Présentation au format PDF

peaceevenBiotechnology

Oct 4, 2013 (3 years and 8 months ago)

109 views

Formation
INSERM
Formation
INSERM
Jeudi
12
F
Jeudi
12
F
é
é
vrier
2004
vrier
2004
marie-claude.potier@espci.fr
marie-claude.potier@espci.fr
Plan
de
l
Plan
de
l


expos
expos
é
é

1
ère
partie: Puces dé
dié
es

2
ème
partie: Analyse du transcriptome
applications en neurobiologie

3
ème
partie: Modifications du
transcriptome dans la Trisomie 21
PUCES
DEDIEES
PUCES
DEDIEES
PUCES
DE
LUXE?
PUCES
DE
LUXE?
ANALYSE
D
ANALYSE
D


IMAGE:
MOINS
DE
SPOTS
IMAGE:
MOINS
DE
SPOTS
PLUS
D
PLUS
D


INFORMATIONS
INFORMATIONS
Puce HGMP humaine
19 000 oligos
Puce Neurotrans
280
gènes
www.genescore.net
PUCES
PANGENOMIQUES
PUCES
PANGENOMIQUES
INCOMPLETES
INCOMPLETES
Comparaison
Neurotrans/Affymetrix
MG
U74v2
- 20% des gènes présents sur la Neurotrans sont absents
sur
Affymetrix
-
53 gènes importants ne sont pas présents sur la puce
Affymetrix
S
S
é
é
lection
des
sondes
lection
des
sondes
-
Logiciels: SOL
Oligoarray
(Rouillard
et al.
NAR 2003)
ROSO
(Reymond
et al.

Bioinformatics 2004)
- Bases de donné
es
Harvard-Lipper Center
http://arep.med.harvard.edu/probes.htm
Mediante
http://medcal.ipmc.cnrs.fr:8080/mediante/index
geoffroy.golfier@espci.fr
7
http://www.bionet.espci.fr
Selection
of
Selection
of
OLigos
OLigos

(SOL)

(SOL)
Melting-Blast-Mfold
Melting-Blast-Mfold
-Data
bases
to
look
for
specificity
Refseq,
Ensembl
-Adjust
to
experimental
conditions
(temp,
%
formamide,
salt
concentration)
-i/o
from
different
softwares
geoffroy.golfier@espci.fr
8
http://www.bionet.espci.fr
SOL
SOL
>GLUR4
tgcggatttgagatt
attaaaagggggc
>VIP
atggggccgatatat
gtaccttagggttaat
db
db


mARN
mARN
>RAT
>SOURIS
>HUMAIN
...
Refseq
Refseq
Specific
Specific


Oligonucleotides
Oligonucleotides
Melted-Blast
Melted-Blast
DB OLIGOS
DB OLIGOS
Melting
Melting
Mfold
Mfold
T
T
hybridization
hybridization
%
%
formamide
formamide
Salts
Salts
Thybridization
Thybridization
Salts
Salts
geoffroy.golfier@espci.fr
9
http://www.bionet.espci.fr
Melted-Blast
Melted-Blast
QUERY 1
QUERY 1
tgacccccgactgccccaaggccgtacacacaggaactgcgattagacagagctcgggat
tgacccccgactgccccaaggccgtacacacaggaactgcgattagacagagctcgggat
60
60
5458 2834 ............................................................ 2893
5458 2834 ............................................................ 2893
1662 2929 ..........g..... 2914
1662 2929 ..........g..... 2914
7361
234
..............
221
7361
234
..............
221
7186
91
..............
104
7186
91
..............
104
5385 1591 .............. 1604
5385 1591 .............. 1604
5385 3604 ............ 3593
5385 3604 ............ 3593
3201
259
..............
272
3201
259
..............
272
2757 1214 .............. 1201
2757 1214 .............. 1201
549 7727 .............. 7714
549 7727 .............. 7714
7065 1218 ............. 1230
7065 1218 ............. 1230
6401
635
.............
647
6401
635
.............
647
QUERY 1
QUERY 1
tgacccccgactgccccaaggccgtacacacaggaactgcgattagacagagctcgggat
tgacccccgactgccccaaggccgtacacacaggaactgcgattagacagagctcgggat
60
60
5458 2834 ............................................................ 2893
5458 2834 ............................................................ 2893
1662 2929 ..........g..... 2914
1662 2929 ..........g..... 2914
7361
234
..............
221
7361
234
..............
221
7186
91
..............
104
7186
91
..............
104
5385 1591 .............. 1604
5385 1591 .............. 1604
5385 3604 ............ 3593
5385 3604 ............ 3593
3201
259
..............
272
3201
259
..............
272
2757 1214 .............. 1201
2757 1214 .............. 1201
549 7727 .............. 7714
549 7727 .............. 7714
7065 1218 ............. 1230
7065 1218 ............. 1230
6401
635
.............
647
6401
635
.............
647
agacagagctcgggat
agacagagctcgggat




