SUPPLEMENTARY DATA Deletions in GRID2 lead to a recessive ...

portertoaststicksBiotechnology

Oct 23, 2013 (3 years and 11 months ago)

179 views

1


SUPPLEMENTARY
DATA

Deletions in
GRID2

lead to a recessive syndrome of cerebel
lar ataxia and tonic upgaze

in humans


Table of Contents

I.

E
-
Methods

2
-
6

II.

E
-
Figures



F
igure e
-
1.

Atrophy of the cerebellar flocculus in the individual CH
-
5401



Figure e
-
2
.

Quantification of cerebellar vermal and int
ra
cranial areas on
brain MRI

7


Figure e
-
3
.

SNP genotypes and LOD scores of the CH
-
4900 family in the
candidate region
on chromosome 4q

8


Figure e
-
4
.

Microsatellite marker analysis on chromosome 4q in the CH
-
5400 family



9


Figure e
-
5
.

Quantitative PCR Analysis of
GRID2

exonic deletions in the CH
-
4900 and
CH
-
5400

families

10


Figure e
-
6
.

Chromatograms of sequencing across
GRID2

deletion
breakpoints



11

III.

E
-
Tables

12


Table e
-
1.

Primer sequences

13


Table e
-
2.

Largest blocks of homozygosity shared by all affe
cted
individuals in the CH
-
4900

family



IV.

E
-
References

14












2

I.

E
-
Methods


Quantification of cerebellar vermal and int
ra
cranial area
s on brain MRI


A midline
sagittal image was identified for each of the MRI series

(CH
-
4901 at 10
months and 4 years, CH
-
5401 at 14 months and 4 years, and neurological
ly

normal control
individuals
at

13 months and 4 years of age)
, and the images were imported i
nto the ImageJ
softw
are
.

e
1

An outline of the cerebellar vermis and intracranial area was drawn

as
previously
described
e
2

using the polygon t
ool. T
he area was measure
d

using
the scale bar on the MRI
image as
a
reference.


Genomic DNA isolation and purification

From the whole blood, leukocytes were isolated and the DNA extraction was performed
on
a

Qiagen M48 BioRobot using the MagAttract M48 Blood Midi Kit (Qiagen). From the

saliva,
DNA was extracted according to the manufacturer’s protocol.


SNP genotyping and linkage analysis

Genome
-
wide SNP genotyping was performed at the W.M. Keck Foundation
Biotechnology Resource
Laboratory at Yale University.
Each member of the family was
genotyped using either the Illumina Omni Express

or Illumina 660w microarrays.
Only SNPs
present on both

chips were used for analysis.
The SNPs were filtered against a larger group of
414 samples run on the same chips
. Any

SNP that genotyped at <95% of all samples, had a
MAF>10%, or deviated from Hardy
-
Weinberg equilibrium with a p
-
value of <0.00000001 were
removed from further analysis.
Any markers that were missing from one or more individuals
within the pedigree, were ho
mozygous in all members of the pedigree, or had Mendelian
inheritance errors were removed from all members of the pedigree
.
Linkage disequilibrium
-
based SNP pruning was performed with PLINK, using genotype data from 85 unrelated

3

individuals r
un on the same

Illumina chips.
Multipoint LOD scores were calculated using
MERLIN

and

assuming a recessive mode of disease inheritance, full penetrance, and a disea
se
allele frequency of 0.0001.
Runs of homozygosity were calculated using custom Perl scripts,
allowing fo
r no more than 2 consecutive heterozygous SNPs in a run and 3 heterozygous calls

in every 10 consecutive SNPs.
Intervals homozygous for the same haplotype and shared by all
affected individuals were used to narrow the
disease
locus in the family.


Array CG
H (comparative genomic hybridization)

Probe spacing for the custom microarray was selected as follows: 350bp for the three
regions where a deletion was suspected by SNP genoty
ping array or clinical chromosome
microarray

(chr4:92,267,5
59
-
92,286,605, chr4:93
,409,932
-
93,754,412, and chr4:94,014,156
-
94,064,059); 500bp for the rest of the common fragile site FRA4F; 5.6kb for the rest of
chromosome 4. The remaining 4,155 probes were distributed across the rest of the genome for
normalization.

For each sample, 500
ng of genomic DNA was incubated
with Fragmentation Buffer
(Agilent)
at 95

C for

4 minutes
.

Fragmented DNA was then PCR amplified and subjected to
column purification. The purified DNA fragments were labeled by incorporation of cyanine
-
dUTP
using Exo
-
Klenow

enzyme and random primers
from the

SureTag labeling kit (Agilent).

