B. alpinus - Université de Neuchâtel

peaceevenBiotechnology

Oct 4, 2013 (3 years and 9 months ago)

215 views

Organisation de la diversité spécifique
et génétique au

sein de deux ordres
d'insectes aquatiques en Suisse
o
ccidentale


Alexis Reding

Mémoire de
Master 201
1

Université de Neuchâtel, Institut de Biologie


Supervision par: Dr. N. Alvarez, Dr. M.
Bouzelboudjen & Dr. J.
-
P. G. Reding



1


T
ABLE DES MATIÈRES

I
NTRODUCTION

................................
................................
................

3

Préambule

................................
................................
................................
....

3

L’approche phylogénétique en écologie des communautés

.........................

4

La phylogénétique en biogéographie

................................
...........................

8

V
OLET ÉCOLOGIQUE

................................
................................
........

10

Cas d’étude

: communautés E+P des stations jurassiennes

........................

10

Méthode

................................
................................
................................
....

12

Collecte

................................
................................
................................
..........................

12

Données communautaires

................................
................................
............................

12

Séquençage

................................
................................
................................
...................

14

Alignements

................................
................................
................................
...................

15

Analyses phylogénétiques

................................
................................
.............................

15

Résultat

................................
................................
................................
......

16

Phy
logénie des Plécoptères

................................
................................
..........................

16

Structure phylogénétique des communautés de Plécoptères

................................
......

17

Phylogénie des Ephéméroptères

................................
................................
..................

19

Structure phylogénétique des communautés d’Ephéméroptères

...............................

21

Discussion

................................
................................
................................
..

24

Phylogénie du pool régional

................................
................................
..........................

24

Diversité phylogénétique

................................
................................
..............................

24

Structure phylogénétique

................................
................................
.............................

25

V
OLET BIOGÉOGRAPHIQUE

................................
...............................

27

Cas d’étude

: endémiques jurassiennes

................................
......................

27

Méthode

................................
................................
................................
....

30

Collecte

................................
................................
................................
..........................

31

Séquençage

................................
................................
................................
...................

32

Alignements

................................
................................
................................
...................

33

Analyses phylogénétiques

................................
................................
.............................

33

Résultat

................................
................................
................................
......

34

2


Matrices de données moléculaires

................................
................................
...............

34

Analyse de parcimonie

: taxons endémiques jurassiens et relatifs alpins

....................

35

Analyse de parcimonie

:

taxons
indifférenciés
distribués dans les Alpes et le Jura

.....

36

Analyse bayésienne

: B. nubecularis et B. alpinus (Ephemeroptera)

...........................

37

Analyse bayésienne

: P. jurassicus et P. intricatus (Plecoptera)

................................
.

38

Analyse bayésienne

: Chloro
perla susemicheli (Plecoptera)

................................
........

39

Analyse bayésienne

: Leuctra braueri (Plecoptera)

................................
......................

40

Discussion

................................
................................
................................
..

41

Endémiques jurassiennes

: B. nubecularis et B. alpinus

................................
...............

41

Endémiques jurassiennes

: P. jurassicus

et P. intricatus

................................
...............

43

Taxons
indifférenciés
distribués dans les Alpes et le Jura

................................
............

45

Vecteur de dispersion

................................
................................
................................
...

45

C
ONCLUSION

................................
................................
................

46

Volet biogéogra
phique

................................
................................
...............

46

Volet écologique
................................
................................
.........................

47

R
EMERCIEMENTS

................................
................................
...........

48

B
IBLIOGRAPHIE

................................
................................
..............

49

A
NNEXE

................................
................................
.......................

53

Présentation de quelques taxons

................................
................................

53

Ephéméroptères

................................
................................
................................
............

53

Plécoptères

................................
................................
................................
....................

54

Perlodes jurassicus (Aubert, 1946)
................................
................................
................

56

Détail de la collecte

................................
................................
....................

58

Paramétrages des analyses

................................
................................
........

60

Paramétrage des analyses pour le volet écologique

................................
....................

60

Paramétrage des analyses pour le volet biogéographique

................................
...........

64

3


Introduction

Préambule

Ce travail s’inscrit dans le cadre d’un Master en biologie à l’université de
Neuchâtel sous la direction des professeurs M. Bouzelboudjen et N. Alvarez,
avec la participation de J.
-
P. G. Reding en tant que co
-
encadrant. Il concerne
l’étude de deux ordres d
’insectes

aquatiques: les
E
phéméroptères et les
P
lécoptères (
abrégés après par
E+P). Il se base sur les travaux menés depuis
une vingtaine d’années par J.
-
P. G. Reding dans le Jura
franco
-
helvétique
.

Il se décompose essentiellement en deux volets

: un vol
et biogéographique et
un volet écologique, tous deux ayant une composante phylogénétique
commune. Les questions abordées concernent d’une part l’application du
concept d’espèce aux endémiques ou autres taxons remarquables jurassiens,
ainsi que leur histoi
re évolutive au travers des oscillations climatiques du
Pléistocène, et d’autre part la compréhension de la formation des
communautés vi
a une approche phylogénétique.

D’un point de vue personnel, ce travail
m’
a

permis

d’une part de reprendre les
travaux d
e mon père, et de les compléter grâce à des moyens inaccessibles à
un biologiste «

autodidacte

», et d’autre part d’appliquer les connaissances
acquises durant ces dernières années, et ainsi de concrétiser ma formation
universitaire.

Comme toute recherche
qui se respecte, elle apporte plus de
questions que de réponses, et appelle à d’
autres études.



4


L’approche

phylogénétique
en

écologie

des communautés

«

Une communauté est un ensemble de populations coexistant dans le temps et
l’espace, et interagissant
directement ou indirectement

» (EMERSON B.C. &
GILLESPIE R.G. 2008).
Pratiquement, les limites des communautés sont fixées
par le chercheur

; par exemple
,

dans mon projet
,

je m’intéresse aux
communautés de
deux

ordres d’insectes aquatiques
peuplant
différe
nts

cours
d’eau du
Jura.

La structure d’u
ne communauté se caractérise par sa richesse
spécifique
et

l’abo
ndance relative de ses esp
èces
, ainsi que par
les nombreuses
interactions entre populations

:

prédation, compétition,

facilitation ou
coévolution par exemple

(CAMPBELL N.A. & REECE J. B. 2002)
.


Les questions centrales en écologie des communautés concernent les
processus qui génèrent les différentes communautés et conditionnent leur
structure
,

dans le but ultime d’établi
r des principes généraux permettant de
prédire
l’
assemblage
des espèces
(WEIHER E. & KEDDY P.A. 1995).

Dans cette
optique, la récente intégration de la phylogénétique dans l’étude des
communautés a ouvert la voie à
de

nouvelle
s

approche
s
. En effet, les
relations
phylogénétiques entre espèces d’une communauté permettent sous certaines
conditions d’inférer la principale force écologique la structurant (
WEBB

C.O.
2000
).

Un habitat homogène dans ses conditions tend à sélectionner des espèces
similaires du p
oint de vue des exigences écologiques

(filtre environnemental)
,
et la concurrence
pour les ressources
entre espèces similaires tend à
sélectionner des espèces différentes (
exclusion compétitive
).

L
’assemblage
d’une communauté résulte
notamment
d’un
comprom
is

entre
ces
forces
attractives et répulsives.
Les
dernières
recherches mettent en évidence
deux
5


structures phylogénétiques extrêmes

correspondantes

: la structure agrégée et
la structure surdispersée

(
WEBB

C.O. &
ACKERLY

D.D. &
MCPEEK

M.A. &
DONOGHUE

M.J. 2002
,
CAVENDER
-
BARES

J. &
ACKERLY

D.D. &

BAUM

D.A. &
BAZZAZ

F. A. 2004
)
.

En pratique, l’agrégation ou la surdispersi
on sont des notions relatives,

elles
concernent la structure phylogénétique d
’un sous
-
ensemble de taxons

(
la
communauté étudiée) par

rapport
à un

modèle nul
.

Ce modèle nul simule

un
grand nombre de

communautés assemblées au hasard à
-
partir de tous les
taxons

composant la communauté d’échelle supérieure (tous
ceux

susceptibles
d’appartenir à la communauté
,

de coloniser le milieu), ou «

pool régional

»

(
EMERSON B.C. & GILLESPIE R.G. 2008
)
.

