Bioinformatics and Stem Cell Research - Harvard University LS ...

wickedshortpumpBiotechnology

Oct 1, 2013 (3 years and 10 months ago)

64 views

Express Yourself!

A BioinFORMatics Web Quest


Exploring the Use of Genetic Markers In Stem Cell Research.


By David M. Form

Nashoba Regional High School


Your Task

We are pleased that you have chosen to conduct your doctoral research in our
laboratory! Our

research is aimed at comparing the properties of embryonic stem cells,
cancer cells and differentiated cells,
in vitro
. Gene D’Ranged, our cell culture technician,
has recently left for Outer Mongolia to attend medical school. After receiving his
accepta
nce letter he became lax and neglected to label the flasks containing our various
cell cultures.

For this project you will use your bioinformatics skills to assist us in identifying
the cells that we have in culture. These include stem cells, various diff
erentiated cells and
retinoblastoma (a tumor of the neural tissue in the eye) cells. You will be collaborating
with other scientists, who will isolate RNA from your cells, make labeled cDNA from
your mRNA and sequence the cDNA.

Each member of your group w
ill be assigned two different cell cultures to
identify. A collaborating scientist has isolated RNA molecules from each cell culture and
determined the sequence of each isolated RNA molecule. The RNA was copied into
single
-
stranded DNA, or cDNA, which was
then sequenced. You will be given the cDNA
sequences to use in your bioinformatics research.

Your first task is to determine the identity of the gene represented by each RNA.
This will tell you which genes are being expressed by that particular cell cultu
re.
Identification of the genes can be done using
BLAST
, the Basic Local Alignment Search
Tool. Remember that you must use BLASTn, since you are using nucleotide sequences
as your query.

Once you identify each gene with BLAST, you will use
GeneNote

to id
entify the
gene expression profile for each gene. Scientists at the Weizmann Institute have
performed microarray analyses for each gene in their database. The results are posted in
an online database called
GeneNote
. When you get to GeneNote, just enter t
he symbol
for your gene in the input window, click on search and the microarray results will be
plotted as a bar graph, indicating the level of RNA for this gene as expressed in various
tissues. You will need to look at the expression patterns of all RNA
molecules isolated
from your cells in order to make an accurate identification.

Additional information about each genetic marker can be obtained by clicking on
the link to
GeneCards
. The GeneCards entry for a gene can be accessed directly form
GeneNote by

clicking on the GeneCards ID number in the window. The full name of the
gene can be found at the top of the GeneCard page for a gene. Headings for specific
information sections are located along the left side of the GeneCard page. Information
about the fu
nction of a gene product can be found under the
Gene Function

section.

When you are done, get together with the other members of your group, fill out a
cell identification profile for each cell and complete the Critical Thinking Exercises
section of this
activity. Happy data mining!



Background


Genetic markers of cell differentiation:


Each cell in the human body contains the genetic instructions for making any of
the thousands of human gene products. However only a relatively few genes are in use, or
e
xpressed, in a given cell at a given time. Some of these expressed genes can be utilized
as markers to help in the identification of specific cells or tissues. Genes that are uniquely
expressed in particular cell types can be used as genetic markers to hel
p in the
identification of these cells. Other genes that are more uniformly expressed among all, or
most, cell types are called housekeeping genes because they are involved in processes
that are common to all cells. Housekeeping genes are not generally use
ful as genetic
markers. Of course there is a spectrum of gene expression profiles with most genes being
expressed by a few or many different cell types. Another consideration is that genes may
be turned on or off in a given tissue at different times. For t
hese reasons, you will need to
look at more than one gene in order to identify your cells.

Embryonic stem cells are difficult to identify because they are capable of forming
a large number of differentiated cell types. This property of stem cells is known
as
pluripotency. Other stem cells are multipotent. Meaning they can differentiate to form a
limited number of tissue
-
specific cell types. These multipotent stem cells have been
identified in the brain, lungs, the bone marrow and other organs. Recently, se
veral
genetic markers have been identified that are associated with embryonic stem cells.
Among these embryonic stem cell markers are Prou5f1 (Oct
-
4), Nanog and Sox2, among
others. Genetic markers have also been found for some of the multipotent stem cel
ls
found in various organs and tissues.


Microarray analysis


Microarrays are glass slides or silicon chips that have single stranded copies of
genes arranged in linear arrays. Microarray analysis consists of isolating RNA from cells
or tissues. Single
-

stranded DNA, complementary to the RNA, is prepared and labelled
with a flourescent dye. This labelled cDNA is allowed to bind with its complement on the
microarray. The microarray is analyzed with a laser that causes the labelled cDNA
molecules to glow. T
he pattern of fluorescent dots indicates which genes are represented
by the original RNA molecules that were isolated from the cells. Some microarrays are
capable of analyzing over 100,000 genes on a single chip. The difference in expression of
a gene by v
arious tissues is known as an expression profile for that gene.


BLAST


BLAST stands for Basic Local Alignment and Search Tool. This is, by far, the
most commonly used bioinformatics tool. It can be located at the NCBI website. NCBI
stands for the Nationa
l Center for Biotechnology Information. It’s website (http://
www.ncbi.nlm.nih.gov
) houses databases of genomic, proteomic and transcriptional
information, PubMed , OMIM and bioinformatics tools, such as BLAST
and ORF
-
finder.


Select BLAST from the menu at the top of the NCBI home page. Select
nucleotide BLAST from the menu. Paste your cDNA sequence into the Query Sequence
window and click on the BLAST button on the lower right hand side of the page. BLAST
will
look for known nucleotide sequences (genes) that are similar to your sequence. The
results of the search will be presented in a “hit list”,or table, in order of decreasing
similarity.


When your search is done, look at the transcripts table in the results

window.
Your gene should be the first transcript in the list. Under the Transcripts column, on the
left of the table is the accession number for your gene. This is a link to the NCBI file for
the nucleotide sequence of this gene. Under the heading “Descr
iption, you will find the
name and symbol for this gene. Use the symbol for your search in GeneNote.


GeneNote

(from the GeneNote website @ http://bioinfo2.weizmann.ac.il/cgi
-
bin/genenote/about_page.pl:)

GeneNote
is a database of
human
genes and their exp
ression profiles in
healthy
tissues. It is based on Weizmann Institute of Science DNA array experiments, which
were performed on the Affymetrix HG
-
U95 set A
-
E.

It offers:



• An expression profile
(tissue vector)
for each gene in the human genome



• Gene
and tissue clustering based on expression profiles

• A full genome ranking procedure according to the gene's tendency for tissues
specificity, from tissue
-
specific to housekeeping genes.


You can find a GeneNote expression profile for the gene,
Agr3
. This
gene is
over
-
expressed in the lung but not in other tissues . Therefore, it is a candidate for
being a genetic marker of lung tissue.



GeneCards


GeneCards (
http://www.genecards.org
) is an integrated genomic dat
abase
maintained by the Weizmann Institute in Israel. You can search GeneCards by gene name
or symbol, protein, disease or biological process. You will get a list of genes that are
relevant to your query terms. Each gene is described in a GeneCard that gen
omic,
proteomic, and transcriptional information including sequence data, gene expression
profiles, gene function, SNPS, disease relationships and more.

The following information about the function of BMP4 was obtained from the
Gene Function section of the

GeneCard for BMP4:

UniProt/Swiss
-
Prot:
BMP4_HUMAN, P12644

Function
: Induces cartilage and bone formation. Also act in mesoderm induction,
tooth development, limb formation and fracture repair





Cell Identification Profile

Cell
number

Genetic
Markers
Identified

Probable Identity of Tissue

1




2




3




4




5




6




Retino

blastoma





Critical Thinking Exercises

I. Questions:

1. What are the differences between stem cells and differ
entiated cells?


2. What are genetic markers and how can they be used to identify specific cell types?


3. What are markers of differentiation?


3, What is cell differentiation and how does it occur?


4. What are microarrays (gene chips) and how can they u
sed to identify cells?


5. What is a gene expression profile?


6. Scientists theorize that at least some forms of cancer may be caused by stem cells that
proliferate and differentiate in an out of control manner. In fact, stem cells have been
identified i
n some cancers. Analyze the RNA molecules isolated from retinoblastoma
cells. What do your results tell you about the stem cell theory of cancer?





II. Quotations
:

Choose two of the following quotes. Explain, using two or three sentences for each
quotati
on, how you think that each of the following quotes could pertain to stem cells and
cellular differentiation.

1) Age is no guarantee of maturity.

Lawana Blackwell
,
The Courtship of the V
icar's Daughter, 1998


2) To live a creative life, we must lose our fear of being wrong.

Joseph Chilton Pearce


3) The secret to creativity is knowing how to hide your sources.

Albert Einstein

US (German
-
born) physicist (1879
-

1955
)


4) I'm all in favour of free expression provided it's kept rigidly under control.

Alan Bennett



III. Vocabulary:


Define each term
in your own words, using complete sentences. Cite a specific
example for each term.