Tm
Tm

>

>
Thybridisation
Thybridisation
oligo
non
specific




Tm
Tm

<

<
Thybridisation
Thybridisation
oligo
is
specific
a
a
t
t
c
c
c
c
c
c
c
c
a
a
g
g
c
c
t
t
c
c
t
t
g
g
a
a
c
c
t
t
Melting
Melting
T
T
hybridisation
hybridisation
, %
, %
formamide
formamide
,
,
Salts
Salts
SOL
SOL
output
output
sol parameters: -d Neurotrans/mouse+ -c cds.txt -p 2 -o 20 -s 50 -n gnsouris.tfa -T 42 -f 50 -r 10_janvier02.res
>Gene ID: 296618
sequence
TM
GC%
deltaG (kcal/mol)
from 5'
from 3'
Dbl_mm
gatgaaacggacgacacccagatgtagtaactttgtcttgtcagaagttg
57,1
44
1,1
1176
50
n
acggacgacacccagatgtagatgaaacggacgacacccagatgtagtaa
59,8
50
1,1
1156
70
n
agggccaggatgaagagaggctatgacaaccctaactttgtcttgtcaga
60,1
48
0,7
1096
130
y
gcgagaccatcattttggatcagaccaacatcaactttgtcgtcgacgct
60,6
48
0,6
716
510
n
tgcttatcttccagtctattcttggagtgatcatcaattccttcatgtgt
55,9
38
0,9
476
750
n
Rat/Souris
Rat/Souris
Homology
Homology
sol parameters: -d Neurotrans/mouse+ -c cds.txt -p 2 -o 20 -s 50 -n gnsouris.tfa -T 42 -f 50 -r 10_janvier02.res
>Gene ID: 296618
sequence
TM
GC%
deltaG (kcal/mol)
from 5'
from 3'
Dbl_mm
gatgaaacggacgacacccagatgtagtaactttgtcttgtcagaagttg
57.07
44.00
1.10
1176
50
n
>gi|8393648|ref|NM_017023.1| Rattus norvegicus Potassium
Identities = 27/27 (100%)
acggacgacacccagatgtagatgaaacggacgacacccagatgtagtaa
59.83
50.00
1.10
1156
70
n
>gi|8393648|ref|NM_017023.1| Rattus norvegicus Potassium
Identities = 27/27 (100%)
agggccaggatgaagagaggctatgacaaccctaactttgtcttgtcaga
60.09
48.00
0.70
1096
130
y
>gi|8393648|ref|NM_017023.1| Rattus norvegicus Potassium
Identities = 50/50 (100%)
gcgagaccatcattttggatcagaccaacatcaactttgtcgtcgacgct
60.56
48.00
0.60
716
510
n
>gi|8393648|ref|NM_017023.1| Rattus norvegicus Potassium
Identities = 50/50 (100%)
tgcttatcttccagtctattcttggagtgatcatcaattccttcatgtgt
55.86
38.00
0.90
476
750
n
>gi|8393648|ref|NM_017023.1| Rattus norvegicus Potassium
Identities = 50/50 (100%)
D
D
é
é
p
p
ô
ô
t des
t des
oligos
oligos
sur support
sur support
Activation
Espaceur
Oligos
Cas
d’un
support
spécifique
www.genescore.free.fr
10 µg
5 µg
2 µg
1 µg
Sensibilité

(quantité

d’ARN
total)
Neurotrans
Neurotrans


Oligoarray
Oligoarray
280
genes
280
genes
282 genes - 575 oligonucleotides 50mers
2
oligonucletides
per
gene
(265
genes)
1
oligonucleotide
per
gene
(3
genes)
3
oligonucleotides
per
gene
(14
contrôle
genes)
GC-%
between 34 et 68%.

