Teacher Notes - Bioinformatics Activity Bank

throneharshBiotechnology

Oct 2, 2013 (3 years and 8 months ago)

132 views

Finding an Open Reading Frame (
ORF
) in a DNA Sequence

Teacher Notes


Overview and concepts

Overview

Students create Java classes to p
arse a DNA sequence to find an Open Reading F
rame.



Grade level

AP Computer Science



Java c
oncepts covered

ArrayLists,
classes, static methods, object methods, passing parameters, returning values from methods.


Prior knowledge required

Open Reading Frame (
ORF
)

In
-
frame sequence

DNA

Nucleotides

Codons

Java String methods


Activity notes

Time frame



Reading: 30 minutes.



Laboratory activity:
90

minutes.

Materials



Java



Java IDE



DNA sequence to be used



Rules for Open Reading Frames


Teaching Tips / Activity Overview

1.

Depending on your students’ backgrounds,
assign reading so that they will understand about
the transcription
of an Open Reading F
rame from a DNA sequence to messenger RNA followed
by translation to a protein.

Explain
start and stop codons and
the
rules that determine what
section of a DNA sequence constitute an Open Reading Frame.

2.

Have students manually identify

an
ORF

in a DNA sequence
:

5'

GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA


3.

Have students code a program to identify an Open Reading Frame

in a sequence of DNA:


String DNAsequence =

"TACGCAATGCGTATCATTCTGCTGGGCGCTCCGGGCGCAGGTAAAGGTACTCAGGCTCAATTCATCATGGAGAAATACGGCATTCCGCAAATCTC
TACTGGTGACATGTTGCGCGCCGCTGTAAAAGCAGGTTCTGAGTTAGGTCTGAAAGCAAAAGAAATTATGGATGCGGGCAAGTTGGTGACTGAT
GAGTTAGTTATCGCATTACTCAAAGAACGTATCACACAGGAAGATTGCCGCGATGGTTTTCTGTTA
GACGGGTTCCCGCGTACCATTCCTCAGGCA
GATGCCATGAAAGAAGCCGGTATCAAAGTTGATTATGTGCTGGAGTTTGATGTTCCAGACGAGCTGATTGTTGAGCGCATTGTCGGCCGTCGGGT
ACATGCTGCTTCAGGCCGTGTTTATCACGTTAAATTCAACCCACCTAAAGTTGAAGATAAAGATGATGTTACCGGTGAAGAGCTGACTATTCGTAA
AGATGATCAGGAAGCGACTGTCCGTAAGCGTCTTA
TCGAATATCATCAACAAACTGCACCATTGGTTTCTTACTATCATAAAGAAGCGGATGCAGG
TAATACGCAATATTTTAAACTGGACGGAACCCGTAATGTAGCAGAAGTCAGTGCTGAACTGGCGACTATTCTCGGTTAATTCTGGATGGCCTTATA
GCTAAGGCGGTTTAAGGCCGCCTTAGCTATTTCAAGTAAGAAGGGCGTAGTACCTACAAAAGGAGATTTGGCATGATGCAAAGCAAACCCGGCG
TATTA
ATGGTTAATTTGGGGACACCAGATGCTCCAACGTCGAAAGCTATCAAGCGTTATTTAGCTGAGTTTTTGAGTGACCGCCGGGTAGTTGATA
CTTCCCCATTGCTATGGTGGCCATTGCTGCATGGTGTTATTTTACCGCTTCGGTCACCACGTGTAGCAAAACTTTATCAATCCGTTTGGATGGAAGA
GGGCTCTCCTTTATTGGTTTATAGCCGCCGCCAGCAGAAAGCACTGGCAGCAAGAATGCCTGATATTC
CTGTAGAATTAGGCATGAGCTATGGTTC
AC";

4.

Require students to use ArrayLists and objects to accomplish this task. Have them develop the
program in steps: a) Parse the string to find stop and start codons. b) Create an object to record
the position of the start and
stop codon and whether the codon is a start or stop codon. c)
Create an ArrayList of these objects
. Each element will represent a start or stop codon.
d)Identify sequence(s) which start with a start codon, end with a stop codon, contain at least
300 nucleo
tides, and are in frame. e) Store all sequences that meet this criteria in an ArrayList
whose elements consist of objects made up of each sequence, the position of its start codon,
and the position of its stop codon.

f) Create the appropriate toString met
hods to print the
original sequence and each
ORF

located in it. Report sequences in line widths of 80.

5.

