The Genetic Engineering of a Poly His Tag - Clarkson University

weedheightswaistBiotechnology

Dec 11, 2012 (4 years and 6 months ago)

160 views

Class of 2006

Department of Chemistry

Clarkson University

The Genetic Engineering of a Poly His Tag on the C
-
Terminal End of the E.coli receptor for Glucose and
Galactose


Andrea Fischer, Chad Sydor, Dave Evans and Linda Luck




The glucose galactose binding protein (GGR) is a bacterial periplasmic receptor that

has been
used as a biosensor s
ince it is very
soluble

and easily obtained through genetic engineering procedures.
The challenge in building a biosensor is

the
immobilization of the
protein on the
surface

of the detect
ing
device.
We were interested in fin
ding ways to immobilize the protein on the surface.
One way to do this
is to add

of

six histi
dines to the C
-
terminal en
d of the protein.
Through the use of a cross linker the
protein can be attached to the surface.
The surface has

been coated with a
sel
f
-
assembled monolayer
(SAM) of 3,3 Dithiobis(N
-
(5
-
amino
-
5
-
carboxypentyl propionamide)
-
N
-
N
-
diacetic acid) dihydrochloride
(Dithiobis(C
2
NTA))
.

This is a biological agent that
serves as a cross linker between the His tag and the
gold surface. In solution th
e molecules line up along the surface

of the gold

in a monolayer allowing the
His tag to attach to the other side therefore immobili
zing the protein all along the surface.


Figrure 1. This shows the GGR protein attached to a gold surface.

Initially we

de
signed the
basic
primers to do the genetic engineering using polymerase chain reaction
(PCR).

Since the addition was supposed to flank the stop codon the sequence bo
th before and after the
Class of 2006

Department of Chemistry

Clarkson University

stop co
don was needed for the design process.
The initial sequen
ce was taken with the histi
di
nes added
and a few amino acids on each side were considered for t
he first primer. The second primer is simply the
compliment of the first.
Sequencing primers are suppose to be able to anneal
to the

target DNA in a
predictabl
e location

and must be capable of extension by Taq DNA polymerase.
Howe
ver
,

the addition of

six amino acids

translates into
eighteen base pairs which in molecular biology is a rather large addition
mutation.

The original primers

and specification are see
n below. They were designed
treat
ing

the
insertion as a normal mutation.

Forward: 5' GAATTTAGAAAGAAA
CATCATCACCACCACCAT
TA
AGACTGAGAGCTC 3'

Reverse: 5' GAGCTCTCAGTCTTAATGGTGGTGGTGATGATGTTTCTTTCTAAATTC 3'


Length:

48 bp


GC content:


39.58%


Melting temp:

83.7°C


Mol. weight (fwd): 11643.27 Da


Mo. weight (rev):

11744.26 Da


Mismatch:

0.00%


Ends in G or C:

Yes




Tm = 81.5 + 0
.41(%GC)
-

675/N
-

%mismatch




where N = primer length in bas
e pairs.



The mutagenic primers must contain the desired mutation, the bolded section in the primers shown
above, and need to anneal to the same sequence on opposite strands of the plasmid. The mutation is in the
middle with approximately an equal number

of base pairs on each side. Optimally, the GC content should
be 40% and both primers should terminate in one or more C or G bases.

The above primer was the best
candidate meeting all of the design criteria, however after more research it was discovered
that the HIS
tag was too large to treat as a mutation.

This discovery was made very late in the stages of the research
and the approach needed to be altered to facilitate the size of the insertion.



Instead the addition must be made using a series
of PCR products utilizing restriction enzyme cut
sites.

The primers can be designed to PCR out the 3’ end of the
pUC18/
GGR and add the sequence for

the HIS tag using the ApaL I and EcoR 1
restriction

sites.
A
3’ end
PCR product
can be

generated
that
has

the same restriction

sites on both

sides of the stop codon and has

the HIS insert.

The original
pUC18/GGR is
cut at ApaL 1 and EcoR 1 to remove the 3’ end. Once this is
purified

using a gel the HIS
tag containing PCR product can be
placed

into the pUC18/
GGR vector at the ApaL 1 and EcoR 1
restriction sites using a ligation kit.
After the ligation is complete

a transformation
is performed
on
competent E.coli cells.

Class of 2006

Department of Chemistry

Clarkson University


Figure 2. This is a block diagram of a transformation.


The bacterial pUC18
plasmid

co
ntains an antibiotic resistance gene to determine which colonies

have ta
ken up the vector successfully.


Once
positive
bacterial colonies are formed the DNA can be
sequenced to confirm that the HIS tag is present
.
One colony is taken from the antibiotic c
ontaining plate
and placed in a starter culture via a flame sterilized wire loop. The starter culture is grown in LB media
also containing an antibiotic, in our case ampilicin, and is placed in a shaker incubator overnight.
Contamination is an issue so a

control tube is prepared containing the media a
nd antibiotic but no colony.
A miniprep
DNA purification system
can
used

to obtain the
plasmid
DNA and then it is

sent out for the
sequencing confirmation. Once the presence of the HIS tag is confirmed pro
tein production can occur.

Since the research into this new method of insertion was do
ne very late in the process, we are in the
middle of the protein production.