTATTAGTCTGTAATTTCAGTGT
TCTGCTTTGAGATTTTTACCATTTCTGTGATTTCCAACATTTTAAGCTTCCTGAATCAGGATTACAGCACCTCATGATCCCATCTTTCTAAAATTCCAGTCCTGTGGTTCCAA
CACCTTAAGATGTCAACATTCTAAGCTTACATCTTTACTGTACTTGCCCAGCACTGGGGAGGGCCATCCGCATCCAGCCGAGTACCCTACCTGGTGTCACTTTCTGGGGTCAC
CTGCTCTACTACTTCCATCTGAGGAGCAGCGAAGGCTGGGGAGAGAAGCTAGAGAGGAGGTTCTCATGAGCCAGGCCCTC
GIO9Q0C04H0MGF length=451
ATACAGGCTGGGTATGGTGGCTCACACCTGTAATCCTAATACTTTGTTTTGGGAAC
CTGAGG
GGGG
TGTGAT
TCTACTGAAATGCATTCTGATCCTATTAGTCTGTAATTTCA
GTGTTCTGCTTTGAGATTTTACCATTCTGTGATTCCAACATTTTAAGCTTCCTGAATCAGGATTACAGCACCTCATGATCCCATCTTTCTAAAATTCCAGTCCTGTGGTTCCA
ACACCTTAAGATGTCAACATTCTAAGCTTACATCTTTCTGACTTGCCCAGCACTGGGGAGGGCCATCCGCATCCAGCCGAGTACCCTACCTGGTGTCACTTTCTGGGGTCACC
TGCTCTACTACTTCCATCTGAGGAGCAAGCGAAGGCTGGGAGAGAAGCTAGAGAGGAGGTTCTCATGAGCCAGGCCCTCAGCTGCCAGTTGCTCCTCAGTCTGCCAAGTCCT
A
B
C
D
ex 11
ex 12
c6orf204
-
PDGFR
β
c6orf204
ex 11
ex 12
ex 12
ex 11
PDGFR
β
ex 11
ex 12
gggaacctgagg
gggg
tgtgattctact
GCA TTG CTT GAA A
AG CCA CGT TAC
Ala Leu
Leu
Glu Lys Pro Arg Tyr
PDGFR
B
rc
C
6orf204rc
5’ RACE
Forward
C6orf204
PDGFRB
C6orf204
PDGFRB
C6orf204
-
PDGFRB
Novel C6orf204
-
PDGFRbeta Fusion in

Pt

with Recurrent T
-
ALL and MPN

Chmielecki et al ’10; Chmielecki et al ‘11

Summary


Building a Sustainable Model


Impact in the clinic


Prioritize treatment options for existing targeted therapies


Impact on clinical trials


Accelerate accrual to trials with emerging targeted therapies


Enrich for cohorts of pts likely to benefit


Impact on translational science


Create opportunities from the bedside to bench and back


Initiate new projects

Goals of the VICC PCMI
-

2009


To establish ‘reflex’ testing of ‘common’
clinically relevant genetic alterations in lung
cancers and melanomas


To develop a clinically
-
applicable high
-
throughput molecular genotyping facility for
‘rarer’ genetic variants


To develop
bioinformatic

algorithms to report
genetic results in the electronic medical
record in ways that are clinically useful for
practicing oncologists



Collaboration among
Depts

of Medicine,
Pathology,
BioInformatics
, and VICC

Vanderbilt
-
Ingram Cancer Center

Knowledge Gap

94% of
community oncologists
responded that they
discuss genetic mutation testing with their patient

17% of lung cancer
patients

were aware of
genetic mutation testing

44% of
oncology nurses
did not discuss genetic
mutation testing with patients, because they felt
they lacked knowledge to discuss it

Vanderbilt
-
Ingram Cancer Center

Old Method for Reporting Mutation Results

in the Electronic Medical Record

Old Method:


Report Template


Scanned into Electronic
Health Record as image
file (not computable)


Challenges:


How to report > 40
mutations in 8 genes?


Whose role to curate
knowledge regarding
clinical significance?


Lack clinical trial
information


Vanderbilt
-
Ingram Cancer Center

Mia Levy

New Method for Reporting
Mutation Results in the EMR

Vanderbilt
-
Ingram Cancer Center

My cancer
genome

Vanderbilt
-
Ingram Cancer Center

My cancer
genome

Vanderbilt
-
Ingram Cancer Center

My cancer
genome

Vanderbilt
-
Ingram Cancer Center

My cancer genome

Vanderbilt
-
Ingram Cancer Center

My cancer

genome

Vanderbilt
-
Ingram Cancer Center

My cancer genome

Vanderbilt
-
Ingram Cancer Center

My cancer

genome

7 Cancers

Lung

Melanoma

Breast

Colon

Thymic

GIST

Thyroid


22 Genes


203
Disease
-
Gene
-
Variant
Relationships

~50,000
visits/>170,000
pageviews
/

119
countries/52 US territories

in 1 year (only 8500 oncologists in US)

Now
~1000
visits/week

Vanderbilt
-
Ingram Cancer Center

My cancer genome

Clinical trial search

36,167 Cancer Trials (PDQ)

