Recombinant DNA Cloning Technology - College of Science and ...

twoeggfinnishBiotechnology

Dec 14, 2012 (4 years and 10 months ago)

188 views

Outline/Study Guide
--
Biotechnology

In genetic engineering and molecular characterization, what are the
physical obstacles to overcome? What techniques are used to
overcome these obstacles?


Restriction Mapping


What is a restriction enzyme and why does it cut DNA at specific
sites? (What is the enzyme’s natural function?) What are sticky ends?
Why must two different pieces of DNA be cut with the same enzyme
in order for them to be cloned together?


What is the function of electrophoresis and how does it separate
molecules?


What is a restriction map? Could you determine a restriction map from
a DNA fingerprint on an electrophoresis gel?


Course objective:
Students will be able to explain major methods and
techniques used in molecular genetics to isolate, recombine, amplify, find
and study genes of interest
.


Necessary for future material on: last five genetics labs. Helpful for
Directed Studies and Internships in research labs.

Biotechnology, cont.

Blotting and Probing


What is a Southern blot vs. a Northern blot? When would you
use one vs. the other?


Why is hybridizing important? How does a probe “hybridize”?


What specific sequence must a single stranded probe have in
order to identify the GOI?


How can one make many copies of the Gene of Interest?
What advantages and disadvantages exist in each?


How does PCR work? What specific sequence must a PCR
primer have in order to amplify the right gene?


What is a vector and what properties must it have in order to
be useful? Are all the vectors the same?


What is the Lac Z system for? How does it work?


What is a DNA library?

Uses of molecular genetic research

Basic research

understanding
living organisms at the molecular
level (e.g. fruit
-
fly lifecycle)

Applied research

for solving
specific biomedical problems
(e.g. gene therapy for
hemophilia or cystic fibrosis;
better livestock or agriculture)

Both involve use of recombinant
DNA technology (genetic
engineering)

Obstacles in Molecular Genetics

Goal: characterize the Gene of Interest (GOI)


Amplification of GOI

need to make thousands of copies of one GOI in
order to characterize it.


Cloning
GOI into a
vector


PCR

Polymerase Chain
Reaction



“Macro
-
isolation” of Gene of Interest


Restriction Digest of DNA


Electrophoresis


DNA Library



“Micro
-
isolation” of Gene of Interest (GOI)


Southern Blot

Studying DNA (is a particular gene or sequence present in
this genome?)


Northern Blot

studying RNA (Does this tissue synthesize a particular RNA
[i.e. express a particular gene]?)


Hybridization (using complementarity to find the GOI on a Southern,
Northern, or in PCR)


Sequencing


Restriction enzymes recognize
specific sequences (restriction
sites) and generate “sticky” or
“blunt” ends

“sticky” ends (un
-
paired ss DNA)

:::::::

:::::::

How DNA from different
sources is


put together

(like Fig 19.1,
Brooker
)

Example of restriction sites within a double
-
stranded
DNA sequence

1 GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTATGCACGC 80

1 CTAGTGTCCAGATAGTGGGATAATTGGTGAGTGCCCTCGAGAGGTACGTAAACCATAAAAGCAGACCCCCCATACGTGCG 80


BanII





81 GATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTA 160

81 CTATCGTAACGCTCTGCGACCTCGGCCTCGTGGGATACAGCGTCATAGACAGAAACTAAGGACGGAGTAGGATAATAAAT 160


Bsp1286I





161 TCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAAAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATA 240

161 AGCGTGGATGCAAGTTATAATGTCCGCTTGTATGAATGATTTCACACAATTAATTAATTACGAACATCCTGTATTATTAT 240


SspI






241 ACAATTGAATGTCTGCACAGCCACTTTCCACACAGACATCATAACAAAAAATTTCCACCAAACCCCCCCTCCCCCGCTTC 320

241 TGTTAACTTACAGACGTGTCGGTGAAAGGTGTGTCTGTAGTATTGTTTTTTAAAGGTGGTTTGGGGGGGAGGGGGCGAAG 320





321 TGGCCACAGCACTTAAACACATCTCTGCCAAACCCCAAAAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAATTT 400

321 ACCGGTGTCGTGAATTTGTGTAGAGACGGTTTGGGGTTTTTGTTTCTTGGGATTGTGGTCGGATTGGTCTAAAGTTTAAA 400


EaeI






401 TATCTTTTGGCGGTATGCACTTTTAACAGTCACCCCCCAACTAACACATTATTTTCCCCTCCCACTCCCATACTACTAAT 480

401 ATAGAAAACCGCCATACGTGAAAATTGTCAGTGGGGGGTTGATTGTGTAATAAAAGGGGAGGGTGAGGGTATGATGATTA 480



n
t

position

Restriction Digested DNA
stained with Ethidium Bromide
on an Agarose Gel

Fragments of DNA

What DNA fragments
are generated when cut
by restriction digestion?


