GI10 Intelligent systems in Bioinformatics

vivaciousefficientBiotechnology

Oct 1, 2013 (3 years and 8 months ago)

73 views

GI10/ 4C58 Intelligent systems in Bioinformatics




12/1/04


Homework # 1

(Due Thursday 15
th

January 2004)


PLEASE USE ASSESSED COURSEWORK COVERSHEET, ALTHOUGH
THIS HOMWORK DOESN’T COUNT TOWARDS FINAL MARK. HAND TO
JJ GIWA BY 12NOON ON DUE DATE.


1.

Read thro
ugh the notes and make a glossary of biological terms. (There are a
lot of new terms in lecture 1 and this will aid understanding of the future
lectures.) Make sure you include concepts such as
intron

and
open reading
frame

from the last section of the lec
ture as well as the processes of the
Central Dogma
, etc. from the molecular biology section. If there is anything
you don’t understand, prepare questions for the next lecture.

2.

Draw labelled diagrams of plant and animal cells and comment on the
differences
(you will have to look these up). Focus on the
organelles
-

we
discussed some of these in the lecture, but you will be able to find information
on more of them in
Alberts et al.
, in a more basic biology textbook or
on the
web
.

3.

You should be familiar with t
he genetic code and the three
-
letter and single
-
letter abbreviations of the amino acids. In order to gain familiarity, transcribe
and translate the following DNA sequences into protein, using either the one
-

or three
-
letter abbreviations for the amino acid
s (NB as is traditional, I am
writing the
informational
/ sense strand from 5’ to 3’):

a.

5’
-
ATGTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGG

AAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACA
CCCAAGACCTAG
-
3’ [You can do this by hand or write a program to do
it if you wish.]

b.

5’
-
TTGCCTAGTGATTGGATG
-
3’ [Translate this in each of the three
reading frames
-

assume that this is in the middle of an exon; in reality
you would have to find a start codon to begin translating.]