26
oligos
with
a
GC-%>55%,
44
oligos
with
a
GC-%<45%
Tm
between 54 and 69°C
46%
oligos
(264/575)
will
recognise
rat
ortologous
sequence
With
0
or
1
mismatch
74
%
(210/282)
genes
will
have
at
least
one
oligo
with
0
to
1
mismatch
with
its
ortologue


288
288
mouse
mouse


genes
genes


involved
involved

in

in
neurotransmission
neurotransmission


glutamate, GABA-A, ac
glutamate, GABA-A, ac
é
é
tylcholine, dopamine,
tylcholine, dopamine,
serotonin
serotonin
,
,
somatostatin
somatostatin
, CCK,NGF, VIP,
, CCK,NGF, VIP,
adrenergic
adrenergic
,
,
opioid
opioid
,
,
cannabinoid
cannabinoid


Potassium, sodium
Potassium, sodium
and
and

calcium

calcium
channels
channels


Neurotransmitter
Neurotransmitter


synthesizing
synthesizing
enzymes
enzymes


Neuropeptides
Neuropeptides


Calcium
Calcium
binding
binding


proteins
proteins


Protein
Protein
kinases
kinases


Proteins
Proteins


involved
involved

in

in
exocytosis
exocytosis
www.genescore.net
www.genescore.net
Neurotrans280M
Neurotrans280M
Differential
Differential

expression

expression
with
with


Calbindin
Calbindin

KO

KO
2
2
µ
µ
g
g
mRNA
mRNA


mouse
mouse


cerebellum
cerebellum
WT
WT
KO
KO

300 genes coding for mouse transcription
factors


Leucine
zipper
Leucine
zipper
factos
factos


«
«


helix-loop-helix
helix-loop-helix
/ leucine zipper
/ leucine zipper




»
»




zinc
zinc
finger
finger






homeo
homeo


domain
domain




«
«
paired
paired

box

box

»

»


MADS box
MADS box


TAT-binding
TAT-binding


proteins
proteins




HMG
HMG


www.genescore.net
www.genescore.net
TransTem
TransTem

300M

300M
D
D
é
é
tection
de
tection
de
SNP
SNP


s
s
,
trisomie
21
,
trisomie
21
5
5


5
5


G
G
T
T
T
T
C
C
G
G
A
A
A
A
A
A
C
C
G
G
T
T
C
C
G
G
A
A
A
A
A
A
C
C
G
G
3
3


3
3


RT
RT
3
3


5
5


3
3


G
G
T
T
T
T
C
C
G
G
A
A
A
A
A
A
C
C
G
G
T
T
C
C
G
G
A
A
A
A
A
A
C
C
G
G
U
U
G
G
T
T
C
C
C
C
G
G
A
A
T
T
A
A
T
T
G
G
A
A
T
T
T
T
C
C
A
A
A
A
U
U
A
A
G
G
G
G
T
T
C
C
C
C
G
G
A
A
T
T
A
A
T
T
G
G
A
A
T
T
T
T
C
C
A
A
5
5


C
C
T
T
A
A
U
U
C
C
G
G
SNP

1a-1b
2a-2b

3a-3b

4a-4b

5a-5b

6a-6b

7a-7b

J.
Buard,
Montpellier
Marquage
:
15
µg
ARN
total
Cy3

:
Thymocytes
Cy5

:
Cerveau
www.genescore.net
Luc.talini@espci.fr
Expression diff
Expression diff
é
é
rentielle
rentielle
cerveau-thymus
cerveau-thymus
Expression des r
Expression des r
é
é
cepteurs glutamate
cepteurs glutamate
dans les thymocytes
dans les thymocytes:
correlation
correlation
Puces
Puces
Neurotrans
Neurotrans
et PCR
et PCR


DNA Chip
PCR
Glast-1
0-200
GluR1
GluR1
200-1000
GluR2
GluR2
1000-5000
GluR3
GluR3
>5000
GluR4
GluR4
GluR5
GluR5
GluR6
GluR6
GluR7
GluR