Stem cell


Genetic marker


Marker of differentiation


Embryonic stem cell


Pluripotent stem cell


Multipotent stem cell


Diffferentiated Cell

Housekeeping gene


Microarra
y


cDNA


NCBI


BLAST


GeneNote

GeneCards

Cell Culture #1

RNA #1

ATGGAAATCCCGCCGACCAACTACCCAGCCTCCAGGGCGGCCTTGGTGGCACAGA
ACTACATCAACTACCAGCAGGGGACCCCGCACAGGGTGTTTGAGGTGCAGAAGGT
CAAACAAGCCAGCATGGAGGATATTCCAGGAAGAGGACATAAGTATCGCCTTAAA
TTTGCTGTTGAAGAAATTATACAAAA
ACAAGTTAAGGTGAACTGCACAGCTGAAG
TACTTTACCCTTCAACGGGACAAGAAACTGCACCAGAAGTCAACTTCACATTTGA
AGGAGAAACTGGAAAGAATCCAGATGAAGAAGACAACACATTTTATCAAAGACTT
AAGTCCATGAAGGAACCGCTAGAAGCACAAAATATTCCAGACAATTTTGGAAATG
TATCTCCAGAAATGACGCTCGTTCTACATTTAGCCTGGGTTGCCTGTGGTTATAT
AATATGG
CAAAATTCTACTGAAGACACATGGTATAAAATGGTAAAAATTCAAACT
GTCAAGCAAGTGCAAAGAAATGATGACTTTATTGAATTAGACTACACCATTCTAC
TTCATAATATAGCATCTCAGGAGATTATTCCCTGGCAAATGCAAGTTCTCTGGCA
TCCACAATACGGCACTAAAGTAAAACATAATAGCCGTCTGCCAAAGGAAGTACAA
CTGGAATAA



RNA #2

GCCATGGCTGAGTCACACCTGCTG
CAGTGGCTGCTGCTGCTGCTGCCCACGCTCT
GTGGCCCAGGCACTGCTGCCTGGACCACCTCATCCTTGGCCTGTGCCCAGGGCCC
TGAGTTCTGGTGCCAAAGCCTGGAGCAAGCATTGCAGTGCAGAGCCCTAGGGCAT
TGCCTACAGGAAGTCTGGGGACATGTGGGAGCCGATGACCTATGCCAAGAGTGTG
AGGACATCGTCCACATCCTTAACAAGATGGCCAAGGAGGCCATTTTCCAGGACAC
GATGA
GGAAGTTCCTGGAGCAGGAGTGCAACGTCCTCCCCTTGAAGCTGCTCATG
CCCCAGTGCAACCAAGTGCTTGACGACTACTTCCCCCTGGTCATCGACTACTTCC
AGAACCAGACTGACTCAAACGGCATCTGTATGCACCTGGGCCTGTGCAAATCCCG
GCAGCCAGAGCCAGAGCAGGAGCCAGGGATGTCAGACCCCCTGCCCAAACCTCTG
CGGGACCCTCTGCCAGACCCTCTGCTGGACAAGCTCGTCCT
CCCTGTGCTGCCCG
GGGCCCTCCAGGCGAGGCCTGGGCCTCACACACAGGATCTCTCCGAGCAGCAATT
CCCCATTCCTCTCCCCTATTGCTGGCTCTGCAGGGCTCTGATCAAGCGGATCCAA
GCCATGATTCCCAAGGGTGCGCTAGCTGTGGCAGTGGCCCAGGTGTGCCGCGTGG
TACCTCTGGTGGCGGGCGGCATCTGCCAGTGCCTGGCTGAGCGCTACTCCGTCAT
CCTGCTCGACACGCTGCTGGGC
CGCATGCTGCCCCAGCTGGTCTGCCGCCTCGTC
CTCCGGTGCTCCATGGATGACAGCGCTGGCCCAAGGTCGCCGACAGGAGAATGGC
TGCCGCGAGACTCTGAGTGCCACCTCTGCATGTCCGTGACCACCCAGGCCGGGAA
CAGCAGCGAGCAGGCCATACCACAGGCAATGCTCCAGGCCTGTGTTGGCTCCTGG
CTGGACAGGGAAAAGTGCAAGCAATTTGTGGAGCAGCACACGCCCCAGCTGCTGA
CCC
TGGTGCCCAGGGGCTGGGATGCCCACACCACCTGCCAGGCCCTCGGGGTGTG
TGGGACCATGTCCAGCCCTCTCCAGTGTATCCACAGCCCCGACCTTTGATGAGAA
CTCAGCTGTCCAGCTGCAAAGGAAAAGCCAAGTGAGACGGGCTCTGGGACCATGG
TGACCAGGCTCTTCCCCTGCTCCCTGGCCCTCGCCAGCTGCCAGGCTGAAAAGAA
GCCTCAGCTCCCACACCGCCCTCCTCACCGCCCTTCCTC
GGCAGTCACTTCCACT
GGTGGACCACGGGCCCCCAGCCCTGTGTCGGCCTTGTCTGTCTCAGCTCAACCAC
AGTCTGACACCAGAGCCCACTTCCATCCTCTCTGGTGTGAGGCACAGCGAGGGCA
GCATCTGGAGGAGCTCTGCAGCCTCCACACCTACCACGACCTCCCAGGGCTGGGC
TCAGGAAAAACCAGCCACTGCTTTACAGGACAGGGGGTTGAAGCTGAGCCCCGCC
TCACACCCACCCCCATGCAC
TCAAAGATTGGATTTTACAGCTACTTGCAATTCAA
AATTCAGAAGAATAAAAAATGGGAACATACAGAACTCTAAAAGATAGACATCAGA
AATTGTTAAGTTAAGCTTTTTCAAAAAATCAGCAATTCCCCAGCGTAGTCAAGGG
TGGACACTGCACGCTCTGGCATGATGGGATGGCGACCGGGCAAGCTTTCTTCCTC
GAGATGCTCTGCTGCTTGAGAGCTATTGCTTTGTTAAGATATAAAAAGGGGTTTC
T
TTTTGTCTTTCTGTAAGGTGGACTTCCAGCTTTTGATTGAAAGTCCTAGGGTGA
TTCTATTTCTGCTGTGATTTATCTGCTGAAAGCTCAGCTGGGGTTGTGCAAGCTA
GGGACCCATTCCTGTGTAATACAATGTCTGCACCAATGCTAATAAAGTCCTATTC
TCTTTTATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA




Cell Culture #2

RNA #1

AGTGTTATGATGCAGTTC
CACAACACACAGCCACATTCACCCACAGACCGAGGTA
CAGAACGAGAGACAACCTCTGCCCCCCCAGCAGCTGGCCAGCTTTGCAGCCCCAG
TCTTGAGCCCCCAACTACCCTCCCCCCACCCACCCCCATCCCCTTCCCAATTGAA
GGAGCGGAAAGAGAAGAGAGAAGAGTGAGCAGAGAGATTGAGAGATTGAGAGAGA
GAGAGAGAGATAGACGGAGATCTCTGGAGCAGACCTCAAGGTGACTTCTATTTC
T
ATCTGGTTCTCGTCTGGGGGGGCCCTGGCCGGGCAGCCCCCCAACACTTCTCCTG
CCCTGAAACACGGCTCTAGCCAACCTGCTCCGCTGCTTCACCTGCGACCGTCTCT
GCGGGGGCTGCACGGCGCCAGCCCCTCCAGCCCACCAGGGCATTGTCCTCCAGCC
CGTCATGCCCAGCTGTGACCCCGGTCCGGGCCCTGCCTGCCTCCCCACCAAGACT
TTCCGCAGCTATCTGCCCCGCTGTCACCGCACTTA
CAGCTGTGTCCACTGCCGTG
CACACCTGGCCAAACACGATGAGCTTATTTCCAAGTCCTTCCAAGGGAGCCATGG
CCGAGCCTACCTGTTTAACTCCGTGGTCAACGTGGGTTGCGGGCCAGCTGAACAG
CGCCTCTTGCTCACGGGGCTCCACTCGGTAGCTGACATTTTCTGTGAGAGCTGCA
AAACCACACTGGGCTGGAAATATGAGCAAGCTTTTGAGACGAGCCAGAAGTACAA
GGAAGGGAAATACATC
ATTGAAATGTCACACATGGTGAAGGACAACGGCTGGGAC
TGAGGGGCTCAGGCAGGGTGTGCCCTTCCTCCGCATGCCCCTCCCTCCCCACGGC
CCTGCCAAGCAGTCTATACCAGCATGAGTACTGCCCCACCCCTGGGGGAAACCTG
GCTCCAACCAACCCCTCCCCTGCCTCCACCATATCCACTACCAGGCACCCTTTAG
AACAGGGGTCTGGGGGTACCCCAGGGGTGTTAAGGCTCAGGAGTGGGCAGCA
GTC
AGGGAGAGACAGAACTGGGGGAAAGGGATGGTTGTGGGTCTTTCTGTTCCCAAGA
TCCTGAACATGGAAGCGATGGCAGGGCATAGACTCAGGCAGAGAGGATTGTGGGA
GGAATCCGTTTTTGCTCCACCTCTTTTTGAGTGAACAGAGGACAAACCTTGGGTC
ACAGGGCAAGTAGATCATGGACCACAGAACAGCAGATGAGAAAAGACTTGGGTTG
GAGTGAAATTCTGGTCTCAGACACCAGGAGACC
AGAGTCTCTGAGGATGAAGTTT
CCTACCCCTATTTGTAGGGAAAAGGACTTGAGTGCAGGGAAAACTCAAATCCCAG
GCCCTGGGAAATAGTAAAATAATCAAAGGGTTTTCCATTTCACTCCACTTGTTAG
TTTATCTTGGCACTGAAGAGGCACTTTCGAGTATCTAACTTTTGCCATTGGGTGG
GGTGGGGACAGCTGCTCGCGGAACAGCCCCTAGTCGGCTGCTTCCAGAGTAAGCA
GTCTTTATGGGCTT
TCTCTGAGGCCCAGTCACTGCTCCTGGGACCCAGTCCCCTG
GAGGGGAGGTGGAAAATCAGTGCTACGGGGCCAGTCTTTCCCGTGGCTGCCACCA
GCGAATGAAACTTTTGTATGATACATAAAGTGCTTGAGTCTATTTTTAATAAAAA
GGGAAAAAGCAACTTG




