Supplementary Table 2 List of primers used for qRT-PCR experiments

portertoaststicksBiotechnology

Oct 23, 2013 (3 years and 9 months ago)

166 views

Supplementary Table 2


List of primers used for q
RT
-
PCR experiments

Name

Specificity

Forward (5’



3’)

Reverse (5’


3’)

Target

Reference

rpoB

rpo
B

AACATCGGTTTGATCAAC

CGTTGCATGTTGGTACCCAT

rpoB

2
7

Lachno

Lachnospiraceae

CGGTACCTGACTAAGAAGC

AGTTTYATTCTTGCGAACG

16S
rDN
A

2
7

Eub338

All Bacteria

ACTCCTACGGGAGGCAGCAG

ATTACCGCGGCTGCTGG

16S
rDN
A

S
1

Bact934

Bacteroidetes

GGARCATGTGGTTTAATTCGATGAT

AGCTGACGACAACCATGCAG

16S
rDN
A

S1

Firm

F
irmicutes

GGAGYATGTGGTTTAATTCGAAGCA

AGCTGACGACAACCATGCAC

16S
rDN
A

S1

Bac32

Bacteroides
-
Prevotella

AACGCTAGCTACAGGCTT

CCAATGTGGGGGACCTTC

16S
rDN
A

S1

W102
-
W105

All Bacteria

CGGTGAATACGTTCYCGG

GGWTACCTTGTTACGACTT

16S
rDN
A

S
2

ASF 360

Lactobacillus

CGGCGGATGGGTGAGTAAC

GTATTAGCACCTGTTTCCAAGTGGTA

16S rDNA

S
3

ASF 361

Lactobacillus murinus

GTGGCGAACGGGTGAGTAA

GCACCTGTTTCCAAGTGTTATCC

16S rDNA

S
3

ASF 519

Bacteroides

ATTGCCGTTGGAAATGTTATCC

CCTTCGCAATCGGAGTTCTG

16S rDNA

S
3

ASF 457

Flexistipes

TGCAAGAATGAAACTCAAAGGAAT

TAAGGTTCTTCGGTTAGCATCGA

16S rDNA

S
3

ASF 356

Clostridium

AACGCCGCGTGAAGGAA

ACGCTTGCCCCCTACGTATT

16S rDNA

S
3

ASF 492

Eubacterium plexicaudatum

TGGAGCATGTGGTTTAATTCGA

TGCACCACCTGTCTGCAATG

16S rDNA

S
3

ASF 500

Firmicutes

GCTGCTAATACCGCATGATATGTC

CAGACGCGAGTCCATCTCAGA

16S rDNA

S
3

ASF 502

Clostridium

GCTACAATGGCGTAAACAAAGAGA

TCCGAACTGAGACGTTATTTTTGA

16S rDNA

S
3

Bacteroides

Bacteroides

GAGAGGAAGGTCCCCCAC

CGCTACTTGGCTGGTTCAG

16S rDNA

S
4

Bacillus

Bacillus

GCGGCGTGCCTAATACATGC

CTTCATCACTCACGCGGCGT

16S rDNA

25

A.baum16S

Acinetobacter Baumanni

GGAACTTTAAGGATACTGCCAGTG

GGTCGTAAGGGCCATGATGAC

16S
rDNA

S
5

Ac436
-
676

Acinetobacter

TTTAAGCGAGGAGGAGG

ATTCTACCATCCTCTCCC

16S
rDNA

S
6


List of probes used for FISH experiments

Name

Specificity

Sequence (5’


3’)

Target position

Reference

Eub338

Eubacteria

GCTGCCTCCCGTAGGAGT

16S

rRNA
, 338
-
355

S
7

Non338

None

ACTCCTACGGGAGGCAGC

None

S
8

ACA652

Acinetobacter

ATCCTCTCCCATACTCTA

16S

rRNA
, 652
-
669

S
9

CteA

Comamonas testosteron
i

CATGACCCGGGGATATTAGC

16S rRNA, 462
-
481

S
10

ALF968

Alphaproteobacteria

GGTAAGGTTCTGCGCGTT

16S rRNA
, 968
-
985

S
1
1

BET42a

Betaproteobacteria

GCCTTCCCACTTCGTTT

23S rRNA, 1027
-
1043

S
1
2

GAM42a

Gammaproteobacteria

GCCTTCCCACATCGTTT

23S rRNA, 1027
-
1043

S
1
2

CF319a

Flavobacteria

TGGTCCGTGTCTCAGTAC

16S rRNA, 319
-
336

S
1
3

BAC303

Bacteroidaceae,
Prevotellaceae

CCAATGTGGGGGACCTT

16S rRNA,

303
-
319

S
1
3

Pce

Burkholderia

CCCATCGCATCTAACAAT

23S rRNA, 1406
-
1423

S
1
4

COM1424

Comamonas

ACCTCATTCTGGCGAGA

16S rRNA, 1424
-
1440

S
15

LGC354A

Firmicutes

TGGAAGATTCCCTACTGC

16S rRNA, 354
-
371

S
16

LGC354B

Firmicutes

CGGAAGATTCCCTACTGC

16S rRNA, 354
-
371

S
16

LGC254C

Firmicutes

CCGAAGATTCCCTACTGC

16S rRNA, 354
-
371

S
16



Supplementary references


S
1
.
Rehman, A., et al.