GluR

KA1
KA2
KA2
mGluR1
mGluR1
mGluR2
mGluR3
mGluR3
mGluR4
mGluR5
mGluR5
mGluR6
mGluR7
mGluR7
mGluR8
mGluR8
NR1
NR1
NR2A
NR2A
NR2B
NR2B
NR2C
NR2C
NR2D
NR2D
0
50
100
150
200
250
300
0,0
0,2
0,4
0,6
0,8
1,0
1,2
1,4
1,6
P1, 20

M
P2, 20

M
Hybridizaiton signal
Time, min
Interference
filters
Thermo
Table
Optics
CCD
camera
635 nm Laser
H
g
Mercury Lamp
Elena
B.
Khomyakova
et
al.
In
press
Cell.
Mol.
Biol
.
IMSTAR
Hybridation
en
solution/
Hybridation
en
solution/
Hybridation
sur
puce
Hybridation
sur
puce
Cinétique sens/antisens
2.5xSSC
0.2%SDS
18°C
30
40
50
60
70
80
90
100
0,0
0,2
0,4
0,6
0,8
1,0
P2, 20

M
P1, 20

M
Normalized hybridization signal
Temperature,

C
Mesure de Tm
5xSSC
0.2%SDS
Analyse du
Analyse du
transcriptome
transcriptome
:
:
applications en Neurobiologie
applications en Neurobiologie
Les
puces
à
ADN
source
de
connaissances
en
Neurobiologie
PubMed:
microarray
=
4818

microarray
+
brain
=
302
Trè
s
bonne
revue:
Henry
et
al.

Curr
Opin
Neurobiol
2003
Développement
du
cerveau
:
3
niveaux
d’
intégration:
1.
Au
niveau
cellulaire:
Quels
sont
les
programmes
g
én
étiques
responsables
de
la
spécification
et
de
la
différentiation
cellulaire?
Cellules
souches,
neurosphères,
cellule
unique,
cibles
des facteurs de transcription dans des tris de cellules (mec-3 chez
C. Elegans)
2.
Au
niveau
du
circuit:
Quels
sont
les
profils
d’expression
impliqués
dans
la
migration
des
neurones,
la
formation
des
synapses
et
leurs
connections?
Développement
postnatal
du
cervelet
3.
Au
niveau
du
système:
Cartographier
les
profils
d’expression
spatio-temporels
des

nes.
Brain
Molecular
Anatomy Project
Les
puces
à
ADN
source
de
connaissances
en
Neurobiologie
Comportement
:
Apprentissage
et

moire
:

couverte
de
gènes
fonctionnels
dans
un
tissu
complexe

l’effet
est
de
faible
amplitude
(FGF18
induction
in
rat
hippocampus)
Rythmes
circadiens
:
identification
de
régions
promotrices
pré
sentes
dans
les

nes
modulés.
Ces
régions
lient
les
facteurs
de
transcription
Rev-ErbA/ROR.
Dysfonctionnement
du
cerveau:
X
Fragile:

CGG
motifs
qui
é
teigent
l’expression
du
gène
FMR
(protéine
d’un
complexe
ribonuclé
ique
associé
aux
ribosomes).
Immunoprécipitation
des
ARN
liés
à
la
protéine
FMR:
découverte
de
MAP1B.
Huntington:

CAG
repeat
en
5’
de
l’huntingtin:
polyglutamines
en
N-term
clivée
par
des
capsases.
Accumulation
dans
les
neurones.
Induction
de
g
è
nes
impliqués
dans
la
biosynthè
se
des
acides
gras
et
du
cholesterol
Sclérose
en
plaque:

88

nes
altér
é
s
(sur-expression
de

nes
de
l’
immunité

et
sousexpression
de

nes
impliqués
dans
la
formation
de
la
myéline).
G-CSF
(granulocyte
colony
stimulating
factor)
augmenté
13x
entre
lésion
aïgue
et
chronique
silencieuse
peut
bloquer
les
phases
primaires
chez
la
Souris.
Les
puces
à
ADN
source
de
connaissances
en
Neurobiologie
Diaz
et al.
Neuron 36
:417-434
(2002)
Molecular analysis of gene
expression
in
the
developing
pontocerebellar
projection system.
Postnatal development
of the
cerebellum
Furuichi
et al.
, RIKEN Brain Science Institute
Cb=cerebellum CGC=cerebellar granule cells
GC matures
GC precurseurs
Puces
cDNA
19K
RIKEN
PGC=purified cerebellar granule cells
Cluster
B
:
DIFFERENTIATION
33