C
e
tte simulation

produit une
distribution normale des indices qui sert de base de comparaison pour les
structures phylogénétiques
réelles
. Si les indices réels tombent dans les
quantiles extrêmes de la
distribution normale (représentant l
a gamme des

structures phylogénétiques neutres), alors la composition de la communauté
ne relève
vraisemblablement pas
du hasard
(
WEBB 2000
).

En partant de l’hypothèse que les traits écologiques (adaptations
fonctionnel
les) sont conservés phylogénétiquement (tendance dominante
comme l’indique

WIENS

J.J. & al. 2010), une communauté phylogénétiquement
agrégée reflète plutôt un filtre environnemental fort, alors qu’une structure
surdispersée indique plutôt un rôle prépondér
ant de l’exclusion compétitive
dans l’assemblage des espèces. Comme ces processus agissent de concert (et
avec de nombreux autres), beaucoup de structures phylogénétiques observées
dans la nature ne correspondent à aucune des deux situations extrêmes (
WEBB

C.O. 2000,
WEBB

C.O. &
ACKERLY

D.D. &
MCPEEK

M.A. &
DONOGHUE

M.J.
6


2002,
MAHERALI

H. &
KLIRONOMOS

J.N. 2007, VAMOSI S.M. & HEARD S.B. &
VAMOSI J.C. & WEBB C.O. 2009).

WEBB (2000) fut le premier à développer une
méthode pour

mesurer
l’agrégation de la structure phylogénétique des communautés. Son

premier
indice (NRI, Net Relatedness Index) se base sur la moyenne du nombre de
nœuds séparant chaque pair
e

de taxons d’une communauté dans la phylogénie
du pool régional (MPD, Mean
Pairwise Distance), en regard de

la distribution
de
s MPD
obtenue avec le modèle nul
. Cet indice
permet d’apprécier
l’agrégation

dans l’ensemble de la phylogénie, mais il reflète mal ce qui peut
survenir dans ses hauts niveaux (clades terminaux). Le second
indice développé
par WEBB (NTI, Nearest Taxa Index) permet d
’explorer l’agrégation

dans les
clades terminaux
, en se basant sur la moyenne des distances nodales dans la
phylogénie du pool régional entre chaque taxon et sont taxon le plus proche
présent dans

la communauté (MNTD), toujours vis
-
à
-
vis de la même mesure
issue des randomisations (
WEBB

C.O. 2000
).

Cette approche nodale convient à toute sorte d’arbres phylogénétiques mais
est fortement biaisée par la topologie de la phylogénie

: deux espèces d’une
communauté séparées par un seul nœud sont toujours considérées comme
proches et dirigent l’indice vers l’agrégation
,

alors que leur temps de
divergence
(et leur similitude écologique)
est peut
-
être plus grand que celui de
deux espèces séparées par plusieur
s nœuds, mais ayan
t un ancêtre commun
plus récent.

Ce biais s’amoindrit si l’on utilise une phylogénie quantifiant la
diversité phylogénétique (la longueur des branches) sur une base moléculaire
et permettant une estimation plus précise de
la différenciati
on
. Les derniers
programmes informatiques
développés

dans ce but



Phylocom

» et le
package «

Picante

» pour R) prennent en compte les
longueurs de branches
,
7


mais aussi l’abondance relative des espèces étudiées ainsi que d’autres
paramètres
, et
fournissent une information statistique quant à la significativité
des résultats vis
-
à
-
vis d
u

modèle nul
(
FAITH D.P. 1992, FAITH D.P. 1996,
WEBB

C.O. 2000,
FAITH D.P. 2006,
WEBB

C.O. &
ACKERLY

D.D. &
KEMBEL

S.W. 2008,
KEMBEL

S.W. &
COWAN

P.D. &
HELMUS

M.R.

&
CORNWELL

W.K. &
MORLON

H.
&
ACKERLY

D.D. &
BLOMBERG

S.P. &
WEBB

C.O. 2010,
KEMBEL

S. 2010
).

L’accumulation

massive de données moléculaires (séquences de gènes) pour
beaucoup d’organismes
,

autorisant des reconstructions phylogénétiques d’une
résolution inédite,
a
par ailleurs
ouvert la voie

à

une synthèse de l’écologie des
communautés et de la biologie de l’évolution. Les processus

d
’adaptation, d
e
spéciation et d’extinction
contribuent à l
a biodiversité et

à la dynamique des
communautés,

et en retour le contexte communautaire influence ces
processus.
L’évolution

d’une seule espèce peut modifier les propriétés
écologiques d’une communauté entière, et inversement la vie en communauté
suppose
une coévolution diffuse de ses membres (JOHNSON M.T.J. &
STINCHCOMBE J.R. 2007, RICKLEFS R.E. 2007, STEPHENS P.R. & WIENS J.J.
2009).



8


La p
hylogé
nétique en biogéographie

L’
avènement

de
s

données moléculaires
offre

également de nouvelles
perspectives pour les biogéographes, qui peuvent désormais confronter des
temps de divergences

estimés sur la base d’horloges moléculaires

avec des
données géologiques, et ainsi mettre en relation des phénomènes
paléogéographiques

a
vec les événements de spéciation ou d’extinction
.

Le principe de l’horloge moléculaire consiste à considérer le taux de
substitution des bases dans
la

séquence
d’un gène soumis à la sélection
naturelle
comme
une fonction du temps.

Plus u
n gène
est
conserv
é
, plus
il lui
faudra du temps pour accumuler des mutations. La comparaison de ces gènes
hyperconservés
(
ceux codant pour les histones p.ex.
)
permet d’établir une
topologie
précise
à grande échelle

(classe, ordre
).

Par contre, la divergence de
deux espèces est souvent un événement trop récent pour qu’une variation
s’observe dans des gènes hyperconservés. Dans ce cas
,

les séquences de gènes
plus variables sont utilisées

(gènes mitochondriaux p.ex.)
.
L’horloge est

cal
ibr
ée

selon le gène
avec

des
événements
paléo
géogr
aphiques connus et d’éventuels

fossiles. Les mutations génétiques n’interv
i
e
n
n
e
nt
vraisemblablement pas

à un
rythme régulier,

aussi

la datation des divergences
entre taxons
par cette
méthode
reste

sujette à

débat. De plus, l’absence de fossile chez certains
groupes ne perme
t pas
de

calibration
directe
(
CAMPBELL N.A. & REECE J. B.
2002,
HEADS M. 2005,
DRUMMOND

A.J. &
RAMBAUT

A.

2007,
BORER
M
.

&
ALVAREZ
N
.

&
BUERKI

S
.

&

MARGRAF
N
.

&
RAHIER

M
.

&
NAISBIT

R.E
.

2010
)
.

En Europe

occidentale
,
l
es
oscillations climatiques

du Pléistocènes
sont
connues pour
être

l’une des principales cause
s

de la distribution et de la
structure génétique
actuelle
s

des populations animales et végétales.

9


Le modèle proposé par SCHMITT (2007) met en évidence les effets différents
observés selon que l’on étudie une espèce de haute altitude ou de plaine.
Durant les périodes
glaciaires
, alors que
les secondes se

sont vues repousser
vers les refuges méditerranéens
par
les températures
basses

et

les
précipitations rares, les premières ont vu leur niche
se déplacer
à la

périphérie
des glaciers alpins
,

ou alors
s
’étendre

à
-
travers

toute

l’Eu
rope

libre de glace.
Les

espèces boréo
-
alpines
,

ne présent
a
nt que peu de différenciation

génétique
entre les différents massifs européens et les régions du Nord, sont les preuves
d’une large expansion durant les périodes glaciaires.

A l’inverse, certaines
espèces alpines se révèl
ent être composées de plusieurs lignées génétiques,
suggérant une isolation perdurant pendant les périodes froides
,

dans des
refuges circum
-
alpins.

SCHMITT souligne
également des évidences
de colonisation entre massifs,
ainsi

que des survivances dans les
massifs mêmes

en période glaciaire. Une

espèce
alpine
localisée dans une chaîne montagneuse
se révèle parfois être composée
d’une multitude de lignées indépendantes en voie de différenciation, et dont le
rang taxonomique mériterait d’être revu.

Une bonne c
onnaissance de la
structure génétique des populations
et de leur histoire évolutive
apparaît
aujourd’hui comme un prérequis incontournable dans la gestion et la
préservation de la biodiversité

(
HEWITT M. G. 2004
,

SCHMITT

T. 2007
).




10


Volet écologi
qu
e

Cas
d’étude

: communautés

E+P des stations jurassiennes

Les Plécoptères et les Ephéméroptères (abrégé après E+P) sont des ordres
d’insectes aux larves exclusivement aquatiques, relativement sédentaires et
sensiblement inféodées aux conditions environnementale
s

(
DIREN Haute
-
Normandie


Service Eau et Nature


Laboratoire d’hydrobiologie

: Généralités
sur l’Indice Biologique Global Normalisé (I.B.G.N.)
)
.
Le Jura franco
-
suisse
compte
68

espèces de Plécoptères et
52 espèces
d’Ephéméroptères

(données
personnelles)
,

constitu
a
nt le
s

pool
s

régionau
x

des communautés étudiées
.