135 Cancer Diagnoses

437 Cancer Genes (COSMIC)

Vanderbilt
-
Ingram Cancer Center

My cancer genome

Trial search results can be filtered by
geographic location or trial phase

Vanderbilt
-
Ingram Cancer Center


Consortium Science

Contributors: 30

Informatics: 11

Knowledge Management Experts: 3

Vanderbilt
-
Ingram Cancer Center

DIRECT


A Mutation Knowledgebase


D
NA
-
mutation
I
nventory to
R
efine and
E
nhance
C
ancer
T
reatment


“COSMIC for clinicians”

Horn et al PASCO ‘11

Vanderbilt
-
Ingram Cancer Center

>100 Reported EGFR Mutations:

How Does One Find Clinical Relevance of a Specific One?

Riely et al ‘06

Vanderbilt
-
Ingram Cancer Center

www.mycancergenome.org/DIRECT

1022 pts with
EGFR
mutation/

EGFR TKI
-
response

data;


180 different GFR
mutns


Horn et al PASCO ‘11

Table

2: EGFR Mutations
associated with disease control

Paul Yeh, Leora Horn

Vanderbilt
-
Ingram Cancer Center

Future Directions


DETECT


D
NA
E
valuation of
T
umors for
E
nhanced
C
ancer
T
reatment


Breast
ca
, colon
ca

using
SNaPshot


NGS on ‘pan
-
negative’ cases


Develop in
-
house next
-
gen panels


Partner with Foundation Medicine,
MolecularMD


MyCancerGenome.org


Web
-
based decision support


Expand content; monthly updates


DIRECT


D
NA
-
mutation
I
nventory to
R
efine and
E
nhance
C
ancer
T
reatment


We need a national effort: COSMIC for clinicians


MCG


Drug Compendium


Vanderbilt
-
Ingram Cancer Center

Sanford Guide to
AntiMicrobrial

Therapy

Vanderbilt
-
Ingram Cancer Center

MCG Guide to Anticancer Therapy

Vanderbilt
-
Ingram Cancer Center

2 Issues


DIRECT


Journals and/or the NCI should mandate that for
genotype
-
directed clinical trials, ALL individual level
patient data, including genotypes, MUST be reported
in a public fashion!


FDA
-
mandated companion diagnostics
vs

multiplexed
assays


Tissue


$


Time


Lung cancer: EGFR, HER2, PIK3CA, ALK, ROS, RET, etc.

Vanderbilt
-
Ingram Cancer Center

Acknowledgements

Vanderbilt Ingram Cancer Center

Jennifer Pietenpol

Ashley Lamb

Kim Dahlman

Molecular Diagnostics Laboratory

Cindy Vnencak
-
Jones

Medical Oncology

Christine Lovly

Jeff Sosman

Leora Horn

Carlos Arteaga

Pathology


Sam Santoro


Cheryl Coffin

Bioinformatics

Junfeng Xia

Peilin Jia

Zhongming Zhao

Knowledge Management

Christine Micheel

Paul Yeh

Pao Lab

Katie Hutchinson

Clinical Informatics

Mia Levy

Scott
Sobecki

Jim
Tibbetts

Stacy
Cooreman

Mik

Cantrell

Dario
Giuse

Jonathan
Grande

RuAnn

Schleicher

UCLA


Toni
Ribas

MGH


Dora Dias
-
Santagata


John Iafrate

Grant
Support

Kleberg Foundation

Martell Foundation

Anonymous Foundation

NCI/SU2C
-
AACR

Vanderbilt
-
Ingram Cancer Center


Co
-
Editor
-
in
-
Chief:
Mia Levy


Deputy Editor:
Christine Lovly


Executive Editor:
Christine Micheel


Editorial/Business:
Paul Yeh, Ashley Lamb


Contributors:

Rick Abramson, Carlos Arteaga, Alberto Bardelli, Justin M. Balko,
Paul Bunn, Emily Chan, Haiquan Chen, Christopher Corless, Dan Costa, Allan
Espinosa, Jim Fagin, Jill Gilbert, Nicolas Girard, Leora Horn, Vicki Keedy, Marc
Ladanyi, Mia Levy, Roger Lo, Christine Lovly, Robert Maki, Ingrid Mayer, Geoff
Oxnard, Paul
Paik,
William Pao, Gregory Riely,
David
Solit
,
Ben Solomon, Martin
Sos, Jeff Sosman, Roman Thomas


Informatics:
Mik

Cantrell,
Stacy
Cooreman,
Daniel Carbone, Vincent Gould,

Nathan Johnson,

Anna
Belle Leiserson,
Riyad
Naser,
Ross
Oreto
, Scott Sobecki, Jim
Tibbetts, Mikhail
Zemmel


Funding:
Kleberg/Martell/Anonymous Foundations; BMS; GE


Awards/Grants:



HHS/Office for the National Coordinator for HIT (ONC)
public data and cancer challenge
to
create
health IT applications that use public data and existing technology to help patients and
health care professionals prevent, detect, diagnose and treat
cancer (Health 2.0)


GE
HealthyImagination




We welcome academic/industry/gov’t partnerships!




Acknowledgements