nes
et
18
est;
8

nes
glie
(S100),
12

nes
d’
autres
types
cellulaires:
Purkinje
(
parvalbumin),
Cellules
granulaires
matures
(GABA-a6,
SCG10
dans
IGC,
EST
similaire
à
PAx6
dans
la
couche
des
cellules
de
Purkinje)
Cluster
L
:
SPECIFICATION
12

nes
sous
exprimés
durant
la
première
semaine
de

veloppement
(facteurs
de
transcription
math1,
Mash1)

nes
impliqués
dans
le
programme
de
transcription
des
pré
curseurs
de
cellules
granulaires

t
au
cours
du
développement.
Cluster
I
:
PROLIFERATION
125
gènes
augmentent
aprè
s
P0
puis
diminuent
à
P5.

nes
de
prolifération
cellulaire
exprimé
s
dans
la
couche
externe
(CD24a)
Cluster B,
DIFF
IGC augmente
Cluster B,
DIFF

Purkinje augmente
Cluster I,
PROLIF
EGC
diminue
Weaver
canal K
Pas de cellules G dans IGL
Mort dans EGL
L1
molécule
d’adhésion
exprimée
dans
les
CG
en
migration
Gènes
de
prolifération
et
de
migration
affectés
SPE
PRO
DIF
MIGRATION
PROLI
DIFF
Modifications
Modifications
du
du
transcriptome
transcriptome
dans
dans

la

la
Trisomie
Trisomie
21.
21.
1846
Seguin
1866
John Down
«
Obsevations
of
the
ethnic
classification
of
idiots

London
Hospital
Reports
1959
J
é
rôme
Lejeune,
Trousseau
«
Etude
des
chromosomes
somatiques
de
neuf
enfants
mongoliens.
»
CRAS
2000


quence
complè
te du Chromosome 21
Trisomy
21
364 gè
nes et prédictions
-
22
facteurs
de
transcription/DNA
binding
proteins
-
16

nes
mitochondriaux
é
nergie/mé
tabolisme
oxydatif/
-
6

nes
métabolisme
des
folates
et
m
é
thylation
de
l’ADN/

contrôle
de
l’
expression
des
gènes
-
9

nes
de

veloppement
du
cerveau/Alzheimer
-
111
spécifiques
humains,
38
spé
cifiques souris

(Gardiner, 2003)
Signes cliniques
-

fauts
craniofaciaux
-
Neurohistopathologie
de
maladie
d’Alzheimer
-
Malformations
cardiaques
-
Retard
mental
La
Trisomie
21
serait
une
maladie
du
d
é
veloppement
-
Tous
les
signes
cliniques
ne
sont
pas
pré
sents
chez
tous

les
patients
-
Les
signes
cliniques
sont
d’intensité
variable
Sequence
du
Chromosome
21
Hypothèses
-
Instabilité
de
développement
-
Effets
de
dosage

nique
Questions
-

Transcriptome
dans
des
modè
les

animaux
et
cellulaires?
-

Peut-on
trouver
des
signatures
transcriptionelles

de
phénotypes
particuliers?
Transcriptome
et
Trisomie
21
Chrast
et
al.
2000:
SAGE
cerveaux
de
Ts65Dn
330 tags sur 45000 montrent une diffé
rence T21/2N dont 14 gènes codant
pour
des protéines ribosomiques. 15 des 124 gè
nes en 3N sont détecté
s,
3 sont sur-exprimés.
Bahn
et
al.
2002:
neurospheres
Differential display REST (neuron silencer
factor) et ses cibles SCG10,
L1, synapsine, tubuline-