De
manière générale, c
es espèces se répartissent dans
l
es

sources

et
l
es
résurgences
,
l
es ruisseaux et
l
es rivières
. Les tourbières jurassiennes hébergent
également quelques espèces E+P.


C
es

stations
se distinguent
selon des
paramètres

comme la température de l’eau, son oxygénation ou sa teneur en
n
utriment, la pente et le débit
par exemple.
Tous ces facteurs
constituent
d
es
filtres environnementaux
influen
ça
nt considérablement le cycle de vi
e des
insectes aquatiques
,

et structurent leurs communautés

(
LEROY POFF N. 1997,
COOPER S.D. & DIEHL S. & KRATZ K. & SARNELLE O. 1998,
DELARZE R. &
GONSETH Y. 2008
)
.

D’un autre côté, il n’est pas rare de trouver plusieurs espèces différentes
de
Plécoptère
s ou d’Ephéméroptères
dans
une portion très restreinte
d’un cours
d’eau
.
Cela

suggère un impact des interactions biotiques sur la composition
spécifique
des communautés
,

bien que ce dernier soit mal connu

en raison du
manque d’études sur l’écologie des stades larvaires de ces ordres d’insectes
(
AUBERT J. 1989
).



11


En admettant
le principe

selon laquelle la niche écologique est conservée

phylogénétiquement
, q
uel processus (entre filtre environnemental et excl
usion
compétitive)
prédomine dans

l’assemblage des espèces d
es
différentes
communautés E+P

? Pour répondre à cette question il s’agit de comparer la
structure phylogénétique de communautés E+P

d
e milieux aquatiques
contrastés.


Je
fais l’hypothèse

que des
habitats

contraignants du point de vue de
c
es
ordres d’insectes
auront

des communautés agrégées phylogénétiquement,
reflétant une prépondérance du filtre environnemental sur les interactions
biotiques. Une tourbière dont les eaux sont acides, peu oxygénées

et coulant à
faible débit sélectionnera
donc des

espèces proches phylogénétiquement
,
partageant l
a ou l
es adaptations nécessaires pour survivre dans
ces conditions
inhospitalières
.
En
comparaison
,
je suppose qu’
une rivière ou un ruisseau
ne
réclam
e

pas

d’
adaptations
spécifiques chez

les E+P,

et
que la compétition sera
la principale force structurante

dans ces types

d’habitat
, conduisant à une
structure phylogénétique surdispersée

des communautés
.

Comme beaucoup
d’autres facteurs peuvent influencer la composition des communautés, je
pense que la plupart des structures phylogénétiques observées ne différeront
pas significativement des structures simulées par le modèle nul.

Je compte vérifier ces hyp
othèses en établissant d’abord les phylogénies des
pools régionaux
sur la base

de trois gènes

(COI, 16S & 28S)

et d’une méthode
de reconstruction phylogénétique probabiliste (inférence bayésienne)
,
puis en
établissant

les compositions
spécifiques
de

plusie
ur
s communautés de
différents types d’habitats aquatiques
jurassiens
.

Les

indices d’agrégation (NRI
et NTI)

de chaque communauté
et leur différence avec ceux
issus
du modèle
nul permettront de confirmer ou non une structure
«

extrême

»
.


12


M
éthode

Collecte

C’est le travail colossal de J.
-
P. G. Reding depuis une vingtaine d’années qui a
permis d’obtenir
l
es données nécessaires à une telle étude. Grâce à ses
nombreuses
prospections dans tout le Jura
, la faune des Ephéméroptères et
des Plécoptères de cette régi
on peut être considérée comme bien connue. Ce
travail se matérialise par une collection riche de plus de 20'000 spécimens,
gérée depuis une base de données Access. Les informations stockées dans
cette base de données concernent par exemple les dates et poi
nts de captures
(coordonnées en CH1903, altitude en mètre, type de biotope etc.) ou le
nombre et les stades de développement des spécimens (larve, nymphe etc.).

Données communautaires

Dans mon cas, la disponibilité des données et la nécessité d’avoir des
réplicas
pour chaque type d’habitat

conditionnent

le choix des communautés : comme
il est en plus indispensable d’en connaître la diversité spécifique de façon
exhaustive, une fois les catégories d’habitat fixées le nombre de visites
constitue un bon critè
re de sélection.


Deux

matrice
s

de présence
-
absence
pour l’ensemble de ces communautés
sont

générée
s

via des requêtes
dans
Access

à partir de la base de données REDING
,
correspondant à chacun des
deux ordres d’insectes

et

offrant ainsi un réplica
taxonomique.




13


Communauté

par type d’habitats

:

Tourbière (Peat
-
bog)

Résurgence
(Resurgence)

Source
(Source)

Ruisseau
(Brook)

Rivière (River)

Tourbière du
Cachot

Areuse

Ain

Dénériaz

Areuse (Noiraigue)

Vraconnaz

Noiraigue

Ruisseau du
Val

Saut de l’eau

Buttes (Buttes)

Vurpillières

Soubey

Dessoubre

Combes
Dernier

Areuse (Champ du
Moulin)



Minimum

: 23 visites (Noiraigue)


Structure de la matrice de présence
-
absence

:


0 = absente / 1 = présente

Toutes les espèces du pool régional d’un des deux ordres sont représentées
dans les colonnes
,

chacune des
stations correspond
à une ligne.

Cette
information est
stockée dans un fichier
texte (.txt) en vue des analyses.


0
100
200
300
400
500
600
700
Ain
Areuse
Areuse (Champ du moulin)
Areuse (Noiraigue)
Buttes (Buttes)
Combes Dernier
Dénériaz
Dessoubre
Noiraigue
ruisseau du Val
Saut De L'eau
Soubey
tourbière du Cachot
Vraconnaz
Vurpillières
Visites


Espèce 1

Espèce 2

Espèce 3


Espèce N

Station 1

0

1

0



Station 2

1

1

1




Station N









14


Séquençage

La phylogénie du pool régional de chaque ordre
se base sur les séquences
partielles de trois gènes (16S & COI & 28S) et
est réalisée exclusivement avec
des spécimens provenant de la collection REDING. Pour le
représentant de
chaque espèce, l’ADN de trois pattes est extrait avec le «

DNeasy Blood &
Tissue Kit

» (QIAGEN, Germany) suivant le protocole «

Purification of total DNA
from insects using the DNeasy Blood & Tissue Kit (DY14 Aug
-
06)

» et conservé
dans un r
éfrigérateur à
-
24°C. Les PCR sont réalisées dans des «

T3
Thermocycler

» (vers. 3.29t3 ©
Biometra 2000).


PCR amplification

COI

16S

28S

Température
[°C]

Temps
[secondes]

Température
[°C]

Temps
[secondes]

Température
[°C]

Temps
[secondes]

dénaturation initiale

95

180

95

180

95

180

#

dénaturation

95

30

95

30

95

30

#

hybridation

50

30

52

30

49

30

#
élongation

72

50

72

50

72

50

élongation finale

72

300

72

300

72

300

pause

4



4



4



nombre de cycles
#

34

34

34


MIX amplification 16S / COI

Buffer

1.000

X

Qsol

0.500

X

dNTPs

0.150

mM

Primer F

0.005

mM

Primer R

0.005

mM

MgCl2

2.500

mM

Taq

1.000

unit

Primers


28S

28S D2 for

F

5'
-
AGAGAGAGTTCAAGAGTACGTG
-
3'

Belshaw &
Quicke, 1997

28S D2 rev

R

5'
-
TTGGTCCGTGTTTCAAGACGGG
-
3'

COI

C1
-
J
-
1751

F

5'
-
GGATCACCTGATATAGCATTCCC
-
3'

Simon et al,
1994

C1
-
N
-
2191

R

5'
-
CCAGGTAAAATTAAAATATAAACTTC
-
3'

LCO1490

F

5'
-
GGTCAACAAATCATAAAGATATTGG
-
3'

Folmer et al,
1994

HCO2198

R

5'
-
TAAACTTCAGGGTGACCAAAAAATCA
-
3'

16S

LR
-
J
-
12864

F

5'
-
CTCCGGTTTGAACTCAGATCA
-
3'

Arnedo et al,
2001

LR
-
N
-
13398

R

5'
-
CGCCTGTTTATCAAAAACAT
-
3'

16S_SuzukiF

F

5'
-
CCGGTCTGAACTCAGATCACGT
-
3'

Suzuki, 1997

16S_SuzukiR

R

5'
-
CGCCTGTTTATCAAAAACAT
-
3'

16S_Palumbi_BRH

F

5'
-
CCGGTCTGAACTCAGATCACGT
-
3'

Palumbi et al,
1991

16S_Palumbi_ARL

R

5'
-
CGCCTGTTTATCAAAAACAT
-
3'

MIX amplification 28S

Buffer

1.000

X

Qsol

0.500

X

dNTPs

0.150

mM

Primer F

0.005

mM

Primer R

0.005

mM

MgCl2

2.000

mM

Taq

1.000

unit

15


Le résultat de l’amplification est vérifié sur gel d’agarose avant
purification de
l’ADN amplifié avec le «

QIAquick PCR Purification kit

» (QIAGEN, Germany). Le
séquençage est réalisé par le CIG (Center for Integrative Genomic) de
l’Université de Lausanne.

