Genetic engineering of a Lymantria dispar nuclear polyhedrosis ...

puffautomaticBiotechnology

Dec 10, 2012 (4 years and 8 months ago)

208 views

Journal of General Virology (1992), 73, 1509-1514. Printed in Great Britain 1509
Genetic engineering of a Lymantria dispar nuclear polyhedrosis virus for
expression of foreign genes
Zailin Yu,t~ John D. Podgwaite z and H. Alan Wood ~*
1Boyce Thompson Institute for Plant Research at Cornell University, Tower Road, Ithaca, New York 14853 and
2Northeastern Forest Experiment Station, 51 Mill Pond Road, Hamden, Connecticut 06514, U.S.A.
A bacterial lacZ gene was inserted into an isolate of
the Lymantria dispar nuclear polyhedrosis virus
(LdMNPV). The transfer vector was constructed by
site-directed mutagenesis of the translation start site of
the LdMNPV polyhedrin gene, within the BgllI E
fragment of the viral genome. A multiple cloning
sequence was inserted at this start site and used for the
insertion of the lacZ gene into the transfer plasmid.
Liposome transfection was used to cotransfect L.
dispar tissue culture cells with viral DNA and the
transfer plasmid. Recombinant LdMNPV isolates
were purified by isolation of plaques producing fl-
galactosidase but not polyhedra. Restriction enzyme
fragment profiles were used to determine the site of the
lacZ gene insertion, and DNA sequencing of the 5' and
3' ends of the lacZ gene insert and the adjoining
polyhedrin promoter and coding regions was per-
formed to identify its precise location. Expression of
the lacZ gene was examined by studying virus-induced
protein using [3SS]methionine pulse-labelling, SDS-
PAGE fractionation and autoradiography. Expression
of fl-galactosidase was examined in tissue culture cells
using colorimetric assays. The maximum rate of fl-
galactosidase production was approximately 50 inter-
national units (IU)/106 tissue culture cells/day between
3 and 4 days post-infection (p.i), and the peak total
expression was 158 IU/106 cells 5 days p.i. fl-
Galactosidase activity was first detected 48 h p.i. in
haemolymph samples from fo~arth instar L. dispar
larvae injected with 106 p.f.u, of virus. The peak fl-
galactosidase activity in larval haemolymph samples
was 1931 IU/ml of haemolymph at 11 days p.i., just
prior to death.
The Lymantria dispar nuclear polyhedrosis virus
(LdMNPV) is a pathogen of L. dispar (gypsy moth) and
plays an important role in the natural regulation of gypsy
moth populations in the north-eastern U.S.A. (Podg-
waite, 1981 ; Lewis & Yendol, 1981). When gypsy moth
larval populations reach high density, natural virus
epizootics usually occur, often killing greater than 90%
of the larvae. The LdMNPV host range is limited to a
few insects and does not include beneficial insects. Based
on its safety for vertebrates and potential to cause
devastating epizootics, LdMNPV has been proposed as a
potential alternative to synthetic chemical pesticides in
the control of gypsy moths (Lewis, 1981). In 1978, the
U.S. Forest Service petitioned and received registration
of LdMNPV as a pesticide from the U.S. Environmental
Protection Agency (Lewis et al., 1979), and it is currently
being commercially produced and applied by the U.S.
Forest Service for control of the gypsy moth in hardwood
forests.
i Present address: Cold Spring Harbor Laboratory, Cold Spring
Harbor, New York 11724, U.S.A.
0001-0705 © 1992 SGM
A major problem with using LdMNPV as a pesticide
is that the virus acts slowly, similarly to other baculo-
viruses, taking between 8 and 13 days to kill larvae
(Magnoler, 1974). Owing to this, the improvement of the
pesticidal properties of baculoviruses by the insertion of
foreign pesticidal genes into the genome has been
proposed. Previously, foreign genes with the potential to
increase pesticidal properties have been inserted into the
Autographa californica (Ac) and Bombyx mori MNPV.
These have included the Buthus eupeus insect toxin-1
(Carbonell et al., 1988), the Manduca sexta diuretic
hormone (Maeda, 1989), the Bacillus thuringiensis ssp.
kurstaki HD-73 delta-endotoxin (Merryweather et al.,
1990), the Helicoverpa virescens juvenile hormone ester-
ase (Hammock et al., 1990), the Pyemotes tritici TxP-I
toxin (Tomalski & Miller, 1991) and the Adroctonus
australis neurotoxin (Stewart et al., 1991 ; Maeda et al.,
1991) genes. These genes were inserted into the viral
genomes under the control of the polyhedrin or p 10 gene
promoter; the polyhedrin and pl0 genes are both under
the control of late strong transcriptional promoters and
are non-essential for virus replication.
1510 Short communication
To improve the efficacy of the current LdMNPV
control strategy, a programme was initiated to develop
genetically enhanced LdMNPV pesticides that would be
environmentally acceptable. A physical map of the
166.6 kb DNA genome of LdMNPV, as well as the
location and nucleotide sequence of the LdMNPV
polyhedrin gene, have been reported (Smith et al., 1988).
Based on this information, the present study developed
transfer vectors and efficient transfection procedures for
the genetic engineering of the LdMNPV genome.
The LdMNPV G2 isolate was plaque-purified (Wood,
1977) from the LdMNPV G isolate (Smith et al., 1988)
using L. dispar tissue culture cells (IPLB-LD-652Y)
grown at 27 °C in modified TNMFH medium (Wood,
1980). The LdMNPV polyhedrin promoter and gene
have previously been mapped to the 10-7 kb BgllI E
fragment, and the complete nucleotide sequence has
been determined (Smith et al., 1988). An LdMNPV
transfer vector was constructed using the BgllI E
fragment to replace the LdMNPV polyhedrin gene with
a foreign gene under the control of the polyhedrin gene
promoter. Since the BgllI E fragment did not contain the
appropriate restriction sites to allow the direct removal
of the polyhedrin gene coding sequence and insertion of
foreign gene sequences, site-directed mutagenesis was
used to change the bases surrounding the ATG transla-
tion start site into a BamHI site.
The construction of the LdMNPV transfer vector is
outlined in Fig. 1. Plasmids were propagated in
Escherichia coli D50t cells. All enzymes were purchased
from Promega and used as suggested by the manufac-
turer. The 10-7 kb LdMNPV BgllI E fragment DNA
was isolated following electrophoresis in 1% agarose gels
(Maniatis et al., 1982), extracted using Geneclean (Bio
101) and cloned into the BamHI site of a modified
pBluescript SK + plasmid (Stratagene). The plasmid had
been previously modified to remove the ApaI site by
digestion wtih ApaI, T4 DNA polymerase digestion and
blunt end ligation. This plasmid was designated pLdl. 0.
The 5.1 kb ApaI fragment within this plasmid was
subcloned into pBluescript SK + and referred to as pLd-
B. The remainder of the plasmid was religated and
referred to as the pLd-A plasmid.
Site-directed mutagenesis was then performed using
the Muta-Gene phagemid in vitro mutagenesis kit (Bio-
Rad), based on the phagemid vector system of McClary
et al. (1989). E. coli CJ236 cells infected with helper
phage M13 K07 were transformed with t.i~ pLd-B
plasmid. A synthetic oligonucleotide, 5' AAAAT)UAAA
TACACCGTAGGATCCACAACTTTTACAACTA
3', was annealed to the single-stranded U-DNA. The
underlined bases in this oligonucleotide indicate the
mutated region at the translation start site of the
polyhedrin gene; the parent virus sequence was
AAATG. The second strand was extended using T4
DNA polymerase in the presence of four dNTPs and
ligated using T4 DNA ligase. The mutant product was
transferred into E. coli MV1190 by transformation and
identified by the new BamHI site within the ApaI
fragment. The mutated ApaI fragment was isolated
following agarose gel electrophoresis and inserted into
the pLd-A plasmid (from which the original ApaI
fragment had been removed prior to mutagenesis). This
plasmid was referred to as pLd2.0 and was suitable for
insertion of foreign genes at the unique BamHI site.
The utility of the pLD2.0 transfer vector was
expanded by (i) removal of the ApaI site, which was
upstream from the mutated polyhedrin gene, by partial
digestion with ApaI, treatment with the Klenow frag-
ment of DNA polymerase I and blunt end ligation, (ii)
removal of the pBluescript polylinker from the pLd2.0
plasmid by digestion with Sinai and KpnI, treatment
with the Klenow fragment and blunt end ligation, (iii)
removal of the BamHI-ApaI fragment (186 bp at the 5'
end of the polyhedrin gene coding sequence) and (iv)
insertion of the BamHI-ApaI polylinker fragment from
pBluescript SK+. The resulting transfer plasmid
(pLd2.1) contained unique BamHI, SmaI, EcoRI,
EcoRV, HindlII, ClaI and ApaI sites immediately
downstream from the polyhedrin gene promoter.
The E. coli lacZ gene was excised from a modified
pCH110 plasmid (Possee & Howard, 1987) by digestion
with BgllI and BamHI. The pCH110 plasmid had been
modified by replacement of a HindlII site with a BgllI
site. The fragment containing the lacZ gene was purified
from an agarose gel and cloned into the BamHI site of
pLd2.1, creating the plasmid pLd2. l-gal.
Transfection of L. dispar tissue culture cells with
LdMNPV DNA was performed using calcium phos-
phate (Burand et al., 1980), electroporation (Mann &
King, 1989) and Lipofectin (BRL) procedures. Accord-
ing to cytopathology and progeny virus titres, the
transfection efficiency with all three procedures was low.
To determine whether the low transfection rates were a
property of the cells or the virus, a comparison of the
transfection efficiency using LdMNPV and AcMNPV
DNA was performed using the Lipofectin procedure.
One-million log phase L. dispar tissue culture cells were
seeded into a 35 mm well, washed three times with
serum-free Grace's medium and covered with 1 ml of
serum-free TNMFH medium. The lipofection mixture
was made by suspending 25 p.g liposome in 50 gl water
and then adding 50 gl water containing 2 p.g viral DNA.
The mixture was incubated for 30 min at room
temperature, then added dropwise to cells and incubated
at 27 °C for 16 h. TNMFH medium (1 ml) containing
2 x (20%) foetal bovine serum was added and the cells
were incubated at 27 °C. Typically, at 3 and 10 days post-
Short communication 1511
(a) Bglll E fragment of LdMNPV genome
Php Phg
I I
Bg A A
B/Bg Bg I
':Y Amp A :'
Bl"~2i~tsK
"~t ~ ''~ // ~ ~, Amp /f~'A
:}/" pLd-A ~ '::::'
..~--'-'~-~ ~,o% A /
" B/Bg,
c,
/ f'~s Amp ~ A
B/Bg~ \ ~ I. Deletion of the ApaI site
17 pLd2.0 / / S' to Phg.
~ 13.60kb /2. DeletionofSmalKpnl
fragment (pBluescript
polylinker).
x~Phg j f 3. Replacement of Phg
Apal-BamH1 fragment
~ J with polylinker.
A t
B
I
Bg
Fig. 1. SchemeofconstructionoftheLdMNPVtransfervectors. (a)TheBgllI(Bg)Efragment, containing the polyhedrin gene coding
region (Phg) and promoter region (Php), was inserted into the BamHI (B) cloning site of pBluescript SK + from which the ApaI (A) site
had been removed. (b) The ApaI fragment was cloned into pBluescript SK+ and modified by site-directed phagemid mutagenesis,
creating a BamHI site. (c) The mutated 5' region of the polyhedrin gene and promoter were reinserted into pLd-A, creating a
translationally inactive polyhedrin gene with a unique BamHI cloning site. The ApaI site (5' to Phg) was removed from pLd2.0, the
SmaI-KpnI fragment (pBluescript polylinker fragment) was removed as was the ApaI-BamHI fragment, and a polylinker from
pBluescript SK+ was inserted. The polylinker contains cloning sites for BamHI, SmaI, EcoRI, EcoRV, HindlII, ClaI and ApaI.
transfection, approximately 6x 108 p.f.u./ml of
AcMNPV and 4.5 x 107 p.f.u./ml of LdMNPV, respec-
tively, were present in the medium. The difference in
progeny titres was consistent with the percentage of
transfected cells determined by microscopic observa-
tions. The lower transfection efficiency of LdMNPV
may result from its genome being approximately 30%
larger than that of AcMNPV.
The highest percentage of recombinant LdMNPV
isolates was achieved using the Lipofectin procedure (see
above) with 2 ~tg viral DNA and 2 Bg pLD2.1-gal
plasmid DNA. Following incubation at 27 °C for 6 days,
1512 Short communication
the extracellular virus was harvested and plaque-assayed
(Wood, 1977). Recombinant viruses producing/~-galac-
tosidase were identified as blue plaques following
incubation with 200 ~tg/ml X-gal (Sigma). The wild-type
(wt) LdMNPV plaques were generally diffuse and
contained cells with low numbers of polyhedra. There-
fore, in the absence of reporter gene expression, isolation
of polyhedrin-minus LdMNPV recombinants would be
problematic. Recombinant virus was purified by a series
of three isolations of plaques producing a blue colour and
no polyhedra.
Following plaque purification, the recombinant virus
DNA restriction fragment profile was compared with
that of the wt virus. The BgllI E fragment of the
recombinant virus DNA was 3-8 kb larger than that of wt
virus (data not shown), which is consistent with the
insertion of the lacZ gene. To verify the exact nature of
the lacZ gene insertion, the BgllI E fragment from the
recombinant virus was purified and cloned into pBlue-
script SK+. Sequencing reactions were performed by
the chain termination method of Sanger et al. (1977)
using [~-35S]dATP and Sequenase version 2.0 (United
States Biochemical). The junctions of the LdMNPV and
inserted DNA sequences were sequenced using the
primers 5' GTCGATTTGCGCAACTAATC 3' and 3'
CGACCACCAGTTGACCTCG 5'. These primers hy-
bridize to regions from 92 to 111 bp upstream and 255 to
273 bp downstream from the polyhedrin translation start
site, respectively (Smith et al., 1988). A 6~o Sequagel
(National Diagnostics) gel was used for electrophoretic
separation. The 111 bp immediately upstream from the
wt polyhedrin gene coding sequence were identical to the
sequence reported previously (Smith et al., 1988). Using
site-directed mutagenesis the translation start site of the
wt virus, AAAATGCAC, had been converted to
AGGATCTGA in the recombinant virus DNA. There
was a 90 residue non-coding region between the altered
polyhedrin gene translation start site and that of the lacZ
gene, consistent with the data of Mulligan & Berg (1981 ).
Sequencing of the 3' junction confirmed the predicted
location of the insert at the BamHI recognition site in the
polylinker.
Pulse-labelling of virus-induced proteins in infected L.
dispar cells for 6 h was performed using [3SS]methionine
at 96 h post-infection (p.i.) according to Wood (1980).
Fig. 2 shows an autoradiogram of wt and recombinant
virus-induced proteins. The wt LdMNPV sample (lane
2) contained a major polyhedrin protein band with an Mr
of approximately 30K. This band was absent from the
recombinant virus sample (lane 3), which contained a
new band with an Mr of 120K, corresponding to /~-
galactosidase. It should be noted that even at 96 h p.i. the
LdMNPV cells were still producing large amounts of
host cell protein.
1 2 3
80K-
49.5K -
32.5K -
27.5K-
Fig. 2. Autoradiogram ofproteinsinL, dispartissueculturecellsmock-
infected (lane 1) or infected with the G2 isolate of LdMNPV (lane 2) or
the lacZ-containing recombinant LdMNPV (lane 3). The samples were
labelled at 96 h p.i. with [3SS]methionine for 6 h, and the proteins were
resolved on an 11 ~ SDS-polyacrylamide gel. The dot indicates the
position of the polyhedrin protein (30K) in lane 2; the star indicates the
position of fl-galactosidase (120K) in lane 3. The position of Mr
markers are indicated to the left.
Tissue culture cells were infected with recombinant
LdMNPV at a multiplicity of 30 p.f.u./cell and incubated
at 27 °C. At various times p.i. samples were sonicated in
a water bath for 5 s to disrupt the cells, fl-Galactosidase
activity was measured using the rate of cleavage of
o-nitrophenyl-fl-D-galactoside (Sigma). Absorbance
measurements were made at 420 nm, and activity was
expressed in international units (IU) using the formula
IU/ml = [(A420 x 1500 ~tl)/(4.5 x min inchbation x ~tl
sample)].
fl-Galactosidase activity was first detected in tissue
culture cells 18 to 24 h p.i., and thereafter was assayed at
24 h intervals for 12 days. The maximum rate of fl-
galactosidase production was approximately 50 IU/106
cells/day between 3 and 4 days p.i.; the peak total
expression was 158 IU/106 cells at 5 days p.i.
fl-Galactosidase activity and survival times were also
determined following infection of L. dispar larvae
obtained from a laboratory-reared colony (Northeastern
Forest Experiment Station, Hamden, Conn., U.S.A.)
and maintained on a high wheatgerm diet (Bell et al.,
1981). Fourth (fl-galactosidase assays) or third (survival
time assays) instar gypsy moth larvae were injected with
Short communication 1513
10 ~tl of tissue culture medium containing 106 p.f.u, wt or
recombinant virus; control larvae were injected with
10 p.1 of water. Larvae were incubated on the diet at
28 °C.
fl-Galactosidase activity was first detected in haemo-
lymph samples from larvae at 48 h p.M. with the
recombinant LdMNPV. The peak/~-galactosidase activ-
ity was 1931 IU/ml of haemolymph at l 1 days p.M., just
prior to death. Haemolymph from control and wt virus-
infected larvae contained no detectable fl-galactosidase
activity.
The time at which 50% of larvae died (STso) was
determined using third instar larvae injected with
recombinant virus, LdMNPV-G2 or water, and the
ViStat Bioassay Program (Boyce Thompson Institute,
Cornell University, Ithaca, N.Y., U.S.A.). Each group
consisted of 10 larvae and mortality was recorded at 24 h
intervals. None of the control larvae died. The STso for
the recombinant and G2 isolates of LdMNPV was
8.2 + 0.7 and 7.4 + 0.7 days, respectively; those values
are not significantly different. It was anticipated that
removal of the polyhedrin gene would not significantly
alter the time to death. However, more precise tech-
niques will be needed to evaluate critically any difference
in STso.
This is the first report of the construction of a
genetically engineered isolate of LdMNPV. This pre-
liminary research now provides the materials required
for the enhancement of the pesticidal properties of
LdMNPV through the insertion of pesticidal genes. The
goal will be to kill insect larvae more rapidly or to cause
cessation of feeding sooner after infection. Although
LdMNPV is currently being commercially produced and
applied to control gypsy moth infestations, the virus acts
slowly and its utility as a pesticide can be significantly
improved through genetic manipulations. To address the
environmental issues concerning the release of geneti-
cally engineered viruses (Wood & Granados, 1991;
Wood, 1991), LdMNPV studies are being conducted to
evaluate the environmental persistence of the virus using
the co-infection/co-occlusion strategy (Hamblin et al.,
1990).
We thank Martha Hamblin for her technical assistance and Dr P. R.
Hughes for the statistical analyses. We wish to thank Dr R. D. Possee
for the modified pCH 110 plasmid. This investigation was supported by
US Forest Service Fed. Agr. no. 23-243.
References
BELL, R. A., OWENS, C. D., SHAPIRO, M. & TARDIF, J. R. (1981). Mass
rearing and virus production. Development of mass-rearing techno-
logy. In The Gypsy Moth: Research Toward Integrated Pest
Management, pp. 599-655. Edited by C. C. Doane & M. L.
McManus. Forest Service Technical Bulletin 1584.
BURANO, J. P., SUMMERS, M. D. & SMITH, G. E. (1980). Transfection
with baculovirus DNA. Virology 101, 286-290.
CARBONELL, L. F, HODGE, M. R., TOMALSKI, M. D. & MILLER, M. K.
(1988). Synthesis of a gene coding for an insect-specific scorpion
neurotoxin and attempts to express it using baculovirus vectors. Gene
73, 409-418.
HAMBLIN, M., VAN BEEK, N. A. M., HUGHES, P. R. & WOOD, H. A.
(1990). Co-occlusion and persistence of a baculovirus mutant lacking
the polyhedrin gene. Applied and Environmental Microbiology 56,
3057-3062.
HAMMOCK, B. O., BONNING, B. C., POSSEE, R. D., HANZLIK, T. N. &
MAEOA, S. (1990). Expression and effects of the juvenile hormone
esterase in a baculovirus vector. Nature, London 344, 458-461.
LEWIS, F. B. (1981). Gypsy moth nucleopolyhedrosis virus: introduc-
tion. In The Gypsy Moth: Research Toward Integrated Pest
Management, pp. 454-455. Edited by C. C. Doane & M. L.
McManus. Forest Service Technical Bulletin 1584.
LEWIS, F. B. & YENDOL, W. G. (1981). Gypsy moth nucleopolyhedrosis
virus: efficacy. In The Gypsy Moth: Research Toward Integrated Pest
Management, pp. 503-512. Edited by C. C. Doane & M. L.
McManus. Forest Service Technical Bulletin 1584.
LEwis, F. B., MCMANUS, M. L. & SCHNEEBERGER, i. F. (1979).
Guidelines for the use of gypchek to control the gypsy moth. USDA
Research Paper NE-441.
MCCLARY, J. A., WITNEY, F. & GEISSELSODER, J. (1989). Efficient site-
directed in vitro mutagenesis using phagemid vectors. Bio/Techniques
7, 282-289.
MAEDA, S. (1989). Increased insecticidal effect by a recombinant
baculovirus carrying a synthetic diuretic hormone gene. Biochemical
and Biophysical Research Communications 165, 1177-1183.
MAEDA, S., VORLRATH, S. L., HANZLIK, T. N., HARPER, S. A., MAJIMA,
K., MADDOX, D. W., HAMMOCK, B. D. & FOWLER, E. (1991).
Insecticidal effects of an insect-specific neurotoxin expressed by a
recombinant baculovirus. Virology 184, 777-780.
MAGNOLER, A. (1974). Bioassay of a nuclear polyhedrosis virus of the
gypsy moth, Porthetria dispar. Journal of Invertebrate Pathology 23,
190-196.
MANIATIS, T., FRITSCH, E. F. & SAMBROOK, J. (1982). Molecular
Cloning: A Laboratory Manual. New York: Cold Spring Harbor
Laboratory.
MANN, S. G. & KING, L. A. (1989). Efficient transfection of insect cells
with baculovirus DNA using electroporation. Journal of General
Virology 70, 3501-3505.
MERRYWEATHER, A. T., WEYER, U., HARRIS, M. P. G., HIRST, M.,
BOOTH, T. & POSSEE, R. n. (1990). Construction of genetically
engineered baculovirus insecticides containing the Bacillus thurin-
giensis subsp, kurstaki HD-73 delta endotoxin. Journal of General
Virology 71, 1535 1544.
MULLIGAN, R. C. & BERG, P. (1981). Factors governing the expression
of a bacterial gene in mammalian cells. Molecular and Cellular
Biology 1, 449-459.
PODGWAITE, J. D. (1981). Natural disease within dense gypsy moth
populations. In The Gypsy Moth: Research Toward Integrated Pest
Management, pp. 125-134. Edited by C. C. Doane & M. L.
McManus. Forest Service Technical Bulletin 1584.
POSSEE, R. n. & HOWARD, S. C. (1987). Analysis of the polyhedrin gene
promoter of the Autographa californica nuclear polyhedrosis virus.
Nucleic Acids Research 15, 10233-10248.
SANGER, F., NICKLEN, S. & COULSON, A. R. (1977). DNA sequencing
with chain-terminating inhibitors. Proceedings of the National
Academy of Sciences, U.S.A. 74, 5463-5467.
SMITH, [. R. L., VAN BEEK, N. A. M., PODGWAITE, J. D. & WOOD, H. A.
(1988). Physical map and polyhedrin gene sequence of Lymantria
dispar nuclear polyhedrosis virus. Gene 71, 97-105.
STEWART, L. M. D., HIRST, M., FERBER, M. L., MERRYWEATHER, A. T.,
CAYLEY, P. J. & POSSEE, R. D. (1991). Construction of an improved
baculovirus insecticide containing an insect-specific toxin gene.
Nature, London 352, 85-88.
TOMALSKI, M. & MILLER, L. K. (1991). Insect paralysis by baculovirus-
mediated expression of a mite neurotoxin gene. Nature, London 352,
82-85.
1514 Short communication
WooD, H. A. (1977). An agar overlay plaque assay method for
Autographa californica nuclear polyhedrosis virus. Journal of Inverte-
brate Pathology 29, 304-307.
WooD, H. A. (1980). Isolation and replication of an occlusion body-
deficient mutant of the Autographa californica nuclear polyhedrosis
virus. Virology 105, 338-344.
WooD, H. A. (1991). Development of genetically enhanced baculo-
virus pesticides. In Biotechnology for Biological Control of Pests and
Vectors, pp. 69-76. Edited by K. Maramorosch. Boca Raton:
CRC Press.
WooD, H. A. & GRANAOOS, R. R. (1991). Genetically engineered
baculoviruses as agents for pest control. Annual Review of Micro-
biology 45, 69-87.
(Received 22 October 1991; Accepted 6 February 1992)