4)
Mao
et
al.
2003:
cortex
fœtus
17-21
weeks
Sur 18462 gè
nes , 3.7% sur-exprimés, 3.9% sous-exprimés; 9 gè
nes
du 21 ratio 1.28-1.77
Saran
et
al.
2003:
cervelet
3-4
mois
Ts65Dn
12488 gènes, 6902 exprimés, gè
nes du 16 en 3N (1.45) en 2N (1.01)
Regroupement des T21 jusqu’à une ré
duction de 42-53% des gènes:
perturbation stochastique
22% gènes avec un ratio >1.2 ou <0.8
227 gènes p<0.01 et 922 avec p<0.05
Fitzpatrick
et
al.
2002:
amniocytes
de
T21,
T13
and
T18
Sur 8020 gènes 87% sont détecté
s, 2.3% sur-exprimés, 8.7% sous-
exprimés; 7 communs à
T21 et T13; variabilités interindividuelles
(seulement 3T21, 2T13, 1T18 et 4 contrô
les)
Modè
les
animaux
Souris
Monogénique
Tg
Dyrk1A
Plurigéniques
T16:
Ts1Cje
Souris
YAC
Modè
les
cellulaires
Homme
Ligné
es
Lymphoblastes
2N/3N
Souris
Neurones
I,
Neurosphères
MODELES
D’ETUDE
De
la
Trisomie
21
OUTILS
Puces
utilisées
Souris
Neurotrans
(280

nes)
Neurodev
(2100)
Puces
NIA
(15
000)
Affymetrix
(12
000)
Oligos
longs
(21
587)
Homme
Chromosome
21
(303)
Pan

nomique
(19
000)
Modè
les
d’étude
de
la
Trisomie
21
Modè
les animaux de Trisomie 21
Chr.
21
Human
22.3
21.2
p
q
Chr.
16
Mus musculus
App
Grik1
Sod1
Tiam1
Cbfa2
Gart
Son
Gas4
Ifngr2
Kcne1
Cbr1
Cbr3
C21orf5
Kiaa0136
Chaf1b
Cldn14
Sim2
Hlcs
Dcrc
TtC3
Dcra
Dyrk1a
Kcnj6
Kcnj15
Erg
Ets2
Dscr2
Wdr9
Hmg14
Wrb
Sh3brg
B3galt5
Pcp4
Dscam
Bace2
C21orf11
Mx2
Mx1
Ts65Dn
Ts1Cje
CJ Epstein
Ms1CjeTs65Dn
MMU16
Le mod
è
le
Ts1Cje
:
Trisomie
16
partielle

Croisement
Normale
Normale
Souris
trisomique
16 partielle
Ts1Cje
Disomie partielle
Gamè
tes possibles

iose
Normal
Balancé
Nullisomi
e
partielle
MMU16 (Sod1 à Mx1)
translocation
16
12
16
16
12
12
12
12
12
12
16
12
16
12
12
16
16
12
12
16
16
16
16
16
12
16
16
12
16
12
16
16
12
16
Souris
trisomique
16
partielle
Ts1Cje
SOD1
Superoxyde
Cu/Zn
dismutase
1
GART
Glycinamide
ribonucleotide
formyltransferase
SIM2
Simple
minded,
Facteur
de
transcription
DYRK1a
Ser/
Thr
Kinase
ETS2
Facteur
de
transcription
MX1
Interferon-induced
p78
protein
Sod1-

néo+
Gart
Sim2
Dryk1a
Ets2
Mx1
MMU16 loci
DCR1
Le mod
è
le
Ts1Cje
:
Trisomie
16
partielle

Phé
notype
:

Deficits
dans
les
taches
d’apprentissage
et
de
mémoire
Dysmorphie
cranio-faciale
Développement
anormal
du
cerveau
(
cerebellum)
Projet

:
Expression
diffé
rentielle
dans
le
cervelet
au
cours
du

veloppement
postnatal.
Objectifs

:


Expression
des

nes
du
chromosome
16


Profils
d’
expression


Signatures
transcriptionnelles
Un modèle animal de Trisomie partielle:
les souris Ts1Cje
Méthodes
Affymetrix
mouse
chips
(6
000
gènes
and
6
000
EST)
2
expériences/4
analyses
par
temps
Maté
riel
Pools
d’ARN
de
cervelet
de
3
Ts1Cje
et
de
3
souris
contrô
le
de
même portée à P0, P15, P30
(collaboration K. Toyama, P.-M. Sinet)
Protocole expé
rimental
Ts1
Ts1
C1
C1
Ts2
Ts2
C2
C2
1
1
3
3
2
2
4
4
Analyse VARAN
Expériences
contrô
le
Expériences
diffé
rentielles
(www.bionet.espci.fr
Golfier
et
al.
sous
presse
Bioinformatics
)
G
G
è
è
nes
impliqu
nes
impliqu
é
é
s
dans
le
d
s
dans
le
d
é
é
veloppement
postnatal
du
cervelet
veloppement
postnatal
du
cervelet
1
1
Diaz, E. (2002)
Diaz, E. (2002)
Neuron
Neuron
Expression des g
Expression des g
è
è
nes au cours du
nes au cours du
d
d
é
é
veloppement postnatal normal du cervelet
veloppement postnatal normal du cervelet