What would the
electrophoresis gel look
like if these fragments
were separated by size?

0 1 2 3 4 5 6

Cloning of GOI
into vector, then
into host
organism

How do I know which
restriction enzyme to
use? (hint: the foreign
GOI must “fit” into the
vector)

Host organism
makes lots of copies
of the vector + GOI

What must a host
chromosome have in
order to be useful as
a vector?

What do you think would happen
if this vector did not have an ori?

Examples of different types of vectors and host
organisms

Genome of
Interest

Host
Organism

Vector

Size of
Insert

Human
genome

Yeast

YAC
(Yeast
Artificial
Chromosome)

100
-

2000 kb

Worm
(nematode)
genome

Bacteria

Cosmid

< 45 kb

Firefly
genome

Virus

l

phage

< 20 kb

Drosophila
genome

Bacteria

Plasmid

< 15 kb

Brooker
, fig
19.2

Copyright
©
The McGraw
-
Hill Companies, Inc. Permission required for reproduction or display.

amp
R

gene

Plasmid
Vector

Origin of

replication

lacZ
gene

Unique

restriction

site

Cut the DNAs
with same
restriction enzyme.

Mix the DNAs together. Allow time for

sticky ends to base
-
pair. Add DNA ligase

to covalently link the DNA backbones.

Gene of interest

Chromosomal DNA

from human cells

Vector
with

GOI

Recombinant vectors

Vector with

another fragment

of chromosomal DNA

Recircularized

vector

or

or

How do you know when the vector actually has an
insert?
Use the
Lac Z
-
system

Mix DNA with
E.coli
.


Permeable
E. Coli
take up DNA [Transformation]

Plate cells on
media containing
X
-
Gal, IPTG
, and
ampicillin
.

Vector with the

gene of interest

Vector with

another fragment

of chromosomal DNA

Recircularized

vector

Each bacterial colony is derived from a single cell;

so all the cells in a colony are genetically identical.

Blue colony

Recircularized vector

without an insert

Recombinant

vector

with an

insert

White colony

E. coli
cell


(treated with
permeabilizing

agents)

or

or

Copyright ©The McGraw
-
Hill Companies, Inc. Permission required for reproduction or display

Cloning a gene

into a vector, cont.

Brooker
, fig
19.2

Lac
Z System cont. White colonies contain vector with GOI.

Predict the types of colonies that would grow
under these conditions

Plain
agar

Plain agar

X
-
Gal

Plain agar

X
-
Gal

Plain
agar

Plain agar

X
-
Gal

Plain agar

X
-
Gal

(All with

Ampicillin
)

(no antibiotic)

Bacteria
-
no
vector

Bacteria
-
”empty” vector

Bacteria
-
vector
with GOI

Agar

X
-
Gal

Agar

X
-
Gal

Plain Agar

Agar

Ampicillin

X
-
Gal

Predict the types of colonies that would
grow under these conditions

Agar

ampicillin

Agar

Ampicillin

X
-
Gal

Bacteria
-
”empty” vector

Bacteria
-
no
vector

Bacteria
-
vector
with GOI

Bacteria
-
no
vector

Bacteria
-
”empty” vector

Bacteria
-
vector
with GOI

(no antibiotic)

(All with

Ampicillin
)

Restriction Digested DNA
stained with Ethidium Bromide
on an Agarose Gel

But which fragment has
my gene of interest? How
can I find the right
fragment? (use a DNA
probe)

(Ethidium bromide
stains
all

DNA; DNA
probes only highlight
complementary
sequences)

Fig 18
-
5a
Southern
blotting
:
blotting DNA
fragments onto a membrane
so that it can be probed

Which fragment has my gene of
interest? How can I find the right
fragment?

Electrophoresis gel

Southern blotting
:
blotting DNA fragments
onto a membrane so that it
can be probed

Which fragment has my gene of
interest? How can I find the right
fragment?

Electrophoresis gel

Identifying the
gene of interest
(“probing” with a
labeled tag)

DNA has now been transferred to
membrane.

Which fragment will the gene
-
specific probe bind to?

Expose to film to “see”
the radioactive probe

I want to identify
the
b
-
杬潢楮⁧g湥.

A湤n䤠wa湴 瑯
楤i湴楦i 瑨e
楮i畬楮u来湥.

How must the single stranded probes be
different in order for these two
investigators to identify their specific GOI?

