εκπαι∆ευτικο – ∆ι∆ακτικο σεναριο

nuthookransomBiotechnology

Dec 10, 2012 (4 years and 9 months ago)

489 views


1








ιδακτικό Σενάριο:
ιατήρηση και συνέχεια της ζωής –
Γενετική Μηχανική και Βιοτεχνολογία






Κερα!άρης Κων/νος
ρ. Βιολόγος





Κέντρο Εκπαιδευτικής Στήριξης
Παλλήνης
Επιμορφωτές: Δελής Αθανάσιος – Παπαμιχάλης Κων/νος


2012


2

ΕΚΠΑΙΕΥΤΙΚΟ – ΙΑΚΤΙΚΟ ΣΕΝΑΡΙΟ

1. Τίτλος
ΙΑΤΗΡΗΣΗ ΚΑΙ ΣΥΝΕΧΕΙΑ ΤΗΣ Ζ1ΗΣ – ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ ΚΑΙ
ΒΙΟΤΕΧΝΟΛΟΓΙΑ

2. Ε!πλεκό!ενες γνωστικές περιοχές
Βιολογία, Χη εία, Περιβαλλοντική εκπαίδευση, Βιοτεχνολογία, Κληρονο ικότητα,
Ασθένειες.
ιδακτική ενότητα: Βιολογία Γ΄ τάξης Γυ!νασίου
Κεφ. 5
ο
: ιατήρηση και συνέχεια της ζωής –
Κεφ. 6
ο
: Γενετική Μηχανική και Βιοτεχνολογία

3. Γνώσεις και αντιλήψεις των !αθητών
Γνώσεις
Οι αθητές της Γ΄ τάξης έχουν ήδη διδαχτεί: τα όρια της ζωής – ανόργανες και
οργανικές ενώσεις (1.1), το κύτταρο: η ονάδα ζωής (1.2), τη δο ή του προκαρυωτικού
κυττάρου, την έννοια της διαφοροποίησης και τα είδη των ζωικών ιστών (1.3), ασθένειες –
παθογόνοι ικροοργανισ οί (4.2) και τη δο ή των νουκλεϊκών οξέων (5.2), που θεωρήθηκε
σκόπι ο να διδαχθεί αζί ε τα βιο όρια. Οι αθητές είναι σκόπι ο να θυ ηθούν έννοιες από
το αναπαραγωγικό σύστη α που διδάχτηκαν στην Α΄ τάξη, όπως: γα έτες, γονι οποίηση στα
φυτά και στα ζώα, ζυγωτό, ε βρυϊκή ανάπτυξη και γενικότερα να έχουν γνώση της
οργάνωσης και λειτουργίας των συστη άτων, έχοντας κατανοήσει ότι για τη λειτουργία του
κυττάρου και του οργανισ ού το κύριο ρόλο αναλα βάνουν οι πρωτεΐνες. Για την
διδασκαλία του 5
ου
και 6
ου
κεφαλαίου είναι απαραίτητες οι προηγού ενες γνώσεις, αφού
αποτελούν την βάση για την περαιτέρω ανάπτυξη και ε βάθυνση του γνωστικού
αντικει ένου.
Εναλλακτικές ιδέες (προκαταλήψεις, παρανοήσεις, αντιστάσεις, κλπ).