RNA #2

ATGAGCTACACGTTGGACTCGCTGGGCAACCCGTCCGCCTACCGGCGGGTAACCG
AGACCCGCTCGAGCTTCAGCCGC
GTCAGCGGCTCCCCGTCCAGTGGCTTCCGCTC
GCAGTCGTGGTCCCGCGGCTCGCCCAGCACCGTGTCCTCCTCCTATAAGCGCAGC
ATGCTCGCCCCGCGCCTCGCTTACAGCTCGGCCATGCTCAGCTCCGCCGAGAGCA
GCCTTGACTTCAGCCAGTCCTCGTCCCTGCTCAACGGCGGCTCCGGACCCGGCGG
CGACTACAAGCTGTCCCGCTCCAACGAGAAGGAGCAGCTGCAGGGGCTGAACGAC
CGCT
TTGCCGGCTACATAGAGAAGGTGCACTACCTGGAGCAGCAGAATAAGGAGA
TTGAGGCGGAGATCCAGGCGCTGCGGCAGAAGCAGGCCTCGCACGCCCAGCTGGG
CGACGCGTACGACCAGGAGATCCGCGAGCTGCGCGCCACCCTGGAGATGGTGAAC
CACGAGAAGGCTCAGGTGCAGCTGGACTCGGACCACCTGGAGGAAGACATCCACC
GGCTCAAGGAGCGCTTTGAGGAGGAGGCGCGGTTGCGGGA
CGACACTGAGGCGGC
CATCCGGGCGCTGCGCAAAGACATCGAGGAGGCGTCGCTGGTCAAGGTGGAGCTG
GACAAGAAGGTGCAGTCGCTGCAGGATGAGGTGGCCTTCCTGCGGAGCAACCACG
AGGAGGAGGTGGCCGACCTTCTGGCCCAGATCCAGGCATCGCACATCACGGTGGA

GCGCAAAGACTACCTGAAGACAGACATCTCGACGGCGCTGAAGGAAATCCGCTCC
CAGCTCGAAAGCCACTCAGA
CCAGAATATGCACCAGGCCGAAGAGTGGTTCAAAT
GCCGCTACGCCAAGCTCACCGAGGCGGCCGAGCAGAACAAGGAGGCCATCCGCTC
CGCCAAGGAAGAGATCGCCGAGTACCGGCGCCAGCTGCAGTCCAAGAGCATCGAG
CTAGAGTCGGTGCGCGGCACCAAGGAGTCCCTGGAGCGGCAGCTCAGCGACATCG
AGGAGCGCCACAACCACGACCTCAGCAGCTACCAGGACACCATCCAGCAGCTGGA
A
AATGAGCTTCGGGGCACAAAGTGGGAAATGGCTCGTCATTTGCGCGAATACCAG
GACCTCCTCAACGTCAAGATGGCTCTGGATATAGAAATCGCTGCGTACAGAAAAC
TCCTGGAGGGTGAAGAGACTAGATTTAGCACATTTGCAGGAAGCATCACTGGGCC
ACTGTATACACACCGACCCCCAATCACAATATCCAGTAAGATTCAGAAAACCAAG
GTGGAAGCTCCCAAGCTTAAGGTCCAACACAAATTTG
TCGAGGAGATCATAGAGG
AAACCAAAGTGGAGGATGAGAAGTCAGAAATGGAAGAGGCCCTGACAGCCATTAC
AGAGGAATTGGCCGCTTCCATGAAGGAAGAGAAGAAAGAAGCAGCAGAAGAAAAG
GAAGAGGAACCCGAAGCTGAAGAAGAAGAAGTAGCTGCCAAAAAGTCTCCAGTGA
AAGCAACTGCACCTGAAGTTAAAGAAGAGGAAGGGGAAAAGGAGGAAGAAGAAGG
CCAGGAAGAAGAGGAGGA
AGAAGATGAGGGAGCTAAGTCAGACCAAGCCGAAGAG
GGAGGATCCGAGAAGGAAGGCTCTAGTGAAAAAGAGGAAGGTGAGCAGGAAGAAG
GAGAAACAGAAGCTGAAGCTGAAGGAGAGGAAGCCGAAGCTAAAGAGGAAAAGAA
AGTGGAGGAAAAGAGTGAGGAAGTGGCTACCAAGGAGGAGCTGGTGGCAGATGCC
AAGGTGGAAAAGCCAGAAAAAGCCAAGTCTCCTGTGCCAAAATCACCAGTGGAA
G
AGAAAGGCAAGTCTCCTGTGCCCAAGTCACCAGTGGAAGAGAAAGGCAAGTCTCC
TGTGCCCAAGTCACCAGTGGAAGAGAAAGGCAAGTCTCCTGTGCCGAAATCACCA
GTGGAAGAGAAAGGCAAGTCTCCTGTGTCAAAATCACCAGTGGAAGAGAAAGCCA
AATCTCCTGTGCCAAAATCACCAGTGGAAGAGGCAAAGTCAAAAGCAGAAGTGGG
GAAAGGTGAACAGAAAGAGGAAGAAGAAAAGGAAG
TCAAGGAAGCTCCCAAGGAA
GAGAAGGTAGAGAAAAAGGAAGAGAAACCAAAGGATGTGCCAGAGAAGAAGAAAG
CTGAGTCCCCTGTAAAGGAGGAAGCTGTGGCAGAGGTGGTCACCATCACCAAATC
GGTAAAGGTGCACTTGGAGAAAGAGACCAAAGAAGAGGGGAAGCCACTGCAGCAG
GAGAAAGAGAAGGAGAAAGCGGGAGGAGAGGGAGGAAGTGAGGAGGAAGGGAGTG
ATAAAGGTGCCAAGGG
ATCCAGGAAGGAAGACATAGCTGTCAATGGGGAGGTAGA
AGGAAAAGAGGAGGTAGAGCAGGAGACCAAGGAAAAAGGCAGTGGGAGGGAAGAG
GAGAAAGGCGTTGTCACCAATGGCCTAGACTTGAGCCCAGCAGATGAAAAGAAGG
GGGGTGATAAAAGTGAGGAGAAAGTGGTGGTGACCAAAACGGTAGAAAAAATCAC
CAGTGAGGGGGGAGATGGTGCTACCAAATACATCACTAAATCTGTAACCGTC
ACT
CAAAAGGTTGAAGAGCATGAAGAGACCTTTGAGGAGAAACTAGTGTCTACTAAAA
AGGTAGAAAAAGTCACTTCACACGCCATAGTAAAGGAAGTCACCCAGAGTGACTA
A


Cell Culture #3

RNA #1

ATGGTTGATTTGGAGAGCGAAGTGCCCCCTCTGCCTCCCAGGTACAGGTTTCGAG
ATTTGCTGCTAGGGGACCAAGGATGGCAAAACGACGACAGGGTACAAGTTGAATT
CTATAT
GAATGAAAATACATTTAAAGAAAGACTAAAATTATTTTTCATAAAAAAC
CAGAGATCAAGTCTAAGGATACGCCTGTTCAATTTTTCTCTCAAATTACTAAGCT
GCTTATTATACATAATCCGAGTACTACTAGAAAACCCTTCACAAGGAAATGAATG
GTCTCATATCTTTTGGGTGAACAGAAGTCTACCTTTGTGGGGCTTACAGGTTTCA
GTGGCATTGATAAGTCTGTTTGAAACAATATTACTTGGTTAT
CTTAGTTATAAGG
GAAACATCTGGGAACAGATTTTACGAATACCCTTCATCTTGGAAATAATTAATGC
AGTTCCCTTCATTATCTCAATATTCTGGCCTTCCTTAAGGAATCTATTTGTCCCA
GTCTTTCTGAACTGTTGGCTTGCCAAACATGCCTTGGAAAATATGATTAATGATC
TACACAGAGCCATTCAGCGTACACAGTCTGCAATGTTTAATCAAGTTTTGATTTT
AATATCTACATTACTATGCCTTA
TCTTCACCTGCATTTGTGGGATCCAACATCTG
GAACGAATAGGAAAGAAGCTGAATCTCTTTGACTCCCTTTATTTCTGCATTGTGA
CGTTTTCTACTGTGGGCTTCGGGGATGTCACTCCTGAAACATGGTCCTCCAAGCT