Alignements

Les séquences
(forward et reverse)
sont
nettoyées
avec Chromas Lite version
2.01 (Technelysium, Helensvale, Australia) et
alignées selon

l’algorithme
implémenté dans
MUSCLE (http://www.ebi.ac.uk/Tools/msa/muscle/).
D
e
s
corrections manuelles sont
finalement effectu
ées sous BioEdit version 7.0.9.

Analyses
phylogénétiques

L’arbre phylogénétique de chacun de mes ordres est obtenu par une analyse
d’inférence bayésienne avec MrBayes version 3.1.2 (
RONQUIST

F. &
HUELSENBECK

J.P. 2003
).
Deux fichiers Nexus (.nex
) contiennent les séquences
alignées des espèces de chacun de mes ordres avec chaque fois
un outgroup

provenant de l’
autre ordre, ainsi que les lignes de commandes
spécifiant

les
paramètres de l’analyse (disponibles en annexe)
.

L’analyse comprend quatre
ru
ns indépendants de 20 millions de générations avec
un tirage

toutes les
milles générations.

L
es
analyse
s

de

structure phylogénétique
sont

réalisée
s

sous R avec le package
«

picante

» (
Kembel S, 2010
).
En plus des deux indices d’agrégation
phylogénétique développés par WEBB, ce package offre un aperçu visuel de la
répartition des espèces dans chaque communauté, ainsi que de la diversité
phylogénétique
(au sens de FAITH
2006
)
qui les caractérise.
Les lign
es de
commandes sont disponibles en annexe.


16


Résultat

Phylogénie des Plécoptères




Matrice de d
onnées moléculaires

:
Plecoptera

49 espèces

1688 bp ADN

16S : 525 bp

28S

: 573 bp

COI : 590 bp

outgroup :
Ecdyonurus helveticus

(Ephemeroptera)

17


Structure phylogénétique des communautés de Plécoptères

A.
Corrélation entre richesse spécifique (SR) et diversité phylogénétique (PD) au
sens de FAITH (
2006
).

R² = 0.87





PD


SR

Areuse



6.2222841

31

Buttes_(Buttes)


5.0518980

21

Champ_du_moulin

6.3648428

30

Combes_Dernier

2.3126410

8

Dessoubre



3.8965110

17

Ain




5.1243827

15

Deneriaz


6.6729383

36

Areuse_(Noiraigue)

4.8782748

16

Noiraigue


3.2044104

12

Saut_De_Leau 4.5429115

15

Soubey


3.5680646

14

Cachot


0.7884001

3

Ruisseau _du _Val 3.4302233

16

Vraconnaz

1.1977885

4

Vurpillières



4.3417640

17



B. Diversité phylogénétique en fonction des types d’
habitats








G
auche

: diversité phylogénétique pour chaque ty
pe d’habitat, pas de
différence significative avec un test de
Kruskal
-
Wallis
(p
-
value =
0.2873
).

D
roite

: diversité phylogénétique des
tourbières

vs tous les autres habitats,
pas
de
différence significative avec un test de
Kruskal
-
Wallis
(
p
-
value = 0.0606
).


18


C. Indice
s

d’agrégation phylogénétique au sens de WEBB (200
0
)



SES
MPD

(
NRI
,
Net Relatedness Index)





mpd.obs.z mpd.obs.p

Areuse




-
0.8683888 0.185

Buttes_(Buttes)


-
1.4252598 0.079

Champ_du_moulin



1.8485497 0.992 +
rivière

Combes_Dernier


-
1.5737209 0.090

Dessoubre


-
1.5826402 0.083

Ain



0.6065953 0.712

Deneriaz




-
2.0073251 0.033 *

ruisseau

Areuse_(Noiraigue)


1.60676
57 0.975 +
rivière

Noiraigue




-
1.5112065 0.091

Saut_De_Leau


-
0.3158860 0.339

Soubey





0.4696737 0.647

Cachot




-
1.6810021 0.050 *
tourbière

ruisseau_du_Val


-
1.6658345 0.057

Vraconnaz



-
2.9512666 0.016 *
tourbière

Vurpillieres


-
0.4360306 0.315





SES
M
NTD

(
NTI
,
Nearest Taxa Index)





mntd.obs.z


mntd.obs.p

Areuse




-
1.247911749 0.1200

Buttes_(Buttes)


0.009739615 0.4830

Champ_du_moulin

-
0.795796708 0.2110

Combes_Dernier

-
1.317030478 0.1120

Dessoubre

-
0.033928916 0.4750

Ain




1.725705528 0.9560 +

source

Deneriaz




0.907714465 0.8070

Ar
euse_(Noiraigue)

-
0.193097460 0.4240

Noiraigue



-
0.716628360 0.2320

Saut_De_Leau


0.773965858 0.7670

Soubey




-
1.252584660 0.1070

Cachot



-
1.872305747 0.0425 *

tourbière

ruisseau_du_Val

-
1.060296342 0.14
20

Vraconnaz

-
1.789839026 0.0470 *

tourbière

Vurpillieres


-
0.425635429 0.3310




Différence significative par rapport au modèle nul

:
+

= overdispersion / *

=

agrégation

Runs = 999



19


D.
R
épartition dans la phylogénie des espèces de

chaque communauté




20


Phylogénie des Ephéméroptères




Matrice de d
onnées moléculaires

:
Ephemeroptera

41 espèces

1622 bp ADN

16S : 467 bp

28S

: 563 bp

COI : 592 bp

outgroup : Perla grandis (Plecoptera)

21


Structure phylogénétique des communautés
d’Ephéméroptères

A.
Corrélation entre richesse spécifique (SR) et diversité phylogénétique (PD) au
sens de FAITH (
2006
).
R² =
0.93





PD


SR

Areuse



4.889758

9

Buttes_(Buttes)


4.872074

8

Champ_du_moulin

8.154258

22

Combes_Dernier

3.762030

6

Dessoubre


3.981153

6

Ain



3.431653

5

Deneriaz


3.668986

7

Areuse_(Noiraigue)

8.109873

15

Noiraigue


2.416700

2

Saut_De_Leau


3.550243

6

Soubey



3.761853

5

Cachot



2.565287

2

ruisseau_du_Val

2.428376

3

Vraconnaz


2.553005

2

Vurpillieres


5.806051

11



B. Diversité phylogénétique en fonction des types d’habitats








G
auche

:

diversité phylogénétique
pour chaque

type d’habitat, pas de
différence significative
avec un test de
Kruskal
-
Wallis
(p
-
value =
0.2339
).

D
roite

: diversité phylogénétique des rivières vs tous les autres habitats,
différence significative avec un test de
Kruskal
-
Wallis
(
p
-
value = 0.02092
).