Pretend this is a Southern Blot (membrane with DNA bound to it).
To which piece of ssDNA will the probe hybridize (bind)?

5’
-
GATTACA
-
3’

5’
-
GATTACA
-
3’

3’
-
CTAATGT
-
5’

5’
-
CTAATGT
-
3’


3’
-
GATTACA
-
5’

5’
-
CGATTAT
-
3’

3’
-
CGTTATA
-
5’

Membrane with bound
single stranded DNA

Radioactively labeled
probe

Pretend this is a Southern Blot (membrane with DNA bound to it).
To which piece of ssDNA will the probe hybridize (bind)?

5’
-
GATTACA
-
3’

5’
-
GATTACA
-
3’

3’
-
CTAATGT
-
5’

5’
-
CTAATGT
-
3’


3’
-
GATTACA
-
5’

5’
-
CGATTAT
-
3’

3’
-
CGTTATA
-
5’

Membrane with bound
single stranded DNA

Radioactively labeled
probe

5’
-
GATTACA
-
3’

Photography Film exposed to probed
Southern Blot

Bands of DNA that
bound to the
radioactive probe

Bands of DNA that
bound
weakly

to the
radioactive probe

Southern Blots Can Be Used For
Paternity Tests

Was Ronald Scott Kidnapped from the
Larsons?

“Northern blots show the
expression pattern of the GOI.”

Modern day “
Southerns
” and “
Northerns


microarray analysis

Screening a gene library for the GOI


DNA (or Gene) Library

collection of host organisms containing
DNA vectors with GOI inserts from different parts of the Genome of
Interest


Library allows smaller pieces of genome
-
of
-
interest to be replicated
inside organism and eventually selected based on size, sequence,
or sometimes functional protein.

Two
distinct forms of
large
B
-
cell
lymphoma are shown by the
expression pattern:
GC B
-
like DLBCL (orange) and Activated B
-
like
DLBCL (blue
)

ASH ALIZADEH et al
. 2000

I need lots of copies of my gene of
interest. How can I do this?

PCR


Cell free


Test tube


Fast


Limited to already
known sequences


Can’t directly make
a protein from PCR

Cloning into a vector



Insert
your GOI into
another organism’s
chromosome


Hitch
-
hike replication


May also get host
organism to express
protein of GOI.

Brooker

Fig
19.4

Copyright ©The McGraw
-
Hill Companies, Inc. Permission required for reproduction or display

5′

3′

3′

5′

5′

3′

3′

5′

Site where reverse

primer
binds

Many
copies of GOI, flanked
by regions where primers
bind.

Site where forward

primer
binds

Template DNA

Chromosomal DNA

A different
primer binding

near other end
of
gene

Primer
binding near
one
end of gene

Forward

primer

Reverse
primer

Denature:
Separate DNA

with
high temperature.

Primer annealing: Lower temperature
,
allows primers to
bind
template
DNA.

Many PCR cycles

5′

5′

3′

3′

3′

3′

5′

5′

Primer extension: Incubate
at temperature

that
allows
DNA synthesis
to occur.

5′

5′

3′

3′

3′

3′

5′

5′

(b) The 3 steps of a PCR cycle

(a) The outcome of a PCR experiment

C

G

T

C

A

G

C

G

C

G

C

G

C

G

C

G

C

A

T

A

T

A

T

A

T

A

G

C

G

T

A

G

C

T

3′

5′

5′

3′

Reverse primer

Overview of
PCR

Necessary items for PCR

Template DNA

Forward primer

Reverse primer

Free nucleotides

DNA Polymerase
Enzyme (“
Taq
”)

A

G

C

T

A

G

C

T

A

G

C

T

PCR: Amplifying DNA in a test tube

Forward

Reverse
primer

5’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

5’

3’

5’

5’

3’

3’

3’

3’

5’

3’

5’

3’

5’

3’

3’

5’

Template
DNA

Forward

primer

PCR: Amplifying DNA in a test tube

Forward

Reverse
primer

5’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

5’

3’

5’

5’

3’

3’

3’

3’

5’

3’

5’

3’

5’

3’

3’

5’

Template
DNA

Forward

primer

PCR: Amplifying DNA in a test tube

Forward

Reverse
primer

5’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

5’

3’

5’

5’

3’

3’

3’

3’

5’

3’

5’

3’

5’

3’

3’

5’

Template
DNA

Forward

primer

PCR: Amplifying DNA in a test tube

Forward

Reverse
primer

5’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

5’

3’

5’

5’

3’

3’

3’

3’

5’

3’

5’

3’

5’

3’

3’

5’

Template
DNA

Forward

primer

PCR: Amplifying DNA in a test tube

Forward

Reverse
primer

5’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

5’

3’

5’

5’

3’

3’

3’

3’

5’

3’

5’

3’

5’

3’

3’

5’

Template
DNA

Forward

primer

PCR: Amplifying DNA in a test tube

Forward

Reverse
primer

5’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

5’

3’

5’

5’

3’

3’

3’

3’

5’

3’

5’

3’

5’

3’

3’

5’

Template
DNA

Forward

primer

PCR: Amplifying DNA in a test tube

I want to amplify the
b
-
杬潢i渠来湥.