TTTTGTAGTTGCTATGATTTGTGTTGCTCTTGTGGTTCTACCCATACAGTTTGAA
CAGCTGGCTTATTTGTGGATGGAGAGACAAAAGTCAGGAGGAAACTATAGTCGAC
ATA
GAGCTCAAACTGAAAAGCATGTCGTCCTGTGTGTCAGCTCACTGAAGATTGA
TTTACTTATGGATTTTTTAAATGAATTCTATGCTCATCCTAGGCTCCAGGATTAT
TATGTGGTGATTTTGTGTCCTACTGAAATGGATGTACAGGTTCGAAGGGTACTGC
AGATTCCAATGTGGTCCCAACGAGTTATCTACCTTCAAGGTTCAGCCCTTAAAGA
TCAAGACCTATTGAGAGCAAAGATGGATGACGCTGAGGC
CTGTTTTATTCTCAGT
AGCCGTTGTGAAGTGGATAGGACATCATCTGATCACCAAACAATTTTGAGAGCAT
GGGCTGTGAAAGATTTTGCTCCAAATTGTCCTTTGTATGTCCAGATATTAAAGCC
TGAAAATAAATTTCACATCAAATTTGCTGATCATGTTGTTTGTGAAGAAGAGTTT
AAATACGCCATGTTAGCTTTAAACTGTATATGCCCAGCAACATCTACACTTATTA
CACTACTGGTTCATACCTCT
AGAGGGCAAGAAGGCCAGCAATCGCCAGAACAATG
GCAGAAGATGTACGGTAGATGCTCCGGGAATGAAGTCTACCACATTGTTTTGGAA
GAAAGTACATTTTTTGCTGAATATGAAGGAAAGAGTTTTACATATGCCTCTTTCC

ATGCACACAAAAAGTTTGGCGTCTGCTTGATTGGTGTTAGGAGGGAGGATAATAA
AAACATTTTGCTGAATCCAGGTCCTCGATACATTATGAATTCTACAGACATATGC
TTTTATATTAATATTACCAAAGAAGAGAATTCAGCATTTAAAAACCAAGACCAGC
AGAGAAAAAGCAATGTGTCCAGGTCGTTTTATCATGGACCTTCCAGATTACCTGT
ACATAGCATAATTGCCAGCATGGGTACTGTGGCTATAGACTTGCAAGATACAAGC
TGTAGATCAGCAAGTGGCCCTACCCTGTCTCTTCCTACAGAGGGAAGCAAAGAAA
TAAGAAGACCTAGCATTGCTCCTGTTTTAGAGGTTG
CAGATACATCATCGATTCA
AACATGTGATCTTCTAAGTGACCAATCAGAAGATGAAACTACACCAGATGAAGAA
ATGTCTTCAAACTTAGAGTATGCTAAAGGTTACCCACCTTATTCTCCATATATAG
GAAGTTCACCCACTTTTTGTCATCTCCTTCATGAAAAAGTACCATTTTGCTGCTT
AAGATTAGACAAGAGTTGCCAACATAACTACTATGAGGATGCAAAAGCCTATGGA
TTCAAAAATAAACTAAT
TATAGTTGCAGCTGAAACAGCTGGAAATGGATTATATA
ACTTTATTGTTCCTCTCAGGGCATATTATAGACCAAAGAAAGAACTTAATCCCAT
AGTACTGCTATTGGATAACCCGCCAGATATGCATTTTCTGGATGCAATCTGTTGG

TTTCCAATGGTTTACTACATGGTGGGCTCTATTGACAACCTAGATGACTTACTCA
GGTGTGGAGTGACTTTTGCTGCTAATATGGTGGTTGTGGATAAAGAGAGCAC
CAT
GAGTGCCGAGGAAGACTACATGGCAGATGCCAAAACCATTGTGAACGTGCAGACA
CTCTTCAGGTTGTTTTCCAGTCTCAGTATTATCACAGAGCTAACTCACCCCGCCA
ACATGAGATTCATGCAATTCAGAGCCAAAGACTGTTACTCTCTTGCTCTTTCAAA
ACTGGAAAAGAAAGAACGGGAGAGAGGCTCTAACTTGGCCTTTATGTTTCGACTG
CCTTTTGCTGCTGGGAGGGTGTTTAGCATCAGT
ATGTTGGACACTCTGCTGTATC
AGTCATTTGTGAAGGATTATATGATTTCTATCACGAGACTTCTGTTGGGACTGGA
CACTACACCAGGATCTGGGTTTCTTTGTTCTATGAAAATCACTGCAGATGACTTA
TGGATCAGAACTTATGCCAGACTTTATCAGAAGTTGTGTTCTTCTACTGGAGATG
TTCCCATTGGAATCTACAGGACTGAGTCTCAGAAACTTACTACATCTGAGTCTCA
AATATCTATCAGTG
TAGAAGAGTGGGAAGACACCAAAGACTCCAAAGAACAAGGG
CACCACCGCAGCAACCACCGCAACTCAACATCCAGTGACCAGTCGGACCATCCCT
TGCTGCGGAGAAAAAGCATGCAGTGGGCCCGAAGACTGAGCAGAAAAGGCCCAAA

ACACTCTGGTAAAACAGCTGAAAAAATAACCCAGCAGCGACTGAACCTCTACAGG
AGGTCAGAAAGACAAGAGCTTGCTGAACTTGTGAAAAATAGAATGAAAC
ACTTGG
GTCTTTCTACAGTGGGATATGATGAAATGAATGATCATCAAAGTACCCTCTCCTA
CATCCTGATTAACCCATCTCCAGATACCAGAATAGAGCTGAATGATGTTGTATAC
TTAATTCGACCAGATCCACTGGCCTACCTTCCAAACAGTGAGCCCAGTCGAAGAA
ACAGCATCTGCAATGTCACTGGTCAAGATTCTCGGGAGGAAACTCAACTTTGA