22


C. Indices d’agrégation phylogénétique au sens de WEBB (2000
)



SES
MPD

(NRI, Net Relatedness Index)






mpd.obs.z mpd.obs.p

Areuse






0.45239382 0.6280

Buttes_(Buttes)


0.51811555 0.6590

Champ_du_moulin

-
1.20251053 0.1100

Combes_Dernier


0.19535457 0.4780

Dessoubre


0.43610830 0.6220


Ain



0.36350943 0.5800

Deneriaz



-
0.50836732 0.2480

Areuse_(Noiraigue)


0.77074069 0.7840

Noiraigue




1.10010183 0.8430

Saut_De_Leau

-
0.18430523 0.3390

Soubey





0.89009932 0.8420

C
achot




1.24494051 0.9660
+

tourbière


ruisseau_du_Val

-
0.02571451 0.4040

Vraconnaz


1.28034285 0.9525
+

tourbière

Vurpillieres



0.50149519 0.6390





SES
M
NTD

(NTI, Nearest Taxa Index)





mntd.obs.z

mntd.obs.p

Areuse




-
0.8949343 0.1950

Buttes_(Buttes)

-
0.4187078 0.3380

Champ_du_moulin

-
0.3824821 0.3380

Combes_Dernier

-
1.0112353 0.1660

Dessoubre

-
1.1872623 0.1280

Ain



-
1.5641784 0.0610

Deneriaz



-
2.4516022 0.0110 *

ruisseau

Areuse_(Noiraigue)


1.6416190 0.9540 +

rivière

Noiraigue




1.0702708 0.8180

Saut_De_Leau

-
1.7220359 0.0470 *

ruisseau

Soubey




-
1.1150906 0.1400

Cacho
t




1.2339066

0.9575 +

tourbière

ruisseau_du_Val

-
0.7530415 0.2360

Vraconnaz


1.2142927 0.9435

Vurpillieres


-
0.5169269 0.3020



Différence significative par rapport au modèle nul

: +

= overdispersion / *

= a
grégation

Runs = 999



23


D.
R
épartition dans la phylogénie des espèces de chaque communauté



24


Discussion

Phylogénie
du pool régional

Chez les Plécoptères (exception faite de
s Capniidae
) et
les Ephéméroptères
,
familles et genres sont monophylétiques.

Toutefois,
le
s

support
s

souvent

faibles

des nœuds

profonds invite
nt

à compléter le jeu de données

moléculaires avec d’autres
g
ènes, moins variables, ainsi qu’avec des espèces
supplémentaires de certaines familles représentées
ici
par un seul individu

(Sip
hlonuridae et Oligoneuriidae chez les Ephéméroptères, Taeniopterygidae
chez les Plécoptères)
.
La famille des Baetidae semble se détacher
très
nettement des autres Ephéméroptères
, alors que les
tous les
Plécoptères
forment un
seul
ordre bien défini.

Divers
ité phylogénétique

Dans mes communautés, c
hez les deux ordres, la richesse spécifique (SR) est
bien corrélée avec la diversité phylogénétique (PD, mesurée selon F
AITH

2006
).

Chez

les Ephéméroptères
,

les communautés des rivières semblent s’illustrer
par une haute PD, mais le test de Kruskal
-
Wallis ne révèle pas
de

différence
significative selon le type d’habitat (p
-
value = 0.2339). Chez les Plécoptères, ce
sont les communautés des tourbières qui se dé
marquent par une faible PD,
mais là encore le test de Kruskal
-
Wallis n’est pas significatif (p
-
value = 0.2873).
Suite à ces observations, la PD a été représentée en fonction des rivières
versus
les

autres habitats chez les Ephéméroptères

:

la différence de

PD est alors
significative (p
-
value = 0.02092).
De même, l
a PD chez les Plécoptères est aussi
représentée en fonction des tourbières
versus les

autres habitats, mais le test
reste non significatif (marginalement, p
-
value = 0.0606).


25


Structure phylogénétiq
ue

L’agrégation des espèces dans la phylogénie du pool chez la

plupart des
communautés
d
es deux ordres ne diffère pas
de celle obtenue par
le hasard
, ni
sur l’ensemble de la phylogénie (NRI) ni dans les clades terminaux (NTI).

Le
tableau ci
-
après résume le
s cas où les indices sont significativement différents
de
la
distribution

d’indices
généré
e

par
les

simulations

:


NRI

NTI


Agrégation

Dispersion

Agrégation

Dispersion

Plécoptères



Dénériaz



Cachot



Vraconnaz



Areuse
(Noiraigue)



Champ
-
du
-
Moulin



Cachot



Vraconnaz



Ain

Ephéméroptères




Cachot



Vraconnaz



Dénériaz



Saut de
L’eau



Areuse
(Noiraigue)



Cachot

Chez les Plécoptères, les tourbières du Cachot et de la Vraconnaz s’illustrent
par la proximité phylogénétique
des

espèces

au
x

deux niveaux (
NRI et NTI

:
ensemble de la phylogénie et clades terminaux)
. Le schéma inverse s’observe
chez les
Ephéméroptères de ces communautés

(
surtout celle d
u

Cachot)
,
présentant une overdispersion.
Il me paraît cependant prématuré de tirer des
conclusions quant à l’importance
relative des forces écologiques structurantes
(filtre environnemental vs exclusion compétitive). En effet, ces tourbières sont
constituées d’un patchwork d
e microhabitats

différents, et une analyse plus
fine tenant compte de cette diversité est nécessaire.

De plus
,
elles

peuvent
héberger des espèces dites «

touristes

». Ce
dernier
biais peut être amoindri
par une pondération de la matrice de présence/absence par l’abondance
relative des espèces.

Les communautés de Plécoptères des rivières (Areuse à deux
st
ations
) recèlent
au contraire un
très
grand nombre d’espèces,
«

forçant

»

une représentation
globale dans la phylogénie (NRI)

et donc une dispersion suggérant une
26


prédominance de l’exclusion compétitive. Mais l’aperçu visuel
contredit

clairement cette infé
rence

: beaucoup de couples d’espèces

de Plécoptères très

proches cohabitent dans ces communautés.
Peut
-
être que

le rapport entre
nombre d’espèces considérées dans le pool et celui des communauté
s

peut
biaiser l’analyse
.

En tout cas,

quand toutes (ou presque) les espèces du pool
régional
sont présentent dans une communauté
, il est certain que cet habitat
mérite une attention toute particulière
du point de vue

de
la
conservation.

Les
Ephéméroptères de deux ruisseaux (Dénériaz et Saut
de L’eau) sont
clairement agrégés dans les clades termi
naux

(NTI)
ce qui suppose un filtre
environnemental fort, mais pas dans l’ensemble de la phylogénie (
NRI

non
significatif, mais l’
aperçu visuel le confirme)
.
Il
demeure

très problématique
d’inférer la
principale force écologique structurante quand les deux indi
ces ne
convergent pas. De plus, sans une connaissance précise des traits écologiques
(adaptations des espèces) impliqués dans les interactions, il paraît difficile de
savoir à quel n
iveau taxonomi
que opère

tel ou tel

filtre environnemental.
L’hypothèse assumée pour mes analyses
d’une

conservation phylogénétique de
la niche
définit

d
es limites

:

l’exclusion compétitive
étant

écartée comme
facteur structurant

dans ce cas
,
le filtre
environnemental
n
e

semble agir

que
sur les rangs taxonomiques inférieurs (genres et espèces), supposant des
adaptations convergentes.

Les structures phylogénétiques des communautés
des

deu
x ordres ne se
répètent

pas

dans un même habitat
, malgré
l

a
pparente

similitude

écolog
ique
de ces insectes.
Un troisième réplica taxonomique peut se trouver chez les
Trichoptères, dont la plupart des larves sont également aquatiques.



27


Volet biogéographi
qu
e

Cas d’étude

: endémiques

jurassiennes

Pendant longtemps, la faune aquatique E
+
P du
Jura franco
-
suisse a été
considérée comme banale et peu diversifiée. En effet, la faune des cours d’eau
grands et moyens n’offre aucun élément original par rapport à celle du Plateau
suisse ou de la plaine bressane

française
, et
celle

des massifs montagneu
x du
Jura
était considérée comme
un sous
-
ensemble de celle des Alpes et des
Préalpes.