Κατά τη διδασκαλία και εφαρ ογή του σεναρίου θα πρέπει να λάβου ε υπόψη ότι ορισ ένοι
αθητές: ⇒ Θεωρούν ότι το DNA περιέχεται όνο σε ορισ ένα κύτταρα.
⇒ Έχουν ακούσει τις λέξεις «γονίδια» και «χρω οσώ ατα», αλλά αγνοούν τη φύση και τη
λειτουργία τους. Ορισ ένοι αθητές συνδέουν τα γονίδια ε την κληρονο ικότητα.
⇒ ?εν κατανοούν ότι η εκδήλωση των χαρακτηριστικών είναι αποτέλεσ α της επίδρασης
γενετικού υλικού και του περιβάλλοντος.
⇒ Παρόλο που κατανοούν ότι οι γα έτες είναι το ωάριο και το σπερ ατοζωάριο, αγνοούν
τον τρόπο που καθορίζεται το φύλο. Επίσης, αν και το έχουν διδαχτεί, αντιστέκονται στο
να αποδεχτούν ότι και τα φυτά διαθέτουν γα έτες και ότι γίνεται γονι οποίηση και
δη ιουργείται έ βρυο.
⇒ Έχουν την αντίληψη ότι τα γενετικό υλικό είναι ένα ενιαίο όριο στα ευκαρυωτικά
κύτταρα και δυσκολεύονται να κατανοήσουν τη δο ή του και το ρόλο των πρωτεϊνών
στη δια όρφωσή του.
⇒ Οι λιγοστές γνώσεις χη είας των αθητών κάνει δύσκολη τη κατανόηση των εννοιών:
χη ικός δεσ ός, δεσ ός υδρογόνου, χη ική ένωση, αζωτούχος βάση.
⇒ Κατά τη διδασκαλία των επι έρους ενοτήτων οι αθητές δυσκολεύονται να
κατανοήσουν ότι το χρω όσω α αποτελείται από ένα ή δύο όρια DNA και το κάθε
όριο αντιστοιχεί στη χρω ατίδα.
⇒ Οι αθητές θεωρούν ότι τα χρω οσώ ατα είναι πάντα ορατά ε το οπτικό ικροσκόπιο
και ότι τα χρω οσώ ατα διπλασιάζονται κατά την αντιγραφή.

3

⇒ Θεωρούν την αντιγραφή του DNA προϋπόθεση για τη εταγραφή και τη ετάφραση.
⇒ Θεωρούν ότι το RNA είναι «έτοι ο» και όχι ότι συντίθεται κατά τη διαδικασία της
εταγραφής.
⇒ ?εν συ περιλα βάνουν τα ένζυ α και την ενέργεια ανά εσα στους παράγοντες που είναι
απαραίτητοι κατά τις διαδικασίες της αντιγραφής, της εταγραφής και της ετάφρασης.
⇒ ?εν πορούν να κατανοήσουν ότι η γενετική πληροφορία καθορίζεται από την
αλληλουχία αζωτούχων βάσεων και ότι η έκφραση της γενετικής πληροφορίας
προαπαιτεί την ύπαρξη του γενετικού κώδικα, προκει ένου να δη ιουργηθούν οι
πρωτεΐνες, ε καθορισ ένη ακολουθία α ινοξέων.
⇒ Θεωρούν ότι σε κάθε άτο ο υπάρχουν πάρα πολλά αλληλό ορφα για κάθε
χαρακτηριστικό.
⇒ Ορίζουν ως επικρατές το αλληλό ορφο που εκδηλώνεται, γενικά, στους απογόνους.
Επίσης, θεωρούν ότι οι σχέση εταξύ των αλληλο όρφων είναι πάντα επικρατήC