RNA #2

ATGATGAACATGTCTTTACCT
TTTCTTTGGAGTTTGCTTACCTTATTAATATTTG
CTGAAGTAAATGGCGAACGTGGAGAACTTGAGCTGCAGAGACAAAAAAGAAGCAT
CAATCTCCAACAGCCTCGAATGGCTACAGAGAGAGGAAATTTGGTGTTTCTTACG
GGGTCTGCTCAAAACATTGAGTTTAGAACCGGATCCCTGGGAAAAATTAAATTAA
ATGATGAAGATCTCAGTGAGTGTTTACATCAGATCCAGAAAAACAAAGAAGATAT
TA
TAGAGTTAAAAGGGAGCGCAATTGGTCTGCCTCAAAATATATCTAGTCAAATC
TATCAGCTTAATTCCAAGCTGGTGGATCTTGAGAGAAAATTCCAAGGCTTGCAGC
AGACTGTTGACAAAAAGGTTTGCAGCAGCAATCCTTGCCAGAATGGTGGGAACTG
CCTCAATCTGCATGATTCCTTTTTTTGTATCTGTCCCCCACAGTGGAAGGGTCCT
CTCTGCTCAGCTGATGTTAACGAATGTGAGATTTACTC
AGGAACACCCTTGAGCT
GCCAGAATGGAGGCACATGTGTTAATACAATGGGAAGTTACAGTTGTCACTGCCC
ACCTGAGACGTACGGACCCCAGTGTGCATCCAAATATGACGACTGTGAAGGGGGT
TCTGTGGCACGCTGTGTCCATGGCATCTGTGAGGATTTAATGCGAGAGCAAGCTG
GAGAGCCCAAGTACAGCTGCGTCTGTGATGCTGGGTGGATGTCTTCACCCAACAG
CCCTGCCTGCACGCTGGAC
AGAGACGAGTGCAGCTTCCAGCCCGGGCCTTGCTCC
ACACTTGTGCAGTGTTTCAACACTCAAGGCTCTTTCTACTGTGGGGCCTGTCCAA
CAGGCTGGCAAGGCAATGGATATATTTGCGAAGATATCAATGAATGTGAGATAAA
TAATGGCGGCTGTTCTGTGGCTCCACCCGTTGAGTGTGTGAATACACCTGGGTCT
TCCCACTGCCAGGCCTGTCCACCAGGGTACCAGGGTGACGGAAGAGTGTGCACAC
TCACAGACATCTGCTCAGTCAGTAATGGAGGCTGCCACCCAGATGCCTCATGCTC
CTCAACTCTAGGTTCCTTACCTCTCTGCACGTGTCTCCCGGGTTATACTGGAAAT
GGTTATGGGCCAAATGGATGTGTGCAGCTCAGTAATATTTGCCTAAGTCACCCCT
GTCTAAATGGACAATGCATCGACACTGTCTCTGGTTATTTTTGTAAGTGTGACTC
AGGTTGGACAGGTGTCAACTGTACAGAAAACATCAA
TGAGTGTTTGAGCAACCCC
TGTTTGAATGGAGGAACTTGTGTTGATGGCGTTGATTCTTTCAGTTGTGAATGCA
CACGTCTCTGGACTGGAGCTCTCTGTCAGGTTCCTCAGCAAGTTTGTGGAGAGTC
CCTCTCAGGAATAAATGGAAGCTTCAGCTACAGGAGCCCGGATGTTGGTTATGTT
CATGATGTTAACTGCTTCTGGGTTATCAAAACTGAAATGGGAAAGGTCCTGCGTA
TCACTTTCACTTTTTTC
CGGTTAGAATCCATGGACAACTGTCCACACGAGTTTCT
TCAGGTTTATGATGGAGATTCCTCTTCTGCTTTTCAACTTGGAAGATTTTGTGGC
TCCAGCCTCCCTCATGAACTCCTCAGCAGTGACAATGCTCTCTATTTTCATCTCT
ATTCTGAACATTTAAGAAATGGGAGAGGCTTTACAGTAAGATGGGAAACACAGCA
ACCAGAGTGTGGAGGTATCCTGACTGGTCCTTACGGTTCTATTAAGTCTCCGG
GG
TATCCTGGAAACTATCCCCCAGGAAGAGATTGTGTCTGGATTGTTGTAACTAGTC
CTGACCTCCTGGTAACATTTACTTTTGGGACCTTGAGCCTCGAGCACCATGATGA
CTGCAACAAAGATTACCTTGAGATTCGAGATGGTCCTTTGTATCAGGACCCCCTT
CTTGGGAAGTTCTGCACCACTTTCTCTGTCCCACCGCTCCAGACTACTGGCCCCT
TTGCCAGAATTCACTTCCATTCAGACTCCCAGAT
TAGTGACCAAGGCTTCCATAT
CACCTACTTAACATCACCTTCGGATCTGCGTTGTGGTGGGAACTACACGGACCCA
GAGGGTGAACTCTTCTTGCCTGAGTTGTCTGGGCCTTTCACTCACACCAGGCAAT
GCGTCTATATGATGAAGCAGCCCCAGGGAGAACAAATACAAATCAACTTCACCCA
CGTGGAGCTGCAATGCCAGAGTGACAGTTCTCAGAATTACATTGAGGTTCGAGAT
GGTGAAACCTTACTT
GGAAAAGTCTGTGGCAACGGAACCATCTCTCACATTAAAT
CCATTACTAATAGTGTCTGGATCAGGTTTAAAATAGATGCTTCTGTTGAAAAAGC
TAGTTTCAGAGCTGTTTATCAAGTCGCTTGCGGGGATGAATTAACTGGAGAAGGG
GTCATTCGCTCGCCTTTTTTTCCTAACGTGTATCCTGGAGAAAGAACCTGTAGGT
GGACCATCCACCAGCCCCAAAGCCAAGTCATTCTCCTCAACTTCACTGTCT
TTGA
AATTGGAAGTTCTGCCCACTGTGAAACAGATTATGTTGAGATTGGTAGCAGTTCC
ATTTTGGGTTCTCCTGAAAATAAAAAGTATTGCGGTACAGACATACCTTCATTTA
TAACATCTGTGTACAATTTTCTTTATGTCACATTCGTGAAAAGTTCTTCTACTGA
AAACCATGGTTTCATGGCTAAGTTCAGTGCTGAGGATTTGGCATGTGGAGAAATT
CTTACAGAATCAACAGGGACCATTCAAAGTCC
TGGCCATCCAAATGTCTACCCCC
ACGGTATCAACTGTACTTGGCATATATTAGTCCAACCTAATCACCTGATTCATTT
AATGTTCGAAACATTTCATCTGGAGTTTCATTACAATTGCACAAACGACTACTTG
GAAGTTTATGACACCGACTCTGAGACATCCCTTGGAAGATACTGTGGAAAGTCGA
TCCCGCCATCTCTCACAAGCAGTGGTAACTCATTGATGCTGGTGTTTGTGACTGA
CTCCGACCTCGCT
TATGAAGGCTTCTTAATAAACTATGAAGCAATCAGTGCAGCA
ACAGCATGTTTGCAAGACTACACAGATGATTTGGGGACATTCACTTCTCCAAACT
TCCCCAATAATTATCCCAACAACTGGGAATGCATTTATCGGATCACAGTGAGAAC
TGGCCAACTGATTGCAGTGCACTTCACAAACTTCTCCTTGGAGGAAGCCATTGGA
AACTATTATACAGATTTTCTGGAAATCAGAGATGGAGGCTATGAAAAAT
CACCAT
TGCTGGGAATATTCTATGGCTCAAATCTACCCCCAACAATCATCTCTCATAGTAA
CAAACTATGGTTAAAATTTAAGAGTGACCAAATAGACACAAGGTCTGGATTCTCA
GCTTACTGGGATGGGTCATCAACAGGTTGCGGGGGTAATCTCACCACTTCAAGCG
GTACGTTCATATCTCCCAACTACCCGATGCCCTATTACCACAGCTCTGAATGCTA
CTGGTGGTTGAAATCTAGCCACGGCAGCGC
ATTTGAACTGGAATTCAAAGACTTT
CACTTGGAGCATCATCCAAACTGCACTTTAGATTACCTGGCTGTATATGATGGCC
CAAGTAGCAACTCTCATCTGCTAACTCAGCTTTGTGGGGATGAGAAACCCCCTCT
TATTCGTTCTAGTGGAGACAGCATGTTTATAAAACTGAGGACAGATGAAGGTCAG
CAAGGACGTGGCTTCAAGGCTGAATACCGGCAGACATGTGAGAATGTGGTAATAG
TCAATCAAACC
TATGGCATCTTAGAGAGTATAGGGTATCCGAATCCTTATTCTGA
AAATCAGCATTGCAACTGGACCATCCGGGCAACAACAGGCAACACTGTGAACTAC
ACATTTTTAGCATTTGACTTGGAACATCACATAAACTGCTCCACAGATTATTTAG
AGCTCTATGATGGACCACGGCAGATGGGACGCTACTGTGGAGTAGACCTGCCCCC
TCCAGGGAGTACTACAAGCTCCAAGCTTCAAGTGCTGCTCCTTACAG
ATGGGGTT
GGCCGCCGTGAGAAAGGATTTCAGATGCAGTGGTTTGTTTACGGTTGTGGTGGAG
AGCTGTCTGGGGCCACAGGCTCCTTCAGCAGCCCCGGGTTCCCCAACAGGTATCC
ACCAAACAAGGAGTGTATCTGGTACATTAGGACGGACCCCGGGAGTAGCATTCAG
CTCACCATCCATGACTTCGATGTGGAGTATCATTCAAGGTGCAACTTTGATGTCT
TGGAGATCTATGGAGGCCCCGATTTCCA
CTCTCCCAGAATAGCCCAACTGTGTAC
CCAGAGATCACCTGAGAACCCCATGCAGGTCTCCAGCACTGGAAATGAGCTAGCA
ATTCGATTCAAGACCGACTTGTCCATAAATGGGAGAGGCTTCAATGCGTCATGGC
AAGCAGTCACTGGAGGTTGTGGTGGGATTTTCCAGGCTCCCAGTGGAGAGATTCA
TTCTCCAAATTACCCCAGTCCTTATAGGAGCAACACAGACTGTTCTTGGGTCATT
CGGGTTGAC
AGATATCATCGTGTTCTCTTGAACTTCACTGACTTTGATCTTGAAC
CACAAGACTCTTGTATTATGGCATACGATGGCTTAAGCTCCACAATGTCCCGCCT
TGCCAGGACGTGTGGAAGGGAGCAGCTGGCTAACCCCATCGTCTCCTCAGGAAAC
AGCCTCTTCTTGAGATTTCAGTCTGGCCCTTCCAGACAGAACAGAGGCTTCCGAG
CTCAATTCAGGCAAGCCTGCGGAGGCCACATCCTCACCAGCTCAT
TTGATACTGT
TTCCTCTCCACGGTTCCCTGCCAATTATCCAAACAATCAGAACTGCAGCTGGATC
ATTCAAGCGCAACCTCCATTAAATCATATCACCCTCTCTTTTACCCACTTTGAAC
TTGAAAGAAGCACAACGTGTGCACGTGACTTTGTAGAAATTTTGGATGGCGGCCA
CGAAGACGCGCCCCTCCGAGGCCGTTACTGTGGCACCGACATGCCCCATCCTATC
ACATCCTTCAGCAGCGCCCTGACGCT
GAGATTCGTCTCTGATTCTAGCATCAGTG
CTGGGGGTTTCCACACCACGGTCACCGCATCAGTGTCGGCTTGTGGTGGAACGTT
CTACATGGCTGAAGGCATCTTCAACAGCCCTGGCTACCCAGACATTTATCCCCCT
AATGTGGAATGTGTCTGGAACATCATCAGTTCCCCTGGCAACCGGCTCCAGCTGT
CTTTTATATCTTTCCAGTTGGAAGACTCTCAGGACTGCAGCAGAGATTTTGTGGA
GATCCGT