The test
sample DNA was labeled with cyanine5
-
dUTP and the reference
sample DNA (Promega
) was
labeled with cyanine3
-
dUTP. After a second column purification, the labeled target was mixed
w
ith Cot
-
1 DNA, blocking agent, and buffer and hybridized to the microarray for 40 hours at
65

C.

Hybridized microarrays were washed, dried and scanned on the SureScan Microarray
Scanner (Agilent).

Feature Extraction Software (Agilent) was used for primary
image processing,
and the results were visualized using

Genomic Workbench Software (Agilent). Clinical

4

chromosome micro
a
rray

for the family CH
-
5400 was perfor
med at Lab
oratory
Corp
oration of
America
.


Microsatellite marker analysis

Genomic DNA from individuals CH
-
5401,
CH
-
5402, and
CH
-
5403 was used as a PCR
template.
Touchdown PCR thermal cycling was carried out under the following conditions: the
reactions were incubated at 94
°C for 15 seconds for the initial denaturation. During t
he first 13
cycles, reactions were incubated at 98°C for 1 minute (denaturation), 68
-
56°C (
-
1°C per cycle)
for 1 minute (annealing), and 72°C for 1 minute (extension). In the subsequent 27 cycles,
reactions were incubated at 92°C for 1 minute (denaturation
), 55°C for 1 minute (annealing),
and 72°C for 1 minute (extension). For the final extension, the reactions were incubated at 72°C
for 10 minutes.


PCR products were each mixed with 13uL of HiDi formamide (
Applied Biosystems
) and
0.2uL of LIZ size standard

(
Applied Biosystems
). The electrophoresis reactions were run on the
Applied Biosystems 3130xl Genetic Analyzer and the data was analyzed using the Applied
Biosystems Gene Mapper version 3.0 software.


Quantitative real
-
time PCR (qPCR)

Primer sequences wer
e d
esigned using Primer3 software
,

e
3

based on
the UCSC
Genome Browser (hg19;
http://genome.ucsc.edu/). Primer sequences are p
resented in
Supplementary Table 1
.

Copy number data were normalized to a control reaction with a primer
pair for the
arbitrarily

chosen autosomal gene
TCL6

on chromosome 14q32.1. Relative
quantification was performed using the ΔΔC
T

method.


Reactions were prepared at a total volume of 20
μL containing 10μL of Fast SYBR
Green Master Mix (Applied Biosystems), 1μL each of forward and reverse primers (5μM), 2μL of
DNA template (8
-
10ng), and 6uL of nuclease free water.


5


Thermal cycling was carried out under the following conditions: the react
ions were
incubated for 20 seconds at 95
°C (polymerase activation) followed by 40 cycles of 3 seconds at
95°C (denaturation) and 30 seconds at 60°C (annealing and extension). Reactions were run in
duplicate or quadruplicate depending upon the experiment.


PCR
-
based determination of deletion breakpoints

PCR amplification across the deletion boundaries was performed using Phusion High
-
Fidelity PCR Master Mix with HF Buffer (New England BioLabs).
Primer sequences were
designed
using Primer3 software
,

e
3

based on
the UCSC Genome Browser (hg19;
http://genome.ucsc.edu/). Primer sequences are p
resented in Suppl
e
mentary Table 1
.

Reactions were prepared at a total volume of 20μL containing 10μL of Phusion PCR
Master Mix, 1μL each of forward and reverse primers (10μM), 2μL of DNA template (100
-
200ng),
1μL of DMSO, and 5μL of nuclease free water. Touchdown PCR thermal cycling was car
ried out
under the following conditions: the reactions were incubated at 98
°C for 30 seconds for the
initial denaturation. In the subsequent 30 cycles, reactions were incubated at 98°C for 10
seconds (denaturation), variable temperature for 30 seconds (ann
ealing), and 72°C for 2
minutes and 30 seconds (extension). During the first 13 cycles, the annealing temperature was
decreased from 68°C to 55°C in increments of 1°C per cycle, and remained at 55˚C for the rest
of the cycles. Finally, the reactions were i
ncubated at 72°C for 10 minutes for the final extension.
All reactions were purified using Agencourt AMPure XP (Beckman Coulter) and sequenced at
the
Boston
Children's Hospital Molecular Genetics Core. Sequencing results were mapped
against the hg19 human
genome reference sequence.