υπολειπό ενο.
⇒ Χαρακτηρίζουν γενικά το άτο ο ως ο όζυγο ή ετερόζυγο, χωρίς να αναφέρονται σε
συγκεκρι ένα αλληλό ορφα.
⇒ Πιστεύουν ότι η ποικιλο ορφία οφείλεται περισσότερο στις περιβαλλοντικές συνθήκες
παρά στην κληρονο ικότητα,
⇒ Αποδίδουν την κληρονο ικότητα σε σω ατικούς παράγοντες, όπως το αί α ή ο
εγκέφαλος.
⇒ Θεωρούν ότι τα κορίτσια « οιάζουν» ε τη ητέρα και τα αγόρια ε τον πατέρα.
⇒ Συγχέουν τις διαδικασίες της κυτταρικής διαίρεσης, της κυτταρικής αύξησης και της
κυτταρικής διαφοροποίησης.
⇒ ?εν αντιλα βάνονται ότι κατά την ανάπτυξη τα κύτταρα διαιρούνται, αυξάνεται ο
αριθ ός τους και διαφοροποιούνται. Επίσης, θεωρούν ότι στους ενήλικες η κυτταρική
διαίρεση αποτελεί λειτουργία του κυττάρου που γίνεται συνέχεια, όπως επίσης και η
αντιγραφή, εταγραφή και ετάφραση του γενετικού υλικού.
⇒ Θεωρούν ότι η αντιγραφή του DNA γίνεται κατά την κυτταρική διαίρεση.
⇒ Συγχέουν τις έννοιες χρω ατίδα – χρω όσω α. ?εν πορούν να αντιληφθούν ότι το
χρω όσω α πορεί να αντιπροσωπεύεται και από ία χρω ατίδα , που αποτελεί ένα
όριο DNA.
⇒ ?εν αντιλα βάνονται ότι η δεύτερη χρω ατίδα στο χρω όσω α είναι αποτέλεσ α της
αντιγραφής του DNA.
⇒ Πιστεύουν ότι τα κύτταρα που προκύπτουν από την πρώτη ειωτική διαίρεση είναι
διπλοειδή.
⇒ Θεωρούν ότι τα φυλετικά χρω οσώ ατα βρίσκονται όνο στους γα έτες και όχι στα
σω ατικά κύτταρα.
⇒ Θεωρούν ότι τα σπερ ατοζωάρια έχουν όνο το Y χρω όσω α.
⇒ ?εν συνειδητοποιούν την ύπαρξη του τυχαίου στην κληρονο ικότητα, παρόλο που
υπολογίζουν τις πιθανότητες στα αποτελέσ ατα.
⇒ Συνδέουν τις εταλλάξεις όνο ε ασθένειες και όχι ε την ποικιλο ορφία στους
οργανισ ούς.
⇒ Συνδέουν τις εταλλάξεις ε την κληρονο ικότητα και τους γα έτες και όχι ε τα
σω ατικά κύτταρα και ασθένειες, όπως ο καρκίνος.
⇒ Αντιστέκονται στην ιδέα ότι προϊόντα όπως το ψω ί, το γιαούρτι κλπ αποτελούν
προϊόντα εταβολισ ού ικροοργανισ ών.
⇒ Θεωρούν ότι όλοι οι ικροοργανισ οί είναι βλαβεροί για τον άνθρωπο και προκαλούν
ασθένειες.
⇒ Θεωρούν ότι στους γενετικά τροποποιη ένους οργανισ ούς έχουν εταφερθεί
αλληλό ορφα γονίδια του οργανισ ού.
⇒ ?εν συνειδητοποιούν γιατί ο κλωνοποιη ένος οργανισ ός οιάζει ε το δότη του πυρήνα
και όχι ε τη «θετή» ητέρα ή τον δότη του ωαρίου.