On
a ainsi cru

que la faune
jurassienne

était

entièrement tributaire de
l
a recolonisation post
-
glaciaire

;

soit celle depuis les refuges glaciaires
classiques du Rhône in
férieur pour la faune potamale, soit celle des régions
circum
-
alpines restées libres de glace pour la faune des ruisseaux d’altitude
.
Cependant, des prospections récentes
d
e milieux aquatiques
diversifiés

(tourbières, sources, cours d’eaux apicaux temporai
res, zones littorales des lacs
jurassiens d’altitude) ainsi que des analyses tax
o
nomiques plus poussées
(ootaxonomie, morphologie larvaire) on
t

permis de montrer que le Jura franco
-
suisse recèle tout un ensemble d’espèces dont l’écologie et la distribution

ne
suit pas celle des espèces provenant de la
recolonisation postglaciaire. E
n
réalité
,

la faune E+P

du Jura franco
-
suisse est composée d’une mosaïque
d’éléments faunistiques d’origines fort diverses et su
rtout d’époques fort
différentes
.
Ces prospections

ont révélé que l
e Jura compte au moins
trois

espèces

E+P

endémiques, dont deux font l’objet d’une attention toute
particulière dans ce travail

: il s’agit de
Perlodes jurassicus

(Plecoptera) et de
Baetis nubecularis

(Ephemeroptera). Leur particularité est

d’avoir un taxon
largement distribué et très proche morphologiquement dans les Alpes ou
Préalpes suisses, ainsi que dans les Alpes savoyardes, alors que leur niche
écologique dans le Jura est plutôt restreinte. Il s’agit pour
Baetis nubecularis

de
28


l’espèc
e voisine
B. alpinus
(également présente dans le Jura)
et pour
Perlodes
jurassicus

de
P. intricatus.

La proximité morphologique suggère que ces
endémiques jurassiennes ont vraisemblablement une origine alpine, mais les
moments et les causes des différenciations restent sujettes à discussions

(REDING J.P. G. 2010)
.
Une première hypothèse désigne les oscil
lations
climatiques du Pléistocène et le jeu des glaciers comme moteur de la
colonisation

et de la divergence
.

Une seconde part du principe que le Jura et les
Alpes partageaient leurs populations via le
système Rhin
-
Aar
-
Doubs (4,2
-
2,9

millions d’années) et

que la coupure de ce système en deux bassins distincts
(Aar
-
Rhin et Doubs, 2,9
-
1,7 millions d’années) a isolé les populations du Nord
du Jura (
PETIT C. & CAMPY M. & CHALINE J. & BONVALOT J. 1996, ZIEGLER P.A.
& FRAEFEL M. 2009
)
.
Si ces espèces endémiques
sont apparues
avant les deux
dernières glaciations
,

elles ont dû survivre à proximité ou directement dans le
Jura

(
in situ
)
durant plusieurs

période
s

glaciaire
s
. La structure génétique des
populations devraient alors correspondre au modèle proposé par
SCHMITT
(2007) pour les espèces alpi
nes (divergences
«

chroniques

»

au sein de l’espèce
reflétant des survies
in situ

et/
ou des
isolations puis des
recolonisations depuis

d
es refuges).


D
’autres espèces
E+P
observent un profil de distribution similaire à c
elui des
endémiques et de leurs cousines alpines, mais sans que l’on parvienne à
distinguer les spécimens alpins des jurassiens sur la base de critères
morphologiques. Il s’agit notamment des Plécoptères
Chloroperla

susemicheli,
et

Leuctra braueri.
Ces de
rniers appartiennent
-
ils à des espèces cryptiques
,
isolées depuis longtemps de leur ancêtre commun alpin

? S
i leurs populations

présentent une différenciation génétique semblable à celle
observée

entre les
endémiques jurassiennes et leurs relatives alpines
, alors

le rang taxonomique
29


des populations
du Jura

mériteraient d’être reconsidéré, et

les rares biotopes
les hébergeant d
e
v
rai
ent être
appréciés

non plus simplement comme l’extrême
limite d’une aire de répartition alpine, mais au contraire comme des centres
abritant

des
espèce
s

qui leur
sont

propre
s

(REDING J.P. G. 2010).

Une autre question concerne le vecteur de dispersion privilégié de ces
taxo
ns

:
larves ou adultes

ailé
? La majeure partie de leur cycle de vie se passe dans
l’eau (un à deux ans en moyenne

selon les espèces et les conditions
environnementales
)

; le stade d’adulte varie
quant à lui
de quelques heures à
quelques jours chez les Eph
éméroptères
,

et jusqu’à quelques semaines chez les
Plécoptères. Bien que dominantes sur le plan de la durée, les larves sont
confinées au réseau hydrographiques alors que les adultes peuvent disperser
par
-
delà d’imposant obstacle

: des
adultes de
Plécoptèr
es ont été récoltés au
col de Bretolet à plus de 1900 mètres d’altitudes (
AUBERT

J. 1966)
, bien qu’ils
n’
exécut
e
nt
habituellement

que
des vols dits de compensation vers l’amont

pour
parer à

une modeste dérive larvaire

(
HERSHEY A.E. & PASTOR J. &
PETERSON
B.J. & KLING G.W. 1993
).
La structure génétique de mes populations
est
-
elle ségrégée par l’appartenance à l’un des deux grands bassins versants
drainant ma zone d’étude (Rhin ou Rhône), auquel cas les larves seraient
responsables de la dispersion

?

Pour ré
pondre à ces questions
,

je compte

inférer
les

temps de divergence
entre
populations
à

partir des taux de substitution
de deux gènes mitochondriaux
et
d’une horloge moléculaire empruntée à
BORER
M
.

&
ALVAREZ
N
.

&
BUERKI

S
.

&

MARGRAF
N
.

&
RAHIER

M
.

&
NAISBIT

R.E
.

(
2010
).

Une éventuelle corrél
ation
entre la répartition d’une lignée
et un des bassins versants ou un des massifs
nous informerait quant au vecteur de dispersion privilégié dans ces ordres
d’insectes.


30


Cartes de
distribution des espèces

(
source

:
http://lepus.unine.ch/carto/)
:

Les mentions de
P. intricatus

localisées dans le Jura sont dues selon toute
vraisemblance à des erreurs de détermination.

Copyright CSCF, 03.02.2011, Base cartographique

:

OFS, OFT

ArcGIS v.10
© ESRI 201
1

31


Méthode

Collecte

Entre février et décembre 2010, une cinquantaine de journées de prospection
ont permis la collecte du matériel biologique. 53 cours d’eau du Jura franco
-
suisse et 11 dans les Préalpes de Suisse occidentale ont été
visités

(détail en
annexe)
. Du matériel supplémentaire proven
an
t de

la collection
REDING

est
utilisé pour fourni
r

des représentants du Valais.


ArcGIS v.10

© ESRI 2011








Les méthodes de capture et de conservation sont les suivantes

:



Parapluie
japonais

: battage de la végétation et récupération dans le
parapluie (adultes)



Recherche active sur les rochers, parois ou autres surfaces (adultes)



Piège lumineux (adultes)



Épuisette à maillage fin et raclage des fonds meubles et de la végétation
aquatiq
ue des cours d’eau (larves)



Recherche active sous les cailloux tapissant les cours d’eau (larves)



Capture grâce à une pincette entomologique



Conservation dans de l’éthanol à 96%

32


Séquençage

L
es

phylogénies

se

base
nt sur

l
es séquences partielles de
deux

gèn
es
mitochondriaux (16S & COI
). Pour le représentant de chaque
population
, l’ADN
du corps entier (sauf abdomen et ailes)

est extrait avec le «

DNeasy Blood &
Tissue Kit

» (QIAGEN, Germany) suivant le protocole «

Purification of total DNA
from insects using
the DNeasy Blood & Tissue Kit (DY14 Aug
-
06)

» et conservé
dans un réfrigérateur à
-
24°C. Les PCR sont réalisées dans des «

T3
Thermocycler

» (vers. 3.29t3 © Biometra 2000).


PCR amplification

COI

16S

Température
[°C]

Temps
[secondes]

Température
[°C]

Temps
[secondes]

dénaturation initiale

95

180

95

180

#

dénaturation

95

30

95

30

#

hybridation

50

30

52

30

#
élongation

72

50

72

50

élongation
finale

72

300

72

300

pause

4



4



nombre de cycles
#

34

34


Le résultat de l’amplification est vérifié sur
gel
d’agarose avant purification de l’ADN amplifié avec le
«

QIAquick PCR Purification kit

» (QIAGEN, Germany).
Le séquençage est réalisé par le CIG (Center for
Integrative Genomic) de l’Université de Lausanne.