Recording spontaneous eye movements in mice

All animal experiments were performed according to the guidelines
of

the animal welfare
c
ommittees of the participating institutions

and received institutional approval.
Mice were

6

anesthetized with an intraperitoneal injection of ketamine/xylazine (80/20
mg/kg; Sigma
)
,

and a
1

cm flat
-
head screw was attached to the cranial bone with synthetic resin cement (Super
-
Bon
d,
Sun Medical
). Three or more days later, mice were placed on a tab
le with their head fixed by the
screw and the body loosely strained in a plastic cylinder.


Immunohistochemistry

Under deep pentobarbital anesthesia (100 mg/kg of body weight, i.p.), mice were fixed
transcardially

with 4% paraformaldehyde in 0.1 M sodium phosphate buffer (PB), pH 7.2.
Following pretreatm
ent with 1 mg/ml of pepsin (Dako
) in 0.2 N HCl for 10 min at 37°C for
antigen exposure, paraffin sections were incubated successively with 10% normal donkey
serum f
or 30 min, a mixture of primary antibodies overnight (2 μg/mL for each), and a mixture of
Alexa 488
-

and indocarbocyanine (Cy3)
-
labeled species
-
specific secondary antibodies for 2 h at
a dilution of 1:200 (Invitroge
n and Jackson ImmunoResearch).
As primary
antibodies, we used
rabbit anti
-
GluD2

e
4
, guinea pig anti
-
type 1 vesicular glutamate transpor
ter
(VGluT1)
e
5
, guinea
pig ant
i
-
VGluT2
e
5
, and rabbit and guinea

pig anti
-
carbonic anhydrase
-
8 (Car8)
e
6
. TOTO3
(Invitrogen) was used for fluorescent nuclear counterstaining. Images were taken with a
confocal laser
-
scanning microscope (FV1000; Olympus). For quantitative analysis, the

length of
VGluT2
-
positive dendrites was measured using MetaMorph software (Molecular Devices).






7

II.

E
-
Figures



Figure e
-
1. Atrophy of the cerebellar flocculus in the individual CH
-
5401


An axial T1
-
weighted brain MRI of the affected individual CH
-
5401 at age 4 years (Panel A)
shows significant atrophy of the cerebellar flocculus (arrows) compared to a normal control
individual
at
age 4 years (Panel B).


8



Figure
e
-
2
. Quantification of cerebellar vermal and i
nt
ra
cranial

a
rea
s on brain MRI


Cerebellar vermal area of the affected individuals (CH
-
4901 and CH
-
5401) is dramatically
reduced compared to control individuals (Panel A). The difference increases at 4 years of age.
To account for the difference in overall brain size, total intracranial
area was measured (Panel
B), and when the ratio of vermal and intracranial are measured, CH
-
4901 and CH
-
5401 show
approximately 80% and 96% reduction

at 4 years of age
, respectively, compared to controls
(Panel C).


9



Figure
e
-
3
.
SNP genotypes and LOD sco
res of the CH
-
4900 family in the candidate region
on chromosome 4q


SNP genotyping
results on chromosome 4q (Panel A).

A block of homozygosity shared by the
affected individuals
only

(
CH
-
4901, CH
-
4911 and CH
-
4904)

is evident
.
Red and blue
bars
represent

homozygous SNP markers and green

bars

represent

heterozygous SNP markers
.
LOD score graph of the candidate region

(Panel B).
A maxi
mum multipoint LOD score of 3.608

was obtained within the candidate interval.

The vertical lines delineate the region with L
OD > 0.


Chromosome band and g
enes
within the candidate region, shown as the RefSeq track of the
UCS
C Genome Browser (hg19; Panel C
).


10


Figure
e
-
4
.
Microsatellite marker analysis on chromosome 4q in the CH
-
5400 f
amily


The
affected individual CH
-
5401 inherited
distinct microsatellite markers around the
GRID2

gene
from
the
father (CH
-
5403) and

the

mother (CH
-
5402), eliminating the possibility of
uniparental disomy and non
-
paternity.
GRID2

is

located between

the

markers D4S423

and
D4S1557.








11




Figure
e
-
5
. Quantitative
PCR Analysis of
GRID2
exonic deletions in the

CH
-
4900 and CH
-
5400

families


In family CH
-
4900, affected
individuals
(CH
-
4901, CH
-
4904 and CH
-
4911) show
a
copy number
of 0 for
GRID2

exon 4. The parents show
a
copy number of 1, and unaffected siblings show

a
copy number of

either 1 or 2. In family CH
-
5400, the affected
individual

(CH
-
5401) show
s

a
copy number of 0 for
GRID2

exon 2
. Her mother (CH
-
5402) and father (CH
-
5403) show copy
number of 1 and 2,
respectively. (A)=affected; (M)=mother; (F)=father; (U)=unaffected sibling.