4

4. Στόχοι

Γνωστικοί στόχοι
￿ Να προσδιορίζουν οι αθητές τη σχέση του γενετικού υλικού ε τα ιδιαίτερα
χαρακτηριστικά των οργανισ ών.
￿ Να αντιλα βάνονται ότι τα χρω οσώ ατα αποτελούν όρια DNA που
αντιγράφονται στη εσόφαση του κυτταρικού κύκλου και γίνονται ορατά κατά την
κυτταρική διαίρεση περιλα βάνοντας δύο χρω ατίδες (δύο όρια DNA) ενω ένες
στο κεντρο ερίδιο.
￿ Οι αθητές να πορούν να περιγράφουν τη δο ή της χρω ατίνης κατά τη εσόφαση
και τη διαδικασία συ πύκνωσής της για τη δη ιουργία του χρω οσώ ατος.
￿ Να κατανοούν οι αθητές την δη ιουργία και την χρησι ότητα του καρυότυπου.
￿ Να περιγράφουν συνοπτικά τον τρόπο οργάνωσης, αποθήκευσης, διατήρησης,
εταβίβασης και έκφρασης της γενετικής πληροφορίας.
￿ Οι αθητές να ονο άζουν και να περιγράφουν τους ηχανισ ούς της κυτταρικής
διαίρεσης.
￿ Να συσχετίζουν την ίτωση ε την διαίρεση των σω ατικών κυττάρων κατά την
ανάπτυξη, την επούλωση τραυ άτων, την ανάπλαση των ιστών, την αύξηση των
λευκών αι οσφαιρίων για την αντι ετώπιση των ασθενειών και την είωση ε τη
δη ιουργία των γα ετών και την αναπαραγωγή.
￿ Οι αθητές να διακρίνουν τις διαφορές της ίτωσης και της είωσης.
￿ Να συσχετίζουν τη γενετική ποικιλότητα των οργανισ ών ε την ύπαρξη
διαφορετικών αλληλο όρφων.
￿ Να ορίζουν την κληρονο ικότητα και να διακρίνουν τα χαρακτηριστικά των
οργανισ ών σε κληρονο ικά και επίκτητα.
￿ Οι αθητές να αναγνωρίζουν τις εταλλάξεις ως ένα ηχανισ ό παραγωγής
γενετικής ποικιλο ορφίας.
￿ Να διατυπώνουν τους νό ους του Μέντελ και να εξηγούν τον τρόπο κληρονό ησης
διαφόρων χαρακτηριστικών.
￿ Να επιλύουν απλά προβλή ατα ονοϋβριδισ ού.
￿ Οι αθητές να περιγράφουν τα βασικά στάδια της διαδικασίας εισαγωγής ξένου
γενετικού υλικού στο γενετικό υλικό βακτηρίων και να κατανοούν την
αναγκαιότητα αυτής της εθοδολογίας.
￿ Να αναφέρουν και να περιγράφουν σε γενικές γρα ές, τον τρόπο αξιοποίησης της
δράσης ικροοργανισ ών στην παραγωγή τροφί ων (ψω ί, τυρί, πύρα, ξίδι) και να
συνδέει τις χρήσεις αυτές ε την απαρχή των βιοτεχνολογικών εφαρ ογών.
￿ Να αναφέρουν και να περιγράφουν σύγχρονες εφαρ ογές της βιοτεχνολογίας που
συ βάλλουν στη βελτίωση της ποιότητας ζωής του ανθρώπου.
￿ Να αιτιολογούν τους κινδύνους που απορρέουν από την αλόγιστη χρήση των
εθόδων της τεχνολογίας του ανασυνδυασ ένου DNA, για το περιβάλλον, την
βιοποικιλότητα, την κοινωνία.
￿ Οι αθητές να αντιλα βάνονται την αναγκαιότητα θέσπισης βιοηθικών κανόνων
που να διέπουν την εφαρ ογή της νέας τεχνολογίας, προκει ένου να εξασφαλιστεί η
χρήση της προς όφελος της κοινωνίας και του ανθρώπου.