GAAGGAAATGCCACGGGTCACTTGGTGGGACGATACTGTGGAAACTCC
TTCCCTCTCAATTATTCTTCCATCGTTGGACATACCCTGTGGGTCAGATTTATCT
CAGATGGTTCTGGCAGCGGCACGGGCTTCCAGGCCACATTTATGAAGATATTTGG
CAATGATAATATTGTGGGAACTCATGGGAAAGTCGCCTCTCCTTTCTGGCCTGAA
AACTACCCACATAACTCCAATTACCAATGGACAGTAAATGTGA
ATGCATCTCACG
TTGTCCATGGTAGAATCTTGGAGATGGACATAGAAGAAATACAAAACTGCTATTA
TGACAAATTAAGGATCTATGATGGGCCTAGCATTCACGCCCGCCTAATTGGAGCT
TACTGTGGTACCCAGACTGAATCTTTCAGCTCCACTGGAAATTCTTTGACATTTC
ATTTTTACTCCGACTCTTCAATCTCGGGGAAGGGATTCCTTCTGGAGTGGTTTGC
AGTGGATGCACCTGATGGTGTTTT
ACCTACCATTGCTCCAGGTGCTTGTGGTGGC
TTCCTGAGGACGGGAGATGCACCCGTGTTTCTCTTCTCCCCGGGCTGGCCTGACA
GTTACAGTAATAGAGTGGACTGTACGTGGCTCATCCAGGCTCCCGACTCTACCGT
GGAACTCAACATTCTTTCCCTGGACATTGAATCTCACCGAACGTGTGCCTATGAT
AGCCTTGTGATACGAGATGGAGATAATAACTTGGCCCAGCAGCTAGCAGTTCTCT
GTGGC
AGAGAGATCCCTGGGCCCATCCGGTCTACTGGAGAGTACATGTTCATCCG
CTTCACCTCGGACTCCAGTGTAACCAGGGCAGGCTTCAATGCATCCTTTCACAAG
AGCTGCGGTGGATATTTGCATGCAGACAGAGGGATCATCACGTCCCCCAAGTATC
CAGAGACTTACCCATCCAACCTCAACTGTTCTTGGCACGTCCTGGTCCAAAGTGG
CCTGACCATTGCTGTCCATTTTGAACAGCCTTTCCAGATTC
CAAATGGAGATTCT
TCTTGCAACCAGGGGGATTACTTGGTGCTAAGAAATGGTCCTGATATCTATTCTC
CACCCTTGGGACCCCCTGGAGGAAATGGTCATTTTTGTGGCAGTCATGCTTCATC
AACTCTGTTCACCTCGGATAATCAAATGTTTGTTCAGTTTATTTCTGATCACAGT
AATGAAGGGCAAGGATTTAAAATCAAATATGAGGCAAAGAGTTTAGCCTGTGGGG
GCAACGTCTACATCCATGATGC
TGATTCTGCTGGGTATGTGACCTCCCCCAACCA
CCCTCATAATTATCCCCCGCACGCTGATTGCATTTGGATCTTAGCGGCTCCACCG
GAAACACGCATACAGCTGCAATTTGAAGATCGATTCGATATTGAAGTAACACCCA
ACTGTACTTCCAACTACCTTGAGTTGCGGGATGGAGTGGATTCGGATGCACCAAT
ACTTTCCAAATTTTGTGGGACATCTTTGCCCAGCAGTCAGTGGTCCTCAGGAGAG
GTT
ATGTATTTGAGATTTCGATCTGACAACAGCCCCACACATGTGGGATTCAAGG
CCAAGTATTCTATAGCTCAGTGTGGGGGAAGAGTACCAGGGCAAAGTGGTGTTGT
TGAAAGCATTGGACATCCAACACTTCCATACAGAGACAACTTATTCTGTGAGTGG
CATCTCCAGGGGCTCTCTGGACACTATCTCACCATCTCTTTTGAAGACTTTAACC
TTCAGAATTCTTGAAACATCTTGGGCAGATACTGTGGAA
ACACCATTCCTGACAG
CATAGACACTTCTAGCAATACTGCTGTGGTCAGGTTTGTCACAGACGGCTCTGTG
ACTGCCTCAGGATTCAGACTGCGATTTGAATCCAGTATGGAAGAGTGTGGTGGGG
ATCTTCAGGGCTCTATTGGAACATTTACTTCTCCCAACTACCCGAACCCAAATCC
TCATGGCCGGATCTGCGAGTGGAGAATCACTGCCCCGGAGGGAAGGCGGATCACC
CTAATGTTTAACAACCTGAG
GCTGGCCACGCATCCGTCCTGCAACAATGAGCATG
TGATAGTATTCAATGGCATTAGAAGTAACTCACCCCAGCTAGAGAAACTGTGTAG
TAGTGTGAATGTAAGCAATGAGATTAAATCTTCAGGAAACACAATGAAAGTCATT
TTTTTCACGGATGGATCCAGGCCATATGGCGGCTTCACTGCTTCCTATACCTCCA
GTGAAGATGCAGTGTGTGGTGGGTCTCTTCCAAATACTCCTGAAGGAAACTTTAC
T
TCTCCTGGCTATGACGGAGTCAGGAATTACTCAAGAAACCTGAACTGCGAATGG
ACTCTCAGCAATCCAAATCAGGGAAATTCATCCATTTCCATTCACTTTGAAGATT
TTTACCTAGAAAGTCACCAAGACTGTCAATTTGATGTCCTCGAGTTTCGAGTGGG
TGATGCTGATGGGCCCCTGATGTGGAGACTTTGTGGTCCTTCAAAGCCTACATTG
CCATTGGTTATACCTTATTCTCAGGTATGGATTCACT
TTGTCACCAACGAACGTG
TAGAACACATTGGATTCCATGCAAAGTATTCCTTTACAGATTGTGGCGGAATACA
GATAGGTGACAGTGGAGTGATCACAAGCCCCAACTATCCAAATGCTTATGACAGC
CTGACCCACTGCTCTTGGCTGTTGGAGGCCCCACAAGGGCACACCATCACTCTCA
CATTTAGTGACTTTGATATTGAACCCCATACAACTTGTGCTTGGGACTCTGTCAC
TGTCAGGAATGGTGGGTC
CCCTGAATCACCCATCATAGGACAATACTGTGGAAAT
TCAAACCCCAGGACAATACAGTCAGGTTCCAATCAGCTGGTCGTGACTTTTAACT
CAGACCATTCATTGCAAGGTGGTGGATTTTATGCTACGTGGAACACACAAACTTT
AGGTTGTGGTGGAATATTTCATTCTGATAATGGTACAATCAGATCCCCTCACTGG
CCTCAGAATTTTCCCGAAAACAGCAGATGTTCCTGGACGGCCATTACTCACAAA
A
GTAAACACTTGGAGATCAGCTTTGACAACAACTTCCTAATCCCCAGCGGTGATGG
ACAATGTCAGAATAGCTTCGTGAAGGTGTGGGCAGGAACTGAGGAGGTGGACAAA
GCCCTGCTAGCCACTGGCTGTGGGAACGTGGCTCCGGGTCCCGTTATCACACCAA
GTAACACATTCACTGCCGTCTTCCAGTCTCAGGAGGCACCAGCTCAGGGCTTCTC
CGCGTCCTTTGTTAGCCGATGTGGAAGTAATTTCA
CTGGCCCTTCAGGTTACATC
ATTTCTCCAAATTACCCAAAACAATATGACAACAACATGAATTGCACCTATGTCA
TAGAGGCTAATCCTCTGTCAGTGGTCCTCTTGACTTTTGTGTCCTTCCACTTAGA
AGCTCGTTCCGCTGTGACGGGAAGCTGTGTCAACGATGGCGTGCACATTATCAGA
GGTTACAGCGTCATGTCCACCCCATTTGCTACTGTGTGTGGGGATGAGATGCCAG
CTCCCCTCACCATCGC
TGGGCCGGTTCTGCTTAACTTCTACTCCAACGAGCAAAT
CACAGACTTCGGATTCAAGTTTTCCTATAGGATAATCTCCTGTGGTGGTGTGTTC
AATTTCTCTTCTGGAATCATCACAAGTCCTGCCTATTCATACGCAGACTACCCAA
ATGATATGCACTGTCTGTATACCATCACCGTTAGTGACGACAAGGTGATCGAGCT
CAAGTTCAGTGATTTTGATGTGGTTCCCTCCACCTCCTGCTCCCATGACTAC
CTG
GCAATTTACGATGGTGCCAATACCAGCGATCCCCTTCTTGGCAAATTCTGCGGTT
CCAAGCGCCCACCAAATGTGAAGAGCAGCAATAATAGTATGCTCCTGGTGTTCAA
GACAGATTCATTTCAGACAGCAAAAGGCTGGAAGATGTCTTTCCGGCAGACATTG
GGGCCTCAGCAAGGATGTGGTGGTTATCTGACAGGCTCGAATAATACCTTTGCCT
CTCCTGATTCTGATTCGAATGGAATGTATGACA
AGAATTTAAACTGTGTATGGAT
CATAATTGCACCTGTAAACAAAGTAATTCACCTCACCTTCAATACATTTGCTCTG
GAGGCAGCAAGTACTAGGCAAAGATGCCTTTATGATTATGTAAAGTTATATGATG
GGGATAGTGAAAATGCGAACTTGGCTGGAACGTTTTGTGGTTCCACAGTACCTGC
TCCTTTTATCTCTTCTGGTAACTTCCTTACGGTTCAATTCATCAGTGACTTAACA
TTAGAGAGGGAAGG
ATTTAATGCTACATACACCATCATGGACATGCCTTGTGGTG
GAACGTACAATGCAACTTGGACCCCACAAAATATTTCATCACCCAATTCATCAGA
CCCAGATGTCCCATTTTCCATCTGTACTTGGGTCATTGATTCCCCTCCGCATCAG
CAGGTCAAGATAACTGTGTGGGCATTACAGCTGACCTCGCAAGACTGCACGCAGA
ATTACTTACAGCTTCAGGACTCACCGCAGGGTCACGGAAATTCAAGATTT
CAGTT
CTGTGGCAGAAATGCTTCGGCTGTGCCAGTGTTTTATTCTTCTATGAGTACTGCA
ATGGTCATTTTCAAATCTGGAGTTGTAAACAGAAACTCTAGAATGAGTTTCACCT
ATCAGATTGCAGATTGCAACAGAGACTATCACAAGGCATTTGGCAACCTGAGAAG
CCCTGGATGGCCAGATAACTACGACAATGACAAGGATTGCACCGTTACTCTCACA
GCCCCCCAGAACCACACCATTTCCCTCTTTT
TTCATTCACTTGGCATCGAGAACT
CAGTTGAATGCAGAAACGATTTCTTGGAGGTGAGAAATGGAAGTAACAGCAATTC
ACCATTACTGGGCAAGTACTGTGGAACTCTGCTGCCAAACCCTGTCTTCTCTCAA
AATAATGAACTATACCTACGATTTAAGAGTGATAGTGTAACTTCTGATCGTGGAT
ATGAAATCATCTGGACTTCATCACCCTCTGGATGTGGTGGAACTCTTTATGGAGA
CAGAGGCTCATT
CACCAGCCCCGGCTATCCAGGCACATACCCAAACAACACGTAC
TGCGAGTGGGTCCTTGTTGCTCCTGCTGGAAGGCTTGTCACCATCAACTTCTACT
TCATCAGCATTGACGATCCAGGAGACTGTGTCCAGAACTATCTCACACTCTATGA
TGGGCCCAACGCCAGCTCTCCATCCTCTGGACCATACTGCGGAGGCGACACCAGC
ATAGCTCCCTTCGTGGCTTCCTCAAATCAGGTCTTCATAAAATTTCAT
GCTGATT
ATGCACGGCGTCCATCCGCATTCCGATTAACTTGGGACAGCTAA