A湤 I w慮t t漠
慭灬afy t桥 i湳畬u渠
来湥g

坨慴W獰散ifi挠t桩湧h浵獴m扥 摩df敲敮t i渠t桥獥 tw漠
investigators’ PCR reactions?

Forward

Reverse
primer

5’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

3’

5’

5’

3’

5’

5’

3’

3’

3’

3’

5’

3’

5’

3’

5’

3’

3’

5’

Template
DNA

Forward

primer

How do I design primers in order to detect
(or amplify) specific genes?


www.ncbi.nlm.nih.gov/
omim
/

1.
search under “hemoglobin”

2.
Click on HBB (hemoglobin
-
beta). 1419000?

3.
Click to the map locus (chromosome 11p~~)

4.
Click on [141900] on the chromosome itself

5.

RefSeq

Gene” in right side bar

6.
Use sequence information to design a
complementary primer for the 5’ end of the
gene, and 3’ end of gene.


Difference between “Genomic” and “cDNA”

Genomic

DNA exactly as found in the genome,
including introns and other non
-
coding portions of DNA

EXONS
-
protein coding

INTRONS
-
junk DNA

5’ untranslated region

3’ untranslated
region

cDNA

complementary DNA
--
made from mature mRNA and thus
containing only coding parts of gene

What does each technique “look like”?



1.)


Electrophoresis

2.)


Restriction Digest

3.)


PCR

4.)


Southern Blot

5.)


Screening a genomic library

6.)


Hybridization with radioactive probe

7.)


Cloning of insert DNA into vector,
transformation into host organism

8.) Northern Blot

Which technique(s) do you use for each purpose (there may be
more than one way to solve a problem)?


1.
Identifying specific sequences, regulatory regions or genes
(including introns).

2.)


Determining tissue
-
specific or stage
-
specific gene
expression.

3.)


Cutting of DNA at specific sequences

4.)


Separation of DNA fragments by size

5.)


Amplification of specific DNA sequences

6.)


Expressing an exogenous (foreign) protein in a host or
transformed organism.


Discuss with student next to you

From the techniques discussed so far, how
would you determine if
Drosophila

used
hemoglobin?


If they do, how would you determine
when

[what stage] would they use it? Where in
their body would they use it?



Suppose that you just graduated from
college and have started working in a
biotechnology firm. Your first job
assignment is to clone the pig gene for the
hormone prolactin. Briefly explain a
strategy you might use to find and clone
the pig gene for prolactin.

Vectors require a selectable marker such as antibiotic
resistance so that:

a.


the host cell will replicate the vector and GOI [Gene
-
of
-
interest] along with its own chromosome.

b.


host cells taking up vector can be identified against host
cells that have not.

c.


the host cell is able to have a GOI DNA fragment inserted
into it

d.

host cells with the vector are able to express the GOI.

e.

none of the above

Vectors require a selectable marker such as antibiotic resistance
so that:

a.


the host cell will replicate the vector and GOI [Gene
-
of
-
interest] along with its own chromosome.

b.


host cells taking up vector can be identified against host
cells that have not.

c.


the host cell is able to have a GOI DNA fragment inserted
into it

d.

host cells with the vector are able to express the GOI.

e.

none of the above

Recombinant DNA Technology: practice
questions

The
following comprehension questions (at end of each chapter section) in
Brooker
,
Concepts of Genetics

are recommended
:



Comprehension Questions

(at end of each section): 19.1,19.2, 19.3.
Answers to Comprehension Questions are at the very end of every chapter.



Solved
Problems

at end of chapter (answers included): S1, S2, S4



Conceptual
questions

and
Experimental/Application Questions

at end of
chapter (answers found by logging into publisher’s website, or find them in
the book):


Concepts

C1, C2, C4


Application/Experimental Questions

E1, E2, E3, E4, E5, E6, E12,
E13, E14, E15, E16, E17, E24, E25,


A little more challenging

E18, E19 (but first you have to understand
alternative splicing [in
Ch

17], E21, E22