Συναισθη!ατικοί
￿ Να αξιοποιήσουν οι αθητές την ο αδική συνεργασία.
￿ Να δραστηριοποιηθούν στη διερευνητική – βιω ατική άθηση.
￿ Να αναπτύξουν αυτενέργεια και να άθουν να οικοδο ούν όνοι τους τη γνώση.
￿ Να ενεργοποιήσουν, έσα από ε πειρίες και βιώ ατα, ατο ικές και κοινωνικές
αξίες και αρχές.


5

5. Λογισ!ικό – συνδυασ!ός λογισ!ικών

Για τη διεξαγωγή του σεναρίου χρησι οποιούνται περιβάλλοντα άθησης έσω
καθοδηγού ενης ανακάλυψης και διερεύνησης.
Όταν αναφερό αστε στα συστήατα καθοδηγούενης διδασκαλίας (Υπολογιστική
Υποστήριξη της ιδασκαλίας) εννοού ε κατά κανόνα τη βοήθεια προς το αθητευό ενο
ώστε να προσεγγίσει και να οικοδο ήσει ένα προκαθορισ ένο από το πρόγρα α σπουδών
σύνολο διδακτικών στόχων κάνοντας χρήση ειδικών εφαρ ογών λογισ ικού. Υπό το πρίσ α
αυτό, οι εφαρ ογές ΤΠΕ σχεδιάζονται και αναπτύσσονται ώστε να υποστηρίξουν και να
ενισχύσουν το διδακτικό έργο του εκπαιδευτικού. Με άλλα λόγια, αποτελούν ένα σύγχρονο
εποπτικό έσο διδασκαλίας σε διάφορα γνωστικά αντικεί ενα.
Όταν αναφερό αστε στα περιβάλλοντα άθησης έσω καθοδηγούενης ανακάλυψης
και διερεύνησης (Υπολογιστική Υποστήριξη της Μάθησης) εννοού ε κυρίως την ενίσχυση
του αθητευό ενου ώστε να αποκτήσει γνώσεις και να αναπτύξει δεξιότητες υψηλού
επιπέδου που θα τον καταστήσουν ικανό να αντεπεξέλθει στις διαρκώς εταβαλλό ενες και
ολοένα αυξανό ενες απαιτήσεις του σύγχρονου κόσ ου, κάνοντας χρήση εφαρ ογών
λογισ ικού και υλικού. Υπό το πρίσ α αυτό, οι εκπαιδευτικές εφαρ ογές των ΤΠΕ
σχεδιάζονται έτσι ώστε να υποστηρίζουν και να ενισχύουν το αθησιακό έργο του αθητή.
Συνεπώς, θεωρούνται ως εργαλεία που εν δυνά ει επεκτείνουν ή/και ενισχύουν τις γνωστικές
δεξιότητες των αθητών και για το λόγο αυτό ονο άζονται γνωστικά εργαλεία (cognitive
tools). Τα εργαλεία αυτά πορούν να χρησι οποιηθούν ε εγκάρσιο τρόπο σε διάφορα
γνωστικά αντικεί ενα.
Για την εφαρ ογή του σεναρίου χρησι οποιείται το εκπαιδευτικό λογισ ικό Βιολογία Α΄
και Γ΄ Γυ νασίου που έχει δη ιουργηθεί ε τις αρχές του συ περιφορισ ού (παρόλο που οι
θεωρίες του συ περιφορισ ού είναι σε υποχώρηση). Τα λογισ ικά καθοδήγησης,
διδασκαλίας (tutorials) και πρακτικής και εξάσκησης (drill and practice), κατά κανόνα
βασίζονται πάνω στις θεωρίες αυτές. Το λογισ ικό αυτό είναι κατάλληλο κυρίως για την
εξάσκηση δεξιοτήτων χα ηλού επιπέδου (όπως είναι η εκτέλεση πράξεων, η απο νη όνευση
κ.ά), για την αξιολόγηση των αθητών, για εποπτική διδασκαλία..
Ταυτόχρονα προετοι άστηκε ανά θε ατική ενότητα ια παρουσίαση ε χρήση του
λογισ ικού Office Microsoft Power Point, που αποτελεί βασικό εργαλείο εποπτικής
διδασκαλίας. Επιλέχτηκαν κατάλληλα βίντεο για κάθε θε ατική ενότητα που ενισχύουν τη
δυνατότητα κατανόησης από τους αθητές των κυτταρικών λειτουργιών.
Στο πλαίσιο της ολοκληρω ένης προσέγγισης των διδακτικών ενοτήτων εφαρ όστηκε
διαδικασία καθοδηγού ενης ανακάλυψης και δικτυακής αναζήτησης. Το εκπαιδευτικό υλικό
αναρτήθηκε στο διαδίκτυο, στο ιστολόγιο SCHOOL BIOLOGY στο σχολικό δίκτυο
(
http://blogs.sch.gr/kekbio/
). Οι αθητές ε τη χρήση φυλλο ετρητή (web browser),
κει ενογράφου, λογισ ικού παρουσιάσεων, λογισ ικού ανάκτησης και προβολής βίντεο,
ανακαλύπτουν το υλικό, το αξιολογούν, το οργανώνουν και το παρουσιάζουν στην τάξη. Η
ιδέα της σταδιακής ανακάλυψης της γνώσης αποτελεί ένα ιδιαίτερα ση αντικό κίνητρο για το
αθητή, τον οποίο ο εκπαιδευτικός πορεί να βοηθήσει ή και να καθοδηγήσει
(καθοδηγού ενη ανακάλυψη). Σύ φωνα ε τις θεωρίες του Bruner, o εκπαιδευτικός έχει το
ρόλο του ε ψυχωτή, του καθοδηγητή στη διαδικασία της ανακάλυψης: ο αθητής έρχεται
αντι έτωπος ε προβλή ατα τα οποία καλείται να επιλύσει και ο εκπαιδευτικός τον
υποστηρίζει στην προσπάθεια του αυτή, την οποία ο αθητής ό ως πραγ ατοποιεί ε το δικό
του ρυθ ό και ε βάση τις δικές του αποφάσεις και επιλογές.



6









7

6. ιάρκεια
Ο χρόνος υλοποίησης του σεναρίου είναι 12 εβδο άδες ή 24 διδακτικές ώρες σε καθένα
από τα τ ή ατα της Γ΄ τάξης. Κάθε ία από τις επι έρους θε ατικές ενότητες διδάσκεται σε
2 ή 3 διδακτικές ώρες.

7. Οργάνωση τάξης & απαιτού!ενη υλικοτεχνική υποδο!ή

Οργάνωση τάξης

α) Σε κάθε τ ή α της Γ΄ τάξης οι αθητές χωρίστηκαν σε 3 ο άδες των 8 ατό ων, ε
βάση την επίδοσή τους και την δυνατότητά τους να συνεργαστούν, έτσι ώστε οι
συγκροτού ενες ο άδες να είναι ο οιογενείς και ισοδύνα ες. Ο χωρισ ός των αθητών σε
ο άδες δε ση αίνει αυτό ατα και τη δη ιουργική συνεργασία εταξύ των ελών κάθε
ο άδας. Η ανάθεση κοινού έργου στα έλη της ο άδας, η ανταλλαγή απόψεων και
πληροφοριών δεν αρκούν για να καταστήσουν αποτελεσ ατική την κατά ο άδες διδασκαλία.