Primers

COI

C1
-
J
-
1751

F

5'
-
GGATCACCTGATATAGCATTCCC
-
3'

Simon et al,
1994

C1
-
N
-
2191

R

5'
-
CCAGGTAAAATTAAAATATAAACTTC
-
3'

LCO1490

F

5'
-
GGTCAACAAATCATAAAGATATTGG
-
3'

Folmer et al,
1994

HCO2198

R

5'
-
TAAACTTCAGGGTGACCAAAAAATCA
-
3'

16S

LR
-
J
-
12864

F

5'
-
CTCCGGTTTGAACTCAGATCA
-
3'

Arnedo et al,
2001

LR
-
N
-
13398

R

5'
-
CGCCTGTTTATCAAAAACAT
-
3'

MIX amplification 16S / COI

Buffer

1.000

X

Qsol

0.500

X

dNTPs

0.150

mM

Primer F

0.005

mM

Primer R

0.005

mM

MgCl2

2.500

mM

Taq

1.000

unit

33


Alignements

Les séquences (forward

et reverse) sont nettoyées avec Chromas Lite version
2.01 (Technelysium, Helensvale, Australia) et alignées selon l’algorithme
implémenté dans MUSCLE (http://www.ebi.ac.uk/Tools/msa/muscle/). Des
corrections manuelles sont finalement effectuées sous BioEd
it version 7.0.9.

Analyses phylogénétiques

Une analyse par méthode de parcimonie du jeu de données moléculaires e
s
t
réalisée grâce au software TCS (
CLEMENT

M
. &

POSADA

D
. &

CRANDALL

K
.A.
2000
).

La phylogénie

et les temps de divergence
entre lignées
sont
obtenus

par une
analyse d’inférence bayésienne sous
BEAST version 1.6.2

(
DRUMMOND

A.J. &
RAMBAUT

A.

2007
).

Les taux moyens de substitution de paires de bases pour
les horl
oges moléculaires
sont emprunté
s

à
BORER

M
,
ALVAREZ

N
,
BUERKI

S
,
MARGRAF

N
,
RAHIER

M
,
NAISBIT

RE
. (2010)

:
16S = 0.61% et COI = 1.73%.
Cette
analyse comprend
un run

de
50

millions de générations avec
un tirage

toutes
les milles générations.
Les paramétrages détaillés sont disponibles en annexe.


34


Résultat

Matrices de
données moléculaires

Groupe
des
endémiques plus relatif alpins

:

Perlodes jurassicus & Perlodes intricatus

19 spécimens

893 bp
ADN
mitochondrial (parsim
-
info: 24)

16S : 447 bp

COI : 446 bp

outgroup : Perlodes dispar (16S, Genbank: EF623220.1)





Groupe des
indifférenciés

distribués dans les Alpes et le Jura
:







A l’exception des outgroups
chez

C. susemicheli

et
l
es Perlodes
,

chaque
spécimen est évalué sur les deux gènes.
D’emblée, le nombre de sites
informatifs du point de vue de l
a parcimonie révèle une plus grande diversité
génétique
chez les
groupes

endémiques
jurassiens plus

relatifs alpins

que chez
les taxons indifférenciés
.



Baetis nubecularis & Baetis alpinus

22 spécimens

1026 bp
ADN
mitochondrial (parsim
-
info: 43)

16S : 448 bp

COI : 578 bp

outgroup : Baetis rhodani (16S + COI)

Leuctra braueri

8
spécimens

1080 bp
ADN
mitochondrial (parsim
-
info: 2)

16S : 490 bp

COI : 590 bp

outgroup : Leuctra nigra & Leuctra hippopus (16S
+ COI)

Chloroperla susemicheli

8 spécimens

1093 bp
ADN
mitochondrial (parsim
-
info: 2)

16S : 490 bp

COI : 603 bp

outgroup : Chloroperla tripunctata (16S) &
Siphonoperla torrentium (16S + COI)

35


Analyse de parcimonie

:
taxons
endémiques

jurassiens et relatifs alpins

Les réseaux d’haplotypes sont réalisés

avec

TCS version 1.21 (
CLEMENT

M
. &

POSADA

D
. &

CRANDALL

K
.A.
2000
).

Clement M, Posada D, Crandall KA. 2000 TCS (v1.21):

a computer program to estimate gene genealogies

Molecular Ecology 9 (10): 1657


1660

Gap

5th state

Limit

2 steps

(99.75% connection limit)




36


Analyse de parcimonie

:

taxons

indifférenciés
distribués dans les Alpes et le Jura

Les réseaux d’haplotypes sont réalisés avec

TCS version 1.21 (
CLEMENT

M
. &

POSADA

D
. &

CRANDALL

K
.A.
2000
).

Clement

M, Posada D, Crandall KA. 2000 TCS (v1.21):

a computer program to estimate gene genealogies

Molecular Ecology 9 (10): 1657


1660

Gap

5th state

Limit

2 steps

(99.75% connection limit)







37


Analyse bayésienne

:

B.

nubecularis
et

B.

alpinus
(Ephemeroptera
)










ArcGIS v.10
© ESRI 2011















A =
B. alpinus

N =
B. nubecularis

Copyright Satellite Image

:
©
ESA / Eurimage / swisstopo, NPOC

Source

: Office fédéral de topographie & données personnelles

38


Analyse bayésienne

:

P.

jurassicus
et
P.

intricatus
(Plecoptera)







ArcGIS v.10
© ESRI 2011


















Copyright Satellite Image

:
©
ESA / Eurimage / swisstopo, NPOC

Source

: Office fédéral de topographie & données personnelles


39


Analyse bayésienne

:

Chloroperla susemicheli
(Plecoptera)






ArcGIS v.10
© ESRI 2011











Copyright Satellite Image

:
©
ESA / Eurimage / swisstopo, NPOC

Source

: Office fédéral de topographie & données personnelles

40


Analyse bayésienne

:

Leuctra braueri
(Plecoptera)





ArcGIS v.10
© ESRI 2011













Copyright Satellite Image

:
©
ESA / Eurimage / swisstopo, NPOC

Source

: Office fédéral de topographie & données personnelles

41


Discussion

Endémiques jurassiennes

:
B. nubecularis
et
B. alpinus

La parenté
proche
de
B. nubecularis

et
B. alpinus

ne fait plus aucun doute

;
l’analyse en inférence bayésienne

et en parcimonie convergent sur ce point, et
la phylogénie réalisée pour le volet écologique le confirme
.
La divergence
remonte
à environ 1,5 millions d’
années

et le nœud est très bien soutenu
(Probabilité Bayésienne Postérieure PBP = 1).

La quasi ident
ité morphologique, l
’absence totale de
B. alpinus
sur le plateau
ainsi que les distances limitées que peuvent parcourir les individus de ce genre
(
HERSHEY A.E. & PASTOR J. & PETERSON B.J. & KLING G.W. 1993,
MONAGHAN
M.T. & SPAAK P. & ROBINSON C.T. & WARD
J. V. 2001
) suggère
nt

que
cette

première
colonisation
,

qui donna naissance à
B. nubecularis
,

fut
induite

par
l’expansion du glacier alpin et des habitats potentiels à sa périphérie,
permettant une connexion avec le
massif du
Jura.

Depuis,
B. nubecularis
s’est maintenue dans le Jura durant
de nombreux cycles climatiques.
La structure génétique
révélée par mon étude montre

une différenciation en deux
clades principaux ayant divergé il y a environ 2
1
0'000 ans
(
PBP = 1
). L’un d’eux est localisé exclusivement
dans le Val
-
de
-
Travers ce qui
suggère
une survie

in situ

lors des deux derniers cycles
,

qui v
ire
nt la majeure
partie du Jura prise sous les glaces

au maximums glaciaires
(
BICHET V. &
CAMPY M. 2008
)
. L’autre clade
est présent

sur une bonne partie de la chaî
ne
(depuis la Saine jusqu’à la Dou)

;

cette

dispersion géographique
va dans le sens

d’
une
recolonisation
de
puis

une seule source, probablement
étendue

dans
un
vaste refuge en

périphérie de la
calotte jurassienne lors de
la dernière
42


glaciation
. Cependant, une certaine diversité
plus ou moins bien

résolue (PBP =
0.71) à l’intérieur de ce dernier clade invite à compléter le jeu de données

(séquences d’autres gènes, individus supplémentaires)
.

Une

lignée
ancienne de
B. alpinus

(~7
4
0'000 ans
,
PBP

= 0.99
)
,

présente
seulement
au Chaluet
,

suggère une
deuxième

colonisation
du Jura suite à
un épisode glaciaire
, et le maintien
de la
population
durant de nombreux cycles
.
Les lignées
très localisée
s

géographiquement suggèrent des
survies
in situ
, mais
dans mon cas
des
collectes et
des
séquences

supplémentaires sont nécessaires
pour confirmer
cette

agrégation spatiale.