12



Figure
e
-
6
. C
hromatograms
of sequencing across
GRID2

deletion breakpoints


CH
-
4901 has a homozygous deletion of 37 kb (
chr4:94,019,84
2
-
94,056,765) involving
GRID2

exon 4. CH
-
5401 has a
de novo

deletion of 335 kb
(
chr4:93,412,943
-
93,748,082) on the
paternally derived chromosome, and a 50 kb dele
tion inherited from
her
mother
(chr4:93,481,110
-
93,531,257
), both involving
GRID2

exon 2.









13

III.

E
-
Tables


GRID2

quantitative PCR

GRID2

Exon 2
-
Forward

GTATTTCGCACTGCGGTTG

GRID2

Exon 2
-
Reverse

CTTCTTGAACTGCTTGGAAAGG

GRID2

Exon 4
-
Forward

GGAATGGATGTTGCACTTCA

GRID2

Exon 4
-
Reverse

GCTCGCCTAAGAGTGTCTCG


GRID2

deletion boundary sequencing

GRID2

Exon 4 deletion
-
Forward

TGCTAGTCATGATTTCAACCAAA

GRID2

Exon 4 deletion
-
Reverse

TTTTATACCCTACTGATCATTGTTCCT

GRID2

Exon 2 large deletion
-
Forward

CCTTTGGAAGGAGACTTTTTGA

GRID2

Exon 2 large deletion
-
Reverse

TTTTATTCGTTGAGCATTTACACTG

GRID2

Exon 2 small deletion
-
Forward

TCCACTCAAGTGACAGGTTTGT

GRID2

Exon 2 small deletion
-
Reverse

CCTAATGCATTGTCCCCATC


Table
e
-
1. Primer
sequences


Primer sequences used for quantitative PCR (
Supplementary Figure 4) and Sanger sequencing
across the deletion breakpoints (Supplementary Figure 5) are shown.
















14


Block

Size
(cM)

Size
(Mb)

Number of
markers

Chromosome

Start
(cM)

Start
(Mb)

End
(cM)

End
(Mb)

1

7.07

8.36

738

4

96.12

89.51

103.19

97.88

2

3.05

6.04

2

9

60.59

38.76

63.64

44.81

3

2.33

0.91

148

16

50.77

26.05

53.10

26.97

4

1.51

1.06

135

5

72.88

56.75

74.39

57.81

5

1.23

0.21

17

10

76.54

60.78

77.77

60.99

6

1.16

0.18

28

12

49.50

27.42

50.66

27.60


Table
e
-
2.

Largest blocks of homozygosity shared by
all affected
individuals
in the
CH
-
4900

family


Blocks of homozygosity
larger than 1 cM and
shared by

all affected
individuals
in the

CH
-
4900

family

are shown.




















15

E
-
References


e
1.

Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image
analysis. Nat Methods 2012;9:671
-
675.


e
2.

Schmitt JE, Eliez S, Warsofsky IS, Bellugi U, Reiss AL. Enlarged cerebellar vermis in
Williams syndrome. J Psychiatr Res 2001;35:225
-
2
29.


e
3.

Rozen S, Skaletsky HJ. Primer3 on the WWW for general users and for biologist
programmers. . In: Krawetz S, Misener S, eds. Bioinformatics Methods and Protocols:
Methods in Molecular Biology. Totowa, New Jersey: Humana Press, 2000: 365
-
386.


e
4.

T
akeuchi T, Miyazaki T, Watanabe M, Mori H, Sakimura K, Mishina M. Control of synaptic
connection by glutamate receptor delta2 in the adult cerebellum. J Neurosci
2005;25:2146
-
2156.


e
5.

Miyazaki T, Fukaya M, Shimizu H, Watanabe M. Subtype switching of
vesicular glutamate
transporters at parallel fibre
-
Purkinje cell synapses in developing mouse cerebellum. Eur J
Neurosci 2003;17:2563
-
2572.


e
6.

Patrizi A, Scelfo B, Viltono L, et al. Synapse formation and clustering of neuroligin
-
2 in the
absence of GABAA

receptors. Proc Natl Acad Sci U S A 2008;105:13151
-
13156.