Cell Culture #4

RNA #1

CCTTCGCAAGCCCTCATTTCACCAGGCCCCCGGCTTGGGGCGCCTTCCTTCCCCA
TGGCGGGACACCTGGCTTCGGATTTCGCCTTCTCGCCCCCTCCAGGTGGTGGAGG
TGATGGGCCAGGGGGGCCGGAGCCGGGCTGGGTTGATCCTCGGACCTGGCTAAGC
TTCCAAGGCCCTC
CTGGAGGGCCAGGAATCGGGCCGGGGGTTGGGCCAGGCTCTG
AGGTGTGGGGGATTCCCCCATGCCCCCCGCCGTATGAGTTCTGTGGGGGGATGGC
GTACTGTGGGCCCCAGGTTGGAGTGGGGCTAGTGCCCCAAGGCGGCTTGGAGACC
TCTCAGCCTGAGGGCGAAGCAGGAGTCGGGGTGGAGAGCAACTCCGATGGGGCCT
CCCCGGAGCCCTGCACCGTCACCCCTGGTGCCGTGAAGCTGGAGAAGGA
GAAGCT
GGAGCAAAACCCGGAGGAG



RNA #2

ATGTACAACATGATGGAGACGGAGCTGAAGCCGCCGGGCCCGCAGCAAACTTCGG
GGGGCGGCGGCGGCAACTCCACCGCGGCGGCGGCCGGCGGCAACCAGAAAAACAG
CCCGGACCGCGTCAAGCGGCCCATGAATGCCTTCATGGTGTGGTCCCGCGGGCAG
CGGCGCAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAGC
G
CCTGGGCGCCGAGTGGAAACTTTTGTCGGAGACGGAGAAGCGGCCGTTCATCGA
CGAGGCTAAGCGGCTGCGAGCGCTGCACATGAAGGAGCACCCGGATTATAAATAC
CGGCCCCGGCGGAAAACCAAGACGCTCATGAAGAAGGATAAGTACACGCTGCCCG
GCGGGCTGCTGGCCCCCGGCGGCAATAGCATGGCGAGCGGGGTCGGGGTGGGCGC
CGGCCTGGGCGCGGGCGTGAACCAGCGCATGGACAGT
TACGCGCACATGAACGGC
TGGAGCAACGGCAGCTACAGCATGATGCAGGACCAGCTGGGCTACCCGCAGCACC
CGGGCCTCAATGCGCACGGCGCAGCGCAGATGCAGCCCATGCACCGCTACGACGT
GAGCGCCCTGCAGTACAACTCCATGACCAGCTCGCAGACCTACATGAACGGCTCG
CCCACCTACAGCATGTCCTACTCGCAGCAGGGCACCCCTGGCATGGCTCTTGGCT
CCATGGGTTCGGTGGTCA
AGTCCGAGGCCAGCTCCAGCCCCCCTGTGGTTACCTC

TTCCTCCCACTCCAGGGCGCCCTGCCAGGCCGGGGACCTCCGGGACATGATCAGC
ATGTATCTCCCCGGCGCCGAGGTGCCGGAACCCGCCGCCCCCAGCAGACTTCACA
TGTCCCAGCACTACCAGAGCGGCCCGGTGCCCGGCACGGCCATTAACGGCACACT
GCCCCTCTCACACATGTGA

Cell Culture #5

RNA #1

CAGAGTTGG
GAGTGACTCCAGAGCCTCCAGCGAGATGCTGCTGATTCTGCTGTCA
GTGGCCCTGCTGGCCCTGAGCTCAGCTGAGAGTTCAAGTGAAG



RNA #2

ATGGCCAGTCAACCTCCTGAAGACACTGCGGAGTCTCAGGCCTCTGATGAGCTGG
AGTGCAAAATCTGTTACAATCGATACAATCTGAAACAGAGGAAACCCAAAGTGCT
GGAGTGTTGTCATAGGGTTTGTGCCAAATGCCTCTACAAGATCATAG
ACTTTGGG
GACTCCCCACAAGGTGTCATTGTCTGTCCTTTCTGCAGGTTTGAGACGTGCCTGC
CAGATGATGAAGTTAGTAGCCTGCCCGATGACAACAACATCCTTGTAAACTTGAC
TTGTGGAGGCAAAGGGAAGAAGTGCCTGCCAGAGAACCCTACTGAGCTGCTGCTC
ACCCCCAAGAGGCTGGCCTCTCTGGTCAGTCCTTCTCACACGTCCTCCAACTGCC
TGGTCATAACCATCATGGAGGTGCAGAG
AGAGAGCTCCCCGTCCCTGAGCTCCAC
TCCTGTGGTAGAATTTTATAGGCCTGCGAGTTTCGACTCTGTCACCACTGTGTCA
CACAACTGGACTGTGTGGAACTGCACGTCCCTGCTGTTTCAGACATCCATCCGGG
TGTTAGTGTGGTTGCTAGGTTTGCTCTACTTCAGCTCCTTACCCTTAGGAATCTA
CTTACTGGTGTCTAAGAAAGTCACCCTTGGGGTCGTCTTTGTCAGCCTGGTCCCT
TCGAGCCTC
GTTATTCTTATGGTGTATGGTTTTTGCCAGTGTGTTTGTCATGAAT
TTCTAGACTGTATGGCACCTCCTTCTTAA