Chez
B. alpinus
, l
e clade
suivant
comprenant le
ruisseau du Val (Nord du Jura) et l’affluent d’Arolla
(Valais) est faiblement soutenu (P
BP = 0.42).
Finalement, le reste d
es populations jurassiennes de

B. alpinus

ont divergé de
s

population
s alpines il y a environ 320'000 ans

(PBP = 0.99)
, vraisemblablement
sous la contrainte d’un
autre
événement glaciaire
.
Cette lignée
issue d’une
troisième

colonisation couvre une bonne partie du Jura
, mais est elle
-
même
assez hétérogène sur le plan génétique
. Cela s’explique par le façonnage réalisé
lors des deux derniers cycles, qui verront notamment une
de ses populations

s’installer définitivement au Va
l
-
de
-
Travers comme chez
B. nubecularis
.

Les expansions des glaciers ont

vraisemblablement permis à
B. alpinus

de
coloniser le Jura au moins tr
ois fois durant le Pléistocène.
La répartition
restreinte au Val
-
de
-
Travers d’une lignée jurassienne chez les deux

espèces

suggère des survivances
in situ

dans ce massif durant les périodes froides.

A
43


l’inverse, la dispersion géographique d’
au moins
une lignée chez
les deux
espèces

indique
que la dernière

recolonisation
s’est faite
depuis une source
unique,
vraisemblablement répandue

partout en

marge de la calotte
jurassienne
,

si l’hypothèse d’une capacité de dispersion limitée est adoptée
.
L’horloge moléculaire utilisée est rudimentaire et la phylogénie est souvent mal
soutenue pour les clades terminaux, ce
qui ne permet pas de retracer

précisément

l’histoire récente des populations de ces deux espèces

(impact de
la dernière glaciation)
.

Endémiques jurassiennes

:
P. jurassicus
et
P. intricatus

La parenté proche de
P. jurassicus
et
P. intricatus

est également confirmée

au
niveau génétique

(PBP = 1)
.
Contrairement à
B. alpinus
, il n’y eut qu’une seule

colonisation du Jura par le taxon alpin
, il y a environ un million d’années
.

Deux populations isolées (Baumine et Chaluet)
constituent deux lignée
s basales (~160'000 ans, PBP = 1 et
~90'000 ans, PBP = 0.83), allant dans le sens d’une survie
in situ

lors des deux derniers cycles.

Le reste des populations se divisent en deux clades

: un
constitué d’une
seule
population
à la Dénériaz
vraisemblablement isolée par la glaciation du Würm
et la
période interglaciaire précédente
(~50'000 ans, PBP =
0.9
6
)

;

et l’autre recouvrant l’entier du Jura.
Ce dernier
clade majoritairement représenté et relevant d’une unité génétique absolue
suggère une

recolonisation depuis un vaste refuge après la dernière glaciation
.

La principale

si ce n’est la seule
différence morphologique entre ces deux
espèces réside dans la structure des œufs

(
KNISPEL S. & ROSCISZEWSKA E. &
44


VINÇON G. & LUBINI V.
2002
, détail en annexe
)
.
Cet indice relativise
la
responsabilité

de
l’expansion des glaciers
alpi
ns

dans la colonisation
du Jura

:

peut
-
être que
cette dernière n’a pu
être
au final
rendue
possible que grâce à
une évolution

de la forme des œufs.

Le
disque d’attachement de l’œuf de
P. intricatus
,

ressortant comme une ancre
,

sert

sans doute
à

le fixer soli
dement au substrat
rocheux
des torrents alpins à
fort courant, et ainsi
d’éviter une trop forte dérive
.

Cette adaptation
devien
drai
t contreproductive dans les cours d’eau jurassiens, moins torrentiels
et sujet
s

à des fortes variations du niveau de l’eau
,

a
llant parfois jusqu’
à
l’
asséchement

superficiel
. Les œufs doivent pouvoir suivre l’eau là où elle va,
parfois jusque dans le milieu hyporhéique
, et le disque d’attachement plat de
P. jurassicus

autorise

peut
-
être
cette

liberté de mouvements

nécessaire
.
Une
étude comparative des œufs de Perlodes dans des cours d’eau de différentes
pentes
et débits
permettrait d’y voir plus clair.

Pour
l
es deux
espèces
endémiques

traitées
, l’hypothèse d’une divergence
causée par la séparation des bassins de l’Aar et du Do
ubs
tient aussi la route

;

cette dernière

finissant de s’opérer peu avant les divergences (~1,7 millions
d’années)
, à une époque où les périodes glaciaires étaient beaucoup moins
froides que les deux dernières

(et l’expansion des glaciers

jusqu’au Jura

inc
ertaine)
.
Mais les capacités de dispersion limitées chez ces espèces profitent
à l’hypothèse d’une divergence causée
directement
par
une glaciation
.


Source

: extrait de

: BERTHELEMY

C. &
LAUR

C. (1975) Plécoptères
et Coléoptères aquatiques du Lot (Massif Central Français), in

:
Annales de Limnologie 11(1)

: 275.


45


Taxons

indifférenciés

distribués dans les Alpes et le Jura

Les
deux
clades

suffisamment soutenus chez

C.
susemicheli

(
~140'000 ans
, PBP = 1
)
présentent
chacun
des

individus alpins et jurassiens
, mais dont les relations ne
peuvent être résolues (faible support des nœuds et
manque de données)
.

Ce schéma se retrouve chez
L.
braueri
, avec deux lignées ayant
divergé il y a environ
150'000 ans

(PBP = 1)
.
Cela suggère l’existence de deux
refuges discontinus lors du Riss.
La Dénériaz
héberge

des
représentants de
s

deux lignées

de
L. braueri
.
La résolution
phylogénétique à l’intérieur de ces
quatre lignées laisse
à
désirer

; apparemment, il n’y a pas de ségrégation
géographique ma
rquée comme chez
B. alpinus

et
l’aire de
distribution de chaque clade est très étendue

(Alpes
plus

Jura)
.
L
’interprétation

de ces structures génétiques demeure

problématique et nécessite des
séquences suppléme
ntaires, ainsi que des informations sur les capacités de
dispersion des membr
es de ces deux derniers taxons.

Vecteur de dispersion

Le seul exemple probant de dispersion indépendante du bassin versant
s’obs
erve chez
P. jurassicus
, avec
une lignée parfaitement homogène

recouvrant tout le Jura
.

De manière générale, les
habitudes

de dispersion sont
mal connu
e
s chez ces ordres

d’insectes

plutôt
réputés

pour leur sédentarité
,

mais l
e

jeu

des glaciers
tient

sans d
oute un rôle prédominant dans leur

répartition
.


46


Conclusion

Volet biogéographique

SCHMITT
(2007)
constate que

l’endémisme
rencontré

dans l
es petits massifs
européens
est
majoritairement

à une évolution de la niche écologique
d’espèces collinéennes

avoisinantes
. Mes résultats
montrent

quant à eux
des

exemple
s

de

vicariance via
colonisation depuis les grands massifs
,
accompagnée

ou non d’
une
adaptation
-
clé
.

Compte
-
tenu de la capacité de
dispersion limité
e

chez
m
es endémiques
, les glaciations apparais
se
nt comme le
moteur principal de

ce
s
spéciation
s
, malgré que l’hypothèse d’une
colonisation
«

permanente

» du Jura et de
divergence
s

causée
s

par la séparation des bassins
de l’Aar
-
Rhin et du Doubs ne puisse être écartée
.

Comme les grands massifs, le Jura offre
en période glaciaire
des possibilités de
survie à ses espèces à proximité de leurs aires de répartition.
Les patterns
génétiques observés
chez les endémiques
cadrent bien avec ceux des espèces
alpines

décrits par SCH
MITT (2007)

;

ils

suggèrent

en outre

l’existence d’un
vaste refuge
périglaciaire
propre
au Jura
, ainsi que
celle
d’îlots épargnés par les
glaces permettant une survie
in situ

lors des épisodes froids (Val
-
de
-
Travers,
Chaluet).
L
e Jura ne peut
donc
pas être

considéré
simplement
comme l
a limite
de l
’aire de répartition
d

espèce
s alpines
, il abrite
aussi
ses lignées

propres
.

Mes résultats ne permettent
par contre
pas de tirer de conclusion
définitive
quant au vecteur de dispersion privilégié au sein de
mes taxons, bien que les
bassins
-
versants
ne semblent pas jouer de r
ôle.





47


Volet écologique

Ce volet s’appréhende plus comme une démarche exploratoire en raison de
nombreux biais

:



L’é
chantillonnage

non quantitatif
peut induire des erreurs au niveau des

richesses spécifiques considérées

; la présence d’espèces touristes
n’interagissant pas vraiment avec le milieu ou les autres espèces
peut
biaiser les indices

d’agrégation