Prolif
Prolif
é
é
ration
cellulaire
anormale
ration
cellulaire
anormale


Surtout
Surtout
à
à

P0

P0
Diminution
d
Diminution
d


expression
apr
expression
apr
è
è
s
P12
s
P12


Prolif
Prolif
é
é
ration cellulaire (76 g
ration cellulaire (76 g
è
è
nes)
nes)


Sur-expression
Sur-expression

des
g

des
g
è
è
nes
en
3
copies
(1.5
nes
en
3
copies
(1.5
à
à

3).

3).
Pas
de
Pas
de
sous-expression
sous-expression


D
D
é
é
r
r
é
é
gulation
gulation

des
g

des
g
è
è
nes
impliqu
nes
impliqu
é
é
s
dans
la
prolif
s
dans
la
prolif
é
é
ration
ration
cellulaire,
la
migration
et
la
diff
cellulaire,
la
migration
et
la
diff
é
é
rentiation
rentiation


Similarit
Similarit
é
é
s
s

avec
les
r

avec
les
r
é
é
gulations
observ
gulations
observ
é
é
es
chez
les
es
chez
les
souris
souris
weaver
weaver
.
.
Conclusions
Modè
le cellulaire:
les ligné
es lymphoblastiques
ARNm
de
cellules
de
lignées
lymphoblastiques
de
patients
trisomiques
et
d’individus
normaux

4
ligné
es
de
patients
trisomiques(T21)

10
contrô
les
(2N)
Maté
riel
Méthodes
Expériences
contrô
le:
Pools
2N
vs
2N
Expériences
diffé
rentielles:
Pools
T21
vs
2N
Oligopuces HSA21
(collaboration J. Delabar)
2µgARNm,

T21
T21

vs
2N
2N
609
oligonucleotides
de
50
bases:


309
gènes
et
prédictions


19
contrô
lesd’autres

chromosomes
pour
normaliser


30%
des
gènes
du
21
sont

exprimé
s
Protocole expé
rimental
www.genescore.net
Luc.talini@espci.fr
spotting
Analyse
statistique
avec
Varan
(www.bionet.espci.fr Golfier
et al.
sous presse) E. Graison
Expé
riences contrô
les 2N/2N
1O
pools
contrô
les
randomisés
5
expériences
1.68
0.56
Expé
riences diffé
rentielles 3N/2N
1
pool
de
2N
(4
ind)
1
pool
de
3N
(4
ind)
5
expériences
Puces HGMP oligoarray
Tom
Freeman
Hinxton,
19-k
Compugen/Sigma
Genosis
1.
2N/2N
on
test
slides
2.
VARAN
3.
3x
3N(pool
of
4)/

2N(pool
of
10)
Multigenic
&
pleiotropic
regulation
the
basis
of
genetic
networks
300
g
ènes
Multigenic
&
pleiotropic
regulation
the
basis
of
genetic
networks
Fond géné
tique
Polymorphismes
Environnement, plasticité
Interactions
cellulaires
Modifications transcriptionnelles
Modifications transcriptionnelles
dans la Trisomie 21
dans la Trisomie 21
Sécrétases



APP
770
ADAMs
ADAMTS1
ADAMTS5
BACE
BACE2
A

Trisomie 21
Maladie d’Alzheimer
Métabolisme de
l
’homocysté
ine
Neurobiologie
UMR7637
CNRS/ESPCI
Prof. Jean Rossier
G.
Golfier
L. Dauphinot
R. Moldrich
M. Tran
Dang
E.
Graison
MC. Durand
GeneScore……….
Paris
7
J.Delabar
N.
Cré
au
R. Orti
Broca
P.-M. Sinet
K.
Toyama
Plate-forme
RIO
C. Jacq
P. Charnay
P.Topilko
F. Devaux
P. Marc
C. Blugeon
V. Tanty
D.
Gentien
Euros
CEE
Fondation Jé
rôme
Lejeune
CNRS
Ministè
re de la Recherche