β) Κάθε εβδο άδα οι αθητές των ο άδων συνεργάζονται και υλοποιούν την ίδια
θε ατική ενότητα, την οποία παρουσιάζει στην τάξη ένας αθητής που έχει επιλέξει να είναι
ο εκπρόσωπος της ο άδας για την συγκεκρι ένη θε ατική ενότητα. Κάθε αθητής είναι
υποχρεω ένος να αναλάβει την εκπροσώπηση της ο άδας σε όποια ενότητα επιλέξει. Οι
αθητές της ο άδας βοηθούν τον εκπρόσωπό τους και συνεργάζονται, έτσι ώστε η
παρουσίαση να διαθέτει πληρότητα και σαφήνεια. Οι αθητές πορούν να χρησι οποιούν
εποπτικό υλικό, διαφάνειες, βίντεο. Ο καθηγητής καθοδηγεί και εκ αιεύει τις πληροφορίες
έτσι ώστε να υλοποιούνται οι εκπαιδευτικοί στόχοι που έχουν τεθεί.

γ) Οι δύο ο άδες παρουσιάζουν την 1
η
διδακτική ώρα και η 3
η
ο άδα το πρώτο 20λεπτο
της 2
ης
διδακτικής ώρας. Οι αθητές το τελευταίο 20λεπτο της 2
ης
διδακτικής ώρας σε κάθε
θε ατική ενότητα απαντούν σε ερωτήσεις του φύλλου εργασίας – αξιολόγησης. Σε ορισ ένες
απαιτητικές και δύσκολες θε ατικές ενότητες απαιτείται και 3
η
διδακτική ώρα, όπου οι
αθητές ολοκληρώνουν τις δραστηριότητες στην τάξη. Για την αξιολόγηση του κάθε αθητή
από τον καθηγητή συνεκτι ούνται η ικανότητά του να συνεργάζεται ε την ο άδα, η
σαφήνεια και η πληρότητα της παρουσίασης και η γραπτή επίδοσή του στο φύλλο
αξιολόγησης. Επιπλέον, στην διαδικασία αυτή οι ίδιοι αθητές αξιολογούν τους συ αθητές
τους και την ο άδα (φύλλα αξιολόγησης ο άδας – αθητών).

δ) Μετά την ολοκλήρωση της παρουσίασης των θε ατικών ενοτήτων οι ο άδες είναι
υποχρεω ένες σε χρονικό διάστη α 2 εβδο άδων να προετοι άσουν την παρουσίαση σε
PowerPoint και σε κεί ενο Word της εργασίας ε θέ α: «Εφαρ ογές της Βιοτεχνολογίας,
ελλοντικές προοπτικές και βιοηθική». Ο κάθε αθητής της ο άδας αναλα βάνει
συγκεκρι ένη υποθε ατική ενότητα, που καθορίζεται από τους ίδιους τους αθητές. Την
εργασία αυτή θα παρουσιάσουν οι ο άδες στην Τάξη σε τρεις διδακτικές ώρες ( ία διδακτική
ώρα/ο άδα).
Απαιτού!ενη υλικοτεχνική υποδο!ή

Για την διεξαγωγή του σεναρίου απαιτούνται τουλάχιστον ηλεκτρονικός υπολογιστής ε
τα αντίστοιχα λογισ ικά και σύνδεση στο διαδίκτυο και προβολικό ηχάνη α (projector) και
οθόνη προβολής. Στην ιδανική περίπτωση, προκει ένου να κινητοποιούνται όλοι οι αθητές
και να γίνεται ουσιαστική συ ετοχική εργασία στην τάξη, απαιτούνται υπολογιστές για
κάθε αθητή ή έστω υπολογιστής για κάθε ο άδα αθητών.