Here is an example of the expected output:


* Original Sequence

TACGCAATGCGTATCATTCTGCTGGGCGCTCCGGGCGCAGGTAAAGGTACTCAGGCTCAATTCATCATGGAGAAATACGG

CATTC
CGCAAATCTCTACTGGTGACATGTTGCGCGCCGCTGTAAAAGCAGGTTCTGAGTTAGGTCTGAAAGCAAAAGAAA

TTATGGATGCGGGCAAGTTGGTGACTGATGAGTTAGTTATCGCATTACTCAAAGAACGTATCACACAGGAAGATTGCCGC

GATGGTTTTCTGTTAGACGGGTTCCCGCGTACCATTCCTCAGGCAGATGCCATGAAAGAAGCCGGTATCAAAGTTGATTA

TGTGCTGGAGTTTGATGTTCCAGACGAGCTGATTGTTGAGCGCATTGTCGGCCGTCGGGTACATGCTGCTTCAGGCCGTG

TTTATCACGTTAAATTCAACCCACCTAAAGTTGAAGATAAAGATGATGTTACCGGTGAAGAGCTGACTATTCGTAAAGAT

GATCAGGAAGCGACTGTCCGTAAGCGTCTTATCGAATATCATCAACAAACTGCACCATTGGTTTCTTACTATCATAAAGA

AGCGGATGCA
GGTAATACGCAATATTTTAAACTGGACGGAACCCGTAATGTAGCAGAAGTCAGTGCTGAACTGGCGACTA

TTCTCGGTTAATTCTGGATGGCCTTATAGCTAAGGCGGTTTAAGGCCGCCTTAGCTATTTCAAGTAAGAAGGGCGTAGTA

CCTACAAAAGGAGATTTGGCATGATGCAAAGCAAACCCGGCGTATTAATGGTTAATTTGGGGACACCAGATGCTCCAACG

TCGAAAGCTATCAAGCGTTA
TTTAGCTGAGTTTTTGAGTGACCGCCGGGTAGTTGATACTTCCCCATTGCTATGGTGGCC

ATTGCTGCATGGTGTTATTTTACCGCTTCGGTCACCACGTGTAGCAAAACTTTATCAATCCGTTTGGATGGAAGAGGGCT

CTCCTTTATTGGTTTATAGCCGCCGCCAGCAGAAAGCACTGGCAGCAAGAATGCCTGATATTCCTGTAGAATTAGGCATG

AGCTATGGTTCAC





Start cod
on found at position 6


Start codon found at position 66


Start codon found at position 105


Start codon found at position 162


Start codon found at position 291


Stop codon found at position 648


Start codon found at position 657


Stop codon

found at position 666


Stop codon found at position 741


Stop codon found at position 765


Start codon found at position 789


Stop codon found at position 822


Stop codon found at position 834


Stop codon found at position 849


Start codon f
ound at position 888


Stop codon found at position 921


Stop codon found at position 1026


Stop codon found at position 1032


Stop codon found at position 1038


Start codon found at position 1044

ORF

start position: 292
ORF

end position: 651


ORF

Sequence(s)

ATGAAAGAAGCCGGTATCAAAGTTGATTATGTGCTGGAGTTTGATGTTCCAGACGAGCTGATTGTTGAGCGCATTGTCGG

CCGTCGGGTACATGCTGCTTCAGGCCGTGTTTATCACGTTAAATTCAACCCACCTAAAGTTGAAGATAAAGATGATGTTA

CCGGTGAAGAGCTGACTATTCGTAAAGATGATCAGGAAGCGACTGTCCGTAAGCGTCTTATCGAATATCATCAACAA
ACT

GCACCATTGGTTTCTTACTATCATAAAGAAGCGGATGCAGGTAATACGCAATATTTTAAACTGGACGGAACCCGTAATGT

AGCAGAAGTCAGTGCTGAACTGGCGACTATTCTCGGTTAA


*/


Assessment



Programs will be graded
with respect to the correct output, the correct use of ArrayLists and
objects to solve th
e problem, and the algorithm used to determine ORFs.

Extensions



Additional sequences can be obtained online and analyzed with the program.



ORFs can be translated into messenger RNA.



Messenger RNA can be translated into proteins.


Acknowledgments

This lesson and teacher notes were produced by
Cynthia Lang
, adapted from

1.

University of Wisconsin BioWeb:

http://bioweb.uwlax.edu/GenWeb/Molecular/Theory/Translation/Translation_Problems/translation_probl
ems.htm

2.

Bioinformatics Exercises, developed by
Paul Craig, Department of Chemistry, Rochester Institute of
Technology:

http://media.wiley.com/product_data/excerpt/57/04712149/0471214957
-
3.pdf