Cell Culture #6

RNA #1

ATGGAGGAGTTGGTGGGGCTGCGTGAGGGCTTCTCAGGGGACCCTGTGACTCTGC
AGGAGCTGTGGGGCCCCTGTCCCCACATCCGCCGAGCCATCCAAGGTGGCCTGGA
GTGGCTAAAGCAGAAGGTGTTCCGCCTGGGAGAAGACTGGTAC
TTCCTGATGACC
CTCGGGGTGCTCATGGCCCTGGTCAGCTATGCCATGAACTTTGCCATCGGGTGTG
TGGTCCGAGCACACCAGTGGCTGTACAGGGAGATTGGGGACAGCCACCTGCTCCG
GTATCTTTCCTGGACTGTGTACCCTGTGGCCCTCGTCTCTTTCTCCTCAGGCTTC
TCCCAGAGCATCACGCCCTCCTCTGGAGGTTCTGGAATCCCGGAGCTGAAGACCA
TGTTGGCGGGTGTGATCTTGGAGG
ACTACCTGGATATCAAGAACTTTGGGGCCAA
GGTGGTGGGCCTCTCCTGCACCCTGGCCACCGGCAGCACCCTGTTCCTGGGCAAA
GTGGGCCCTTTCGTGCACCTGTCTGTAATGATCGCTGCCTACCTGGGCCGTGTGC
GCACCACGACCATCGGGGAGCCTGAGAACAAGAGCAAGCAAAACGAAATGCTGGT
GGCAGCGGCGGCAGTGGGCGTGGCCACAGTCTTTGCAGCTCCCTTCAGCGGCGTC
CTGTT
CAGCATCGAGGTCATGTCTTCCCACTTCTCTGTCCGGGATTACTGGAGGG
GCTTCTTTGCGGCCACCTGCGGGGCCTTCATATTCCGGCTCCTGGCAGTCTTCAA
CAGCGAGCAGGAGACCATCACCTCCCTCTACAAGACCAGTTTCCGGGTGGACGTT
CCCTTCGACCTGCCTGAGATCTTCTTTTTTGTGGCGCTGGGTGGCATCTGCGGCG
TCCTGAGCTGTGCTTACCTCTTCTGTCAGCGAACCTTCCTC
AGCTTCATCAAGAC
CAATCGGTACAGCTCCAAACTGCTGGCTACTAGCAAGCCTGTGTACTCCGCTCTG
GCCACCTTGCTTCTCGCCTCCATCACCTACCCGCCTGGTGTGGGCCACTTCCTAG
CTTCTCGGCTGTCCATGAAGCAGCATCTGGACTCGCTGTTCGACAACCACTCCTG
GGCGCTGATGACCCAGAACTCCAGCCCACCCTGGCCCGAGGAGCTCGACCCCCAG
CACCTTTGGTGGGAATGGTACC
ACCCGCGGTTCACCATCTTTGGGACCCTTGCCT
TCTTCCTGGTTATGAAGTTCTGGATGCTGATTCTGGCCACCACCATCCCCATGCC
TGCCGGGTACTTCATGCCCATCTTTATCCTTGGAGCTGCCATCGGGCGCCTCTTG
GGAGAGGCTCTTGCCGTCGCCTTCCCTGAGGGCATTGTGACTGGAGGGGTTACCA
ATCCCATCATGCCCGGGGGGTATGCTCTGGCAGGGGCTGCAGCCTTCTCAGGGGC
TGT
GACCCACACCATCTCCACGGCGCTGCTGGCCTTTGAGCTGACCGGCCAGATA
GTGCATGCACTGCCCGTGCTGATGGCGGTGCTGGCAGCCAACGCCATTGCACAGA

GCTGCCAGCCCTCCTTCTATGATGGCACCATCATTGTCAAGAAGCTGCCATACCT
GCCACGGATTCTGGGCCGCAACATCGGCTCCCACCATGTGAGGGTGGAGCACTTC
ATGAACCACAGCATCACCACACTGGCCAAGGACACGCC
GCTGGAGGAGGTGGTCA
AGGTTGTGACCTCCACAGACGTGACCGAGTATCCCCTGGTGGAGAGCACAGAGTC
CCAGATCCTGGTAGGCATCGTGCAGAGGGCCCAGCTGGTGCAGGCCCTCCAGGCT
GAGCCTCCTTCCAGGGCTCCAGGACACCAGTGTCTCCAGGACATCTTGGCCAGGG
GCTGCCCCACGGAACCAGTGACCCTGACGCTATTCTCAGAGACCACCTTGCACCA
GGCACAAAACCTCTTTAAG
CTGTTGAACCTTCAGTCCCTCTTCGTGACATCGCGG
GGCAGAGCTGTGGGCTGCGTGTCCTGGGTGGAGATGAAGAAAGCAATTTCCAACC
TGACAAATCCGCCAGCTCCAAAGTGA



RNA #2

ATGGCTTTAGAGACGATCTGCCGACCCTCTGGGAGAAAATCCAGCAAGATGCAAG
CCTTCAGAATCTGGGATGTTAACCAGAAGACCTTCTATCTGAGGAACAACCAACT
AGTTGCTGGATACTTGCAA
GGACCAAATGTCAATTTAGAAGAAAAGATAGATGTG
GTACCCATTGAGCCTCATGCTCTGTTCTTGGGAATCCATGGAGGGAAGATGTGCC
TGTCCTGTGTCAAGTCTGGTGATGAGACCAGACTCCAGCTGGAGGCAGTTAACAT
CACTGACCTGAGCGAGAACAGAAAGCAGGACAAGCGCTTCGCCTTCATCCGCTCA
GACAGCGGCCCCACCACCAGTTTTGAGTCTGCCGCCTGCCCCGGTTGGTTCCTCT
GCACAGCGATGGAAGCTGACCAGCCCGTCAGCCTCACCAATATGCCTGACGAAGG
CGTCATGGTCACCAAATTCTACTTCCAGGAGGACGAGTAG

Retinoblastoma

RNA #1

CCTTCGCAAGCCCTCATTTCACCAGGCCCCCGGCTTGGGGCGCCTTCCTTCCCCA
TGGCGGGACACCTGGCTTCGGATTTCGCCTTCTCGCCCCCTCCAGGTGGTGGAGG
TGATGGGCCAGGGGGGCCGGAGCCGGG
CTGGGTTGATCCTCGGACCTGGCTAAGC
TTCCAAGGCCCTCCTGGAGGGCCAGGAATCGGGCCGGGGGTTGGGCCAGGCTCTG
AGGTGTGGGGGATTCCCCCATGCCCCCCGCCGTATGAGTTCTGTGGGGGGATGGC
GTACTGTGGGCCCCAGGTTGGAGTGGGGCTAGTGCCCCAAGGCGGCTTGGAGACC
TCTCAGCCTGAGGGCGAAGCAGGAGTCGGGGTGGAGAGCAACTCCGATGGGGCCT
CCCCGGAG
CCCTGCACCGTCACCCCTGGTGCCGTGAAGCTGGAGAAGGAGAAGCT
GGAGCAAAACCCGGAGGAG



RNA #2

GCTACTCCCACCCCGCCCCGCCCCGTCATTGTCCCCGTCGGTCTCTTTTCTCTTC
CGTCCTAAAAGCTCTGCGAGCCGCTCCCTTCTCCCGGTGCCCCGCGTCTGTCCAT
CCTCAGTGGGTCAGACGAGCAGGATGGAGGGCTGCATGGGGGAGGAGTCGTTTCA
GATGTGGGAGCTCAA
TCGGCGCCTGGAGGCCTACCTGGCCCGGGTCAAGGCGCTG
GAGGAGCAGAATGAGCTGCTCAGCGCGGAGCTCGGGGGGCTCCGGGCACAATCCG
CGGACACCTCCTGGCGGGCGCATGCCGACGACGAGCTGGCGGCCCTGCGGGCCCT
CGTTGACCAACGCTGGCGGGAGAAGCACGCGGCCGAGGTGGCGCGCGACAACCTG
GCTGAAGAGCTGGAGGGCGTGGCAGGCCGATGCCAGCAGCTGCGGCTGGCC
CGGG
AGCGGACGACGGAGGAGGTAGCCCGCAACCGGCGCGCCGTCGAGGCAGAGAAATG
CGCCCGGGCCTGGCTGAGTAGCCAGGTGGCAGAGCTGGAGCGCGAGCTAGAGGCT
CTACGCGTGGCGCACGAGGAGGAGCGCGTCGGCCTGAACGCGCAGGCTGCCTGTG
CCCCCCGCTGCCCCGCGCCGCCCCGCGGGCCTCCCGCGCCGGCCCCGGAGGTAGA
GGAGCTGGCAAGGCGACTGGGCGAGGCGTGGC
GCGGGGCAGTGCGCGGCTACCAG
GAGCGCGTGGCACACATGGAGACGTCGCTGGGCCAGGCCCGCGAGCGGCTGGGCC

GGGCGGTGCAGGGTGCCCGCGAGGGCCGCCTGGAGCTGCAGCAGCTCCAGGCTGA
GCGCGGAGGCCTCCTGGAGCGCAGGGCAGCGTTGGAACAGAGGTTGGAGGGCCGC
TGGCAGGAGCGGCTGCGGGCTACTGAAAAG

TTCCAG


Teacher’s Key for Cell Cult
ure Identification


Cell Culture #1: lung cell


RNA #1 = LXN (non
-
specific)


RNA#2 = SFTPB


Cell Culture#2: Neuron


RNA #1 = YPEL4


RNA #2 = NEFM


Cell Culture # 3: Liver


RNA #1 = KCNT2


RNA #2 = CUBN


Cell Culture #4: Embryonic Stem Cell


RNA # 1 = Pou5f
1 (alias is OCT4)


RNA # 2 = SOX2


Cell Culture #5: Lung


RNA #1 = PRB4


RNA #2 = RNF182


Cell Culture # 6 = Liver


RNA #1 = CLCNKA


RNA# 2 = IL1RN


Retinoblastoma


RNA #1 = Pou5f1


RNA #2 = NESTIN