8

8. Περιγραφή και αιτιολόγηση του σεναρίου
Βή!ατα διεξαγωγής του σεναρίου
α) Ορισ ός επι έρους θε ατικών ενοτήτων
1
η
: Το γενετικό υλικό και η οργάνωσή του σε χρω οσώ ατα
2
η
: Η ροή της γενετικής πληροφορίας – Αντιγραφή του DNA.
3
η
: Μεταγραφή C Μετάφραση. Έκφραση της γενετικής πληροφορίας.
4
η
: Κυτταρική διαίρεση. Μίτωση – Μείωση
5
η
: Αλληλό ορφα γονίδια. Κληρονο ικότητα. Οι νό οι του Μέντελ.
6
η
: Μεταλλάξεις
7
η
: Γενετική ηχανική. Εφαρ ογές της Βιοτεχνολογίας στη Γεωργία C Κτηνοτροφία
8
η
: Κλωνοποίηση C Γονιδιακή θεραπεία – Εφαρ ογές στην Ιατρική. Βιοηθική.

β) Χωρισ ός των αθητών σε ο άδες και ανάρτηση της λίστας στην τάξη προκει ένου ο
κάθε αθητής να επιλέξει την θε ατική ενότητα για την οποία θα εκπροσωπήσει την ο άδα.

γ) ?ίνονται γραπτές οδηγίες προς τους αθητές σχετικά ε τη διεξαγωγή του σεναρίου και
προφορικές διευκρινήσεις για το ρόλο τους και τη λειτουργία των ο άδων. Η ο άδα
συνεργάζεται στην τάξη, εφόσον υπάρχει δυνατότητα χρησι οποίησης υπολογιστή για την
επεξεργασία του υλικού. Σε κάθε περίπτωση ό ως γίνεται ανταλλαγή υλικού και
δια ορφώνονται συνθήκες αλληλοβοήθειας προκει ένου ο εκπρόσωπος της ο άδας να
παρουσιάσει την θε ατική ενότητα.
δ) Ο καθηγητής επιλέγει το υλικό και το αναρτά στο διαδίκτυο. Ταυτόχρονα δίνονται οδηγίες
για την χρησι οποίησή του από τους αθητές. Πριν την διδασκαλία της κάθε θε ατικής
ενότητας δίνεται στους αθητές το φύλλο εργασίας, που περιλα βάνει τους στόχους, τα
έσα, τον τρόπο διδακτικής προετοι ασίας των αθητών, θεωρητική προσέγγιση και
δραστηριότητες στην τάξη.
ε) Ο αθητής, εκπρόσωπος της ο άδας, παρουσιάζει τη θε ατική ενότητα ε τον τρόπο που
έχει επιλέξει. Οι υπόλοιποι αθητές της ίδιας ο άδας συ πληρώνουν, διορθώνουν, επεξηγούν
και απαντούν στα ερωτή ατα που ανακύπτουν. Ο καθηγητής καθοδηγεί την διαδικασία και
προσπαθεί να εκ αιεύσει τις απαντήσεις. Ταυτόχρονα, χρησι οποιεί το εκπαιδευτικό υλικό,
τις διαφάνειες, τα βίντεο και το λογισ ικό της Βιολογίας. Η διαδικασία αυτή απαιτεί 2 ή 3
διδακτικές ώρες, όπου οι αθητές εκπρόσωποι των τριών ο άδων παρουσιάζουν την ίδια
θε ατική ενότητα, έτσι ώστε ε την επανάληψη των εννοιών και την εκτέλεση των
δραστηριοτήτων στην τάξη να οδηγού αστε στη άθηση.

στ) Οι αθητές συ πληρώνουν το φύλλο αξιολόγησης της κάθε θε ατικής ενότητας ε τρόπο
που επιλέγει ο καθηγητής. Είναι σκόπι ο, προκει ένου να υπάρχει αλληλεπίδραση των
αθητών, το φύλλο εργασίας να συ πληρώνεται έχοντας οι αθητές τη δυνατότητα
ελεύθερης πρόσβασης στο σχολικό βιβλίο και στα φύλλα εργασίας.

Αιτιολόγηση και τεκ!ηρίωση των διδακτικών βη!άτων του σεναρίου και
παιδαγωγική αξία της χρήσης ΤΠΕ

α) Συγκρότηση ο!άδων
Οι σύγχρονες θεωρίες άθησης, που αποδίδουν εγάλη ση ασία στον
κοινωνικοπολιτισ ικό παράγοντα, συνηγορούν υπέρ της οργάνωσης αθη άτων στα οποία
να ευνοείται η κοινωνική αλληλεπίδραση και η συνεργατική, ο αδική άθηση. Οι
ο αδοσυνεργατικές έθοδοι φαίνεται να προσφέρουν πολλά διδακτικά πλεονεκτή ατα. Η

9

εκτέλεση ενός σχεδίου συνεργατικής έρευνας, όπως αυτή που επιχειρείται στο συγκεκρι ένο
σενάριο, απαιτεί ερικά απαραίτητα βή ατα:
♦ επιλογή θέ ατος,
♦ συγκεκρι ενοποίηση των στόχων,
♦ συνεργατικός σχεδιασ ός,
♦ αναζήτηση πηγών,
♦ εκτέλεση,
♦ παρουσίαση του τελικού προϊόντος,
♦ αξιολόγηση.
?η ιουργείται έτσι περιβάλλον άθησης ιδεώδη για την αυτοκατευθυνό ενη διερεύνηση.

β) Χρήση του λογισ!ικού Βιολογίας, παρουσίαση διαφανειών και προβολή βίντεο G
Συ!περιφοριστική προσέγγιση.
Το συγκεκρι ένο λογισ ικό έχει αναπτυχθεί ε τις αρχές του συ περιφορισ ού. Κάθε
είδος άθησης, κατά τους συ περιφοριστές, όσο πολύπλοκη και αν είναι, πορεί πάντοτε να
αναλυθεί σε στοιχειωδέστερα τ ή ατα, τα οποία ε τη σειρά τους πορούν να αναλυθούν σε
ακό η πιο απλά κ.ο.κ. έχρις ότου η προς ετάδοση γνώση πορεί να «αποσυναρ ολογηθεί»
σε τ ή ατα απλά, ικρά, τα οποία το άτο ο πορεί εύκολα να άθει. Η γνώση λοιπόν είναι
ια οντότητα η οποία πορεί να εταδοθεί. Το άθη α που βασίζεται στο συ περιφορισ ό
προϋποθέτει βέβαια την ενεργή συ ετοχή του αθητή. Η προς διδασκαλία ύλη αναλύεται σε
επι έρους τ ή ατα, τα οποία διδάσκονται ε βαθ ιαία πρόοδο από τα πλέον απλά τ ή ατα
της ύλης προς τα πλέον σύνθετα και δυσνόητα. Στα αθή ατα αυτά, στις απαντήσεις των
αθητών, πρέπει να υπάρχει ταχεία ανατροφοδότηση – θετική ή αρνητική, ανάλογα ε την
απάντηση. Στην διεξαγωγή του σεναρίου αυτή η προσέγγιση γίνεται προσπάθεια να
συνδυαστεί ε τις εσωτερικές γνωστικές διαδικασίες του αθητή, έσα από τις διαδικασίες
ενεργητικής συ ετοχής και διερευνητικής, ανακαλυπτικής συ ετοχής των αθητών. Το
συ περιφοριστικό οντέλο που αποδέχεται τις γνωστικές διαδικασίες και τον ενεργό ρόλο
του αθητή στη άθηση αποτελεί ένα σύγχρονο ρεύ α που αναφέρεται ως
νεοσυ περιφορισ ός ή γνωστικός συ περιφορισ ός ή σκεπτό ενος συ περιφορισ ός. Η
διαφοροποίηση των απαντήσεων και των στάσεων του καθενός οφείλεται στα κριτήρια που ο
καθένας έχει. Και τα κριτήρια ό ως αυτά είναι αποτέλεσ α της άθησης, στην οποία C
βεβαίωςC επιδρά και η γονιδιακή κληρονο ικότητα. Η κατ' εξοχήν αντιπροσωπευτική θεωρία
του νεοσυ περιφορισ ού είναι το κοινωνικογνωστικό πρότυπο άθησης.
Σύ φωνα ε το οντέλο επεξεργασίας της πληροφορίας, η εικονική νή η ενισχύει τη
άθηση. Η θεωρία του δυαδικού κωδικού συστή ατος του Paivio προτείνει ότι η πληροφορία
κωδικοποιείται είτε στο λεκτικό κωδικό σύστη α, είτε στο εικονικό οπτικό σύστη α, είτε και
στα δύο κωδικά συστή ατα. Αν η πληροφορία κωδικοποιείται και στα δύο συστή ατα, όπως
στο σενάριο, τότε η νή η