2011.
Nod2 is essential for temporal development of intestin
al microbial communities
Gut
.
doi:
10
.1136
.

S
2
.
Moletta
-
Denat, M.
, et al.

2010
.

Selective microbial aerosolization in biogas demonstrated by quantitative PCR.

Bioresour
.

Technol
.
101
:7252
-
725
7.

S
3
.
Deloris
-
Alexander
, A., et al.

2006
Quantitative PCR assays for mouse enteric
microbiota

reveal strain
-
dependent differences in composition
that are influenced by the microenvironment
.

Mammalian Genome
.

17
:1093
-
1104.

S
4
.
Guo, X.
, et al.

200
8
.

Development of a real
-
time PCR method for Firmicutes and Bacteroidetes in faeces and its application to quantify
intestinal population of obese and lean pigs.

Lett
.

Appl
.

Microbiol
.

47
:367
-
3
73.

S
5
.
Rios
-
Licea, M. M.
, F. J. Bosques, A. C. Arroliga
, J. O. Galindo
-
Galindo, and E. Garza
-
Gonzalez.

2010
.

Quadruplex real
-
time
quantitative PCR assay for the detection of pathogens related to late
-
onset ventilator
-
associated pneumonia: a preliminary report.

J
.

Microbiol
.

Methods
.
81
:232
-
23
4.

S
6
.
Vanbroekhoven, K.
, A. Ryngaert, P. Wattiau, R. Mot, and D. Springael.

2004
.

Acinetobacter diversity in environmental samples
assessed by 16S rRNA gene PCR
-
DGGE fingerprinting.

FEMS Microbiol
.

Ecol
.

50
:37
-
50.

S
7
.
Amann, R. I.
, L. Krumholz, and D. A. Stahl.

1990
.

Fluorescent
-
oligonucleotide probing of whole cells for determinative, phylogenetic,
and environmental studies in microbiology.

J
.

Bacteriol
.

172
:762
-
7
70.

S
8
.
Manz, W.
, et al.

1993
.

In situ identification of bacteria in drinking water and adjoining

biofilms by hybridization with 16S and 23S rRNA
-
directed fluorescent oligonucleotide probes.

Appl
.

Environ
.

Microbiol
.

59
:2293
-
229
8.

S
9
.
Wagner, M., et al.

1994
.

Development of an rRNA
-
targeted oligonucleotide probe specific for the genus Acinetobacter

and its application
for in situ monitoring in activated sludge.

Appl
.

Environ
.

Microbiol
.

60
:792
-
800.

S
10
.
Bathe, S.
, and M. Hausner.

2006
.

Design and evaluation of 16S rRNA sequence based oligonucleotide probes for the detection and
quantification of
Comamonas testosteroni in mixed microbial communities.

BMC Microbiol
.

6
:54.

S
11
.
Neef, A.
, et al.

1996
.

Population analysis in a denitrifying sand filter: conventional and in situ identification of Paracoccus spp. in methanol
-
fed biofilms.

Appl
.

Environ
.

Microbiol
.
62
:4329
-
43
39.

S12.

Manz, W., R. Amann, W. Ludwig, M. Wagner, and K. H. Schleifer.

1992
.

Phylogenetic oligonucleotide probes for the major subclasses
of proteobacteria: problems and solutions
.

Syst
.

Appl
.

Microbiol.

15
:
593

600.

S
13
.
Manz, W.
, R.
Amann, W. Ludwig, M. Vancanneyt, and K. H. Schleifer.

1996
.

Application of a suite of 16S rRNA
-
specific
oligonucleotide probes designed to investigate bacteria of the phylum cytophaga
-
flavobacter
-
bacteroides in the natural environment.

Microbiology
.

142
:10
97
-
1
106.

S
14
.
Schleifer, K. H., et al.

1992.

Nucleic acid probes for the identification and in situ detection of pseudomonads. Pseudomonas: Molecular
Biology and Biotechnology (Galli E, Silver S & Witholt B, ed), pp. 127

134.


S
15
.
Amann, R., J. Snaidr
, M. Wagner, W. Ludwig, and K. H. Schleifer.

1996.

In situ visualization of high genetic diversity in a natural
microb
ial community.
J
.

Bacteriol.

178
:
3496

3500.

S16.
Meier, H.
, R. Amann, W. Ludwig, and K. H. Schleifer
.

1999
.

Specific oligonucleotide probe
s for in situ detection of a major group of
gram
-
positive bacteria with low DNA G + C content.

Syst
.

Appl
.

Microbiol
.

22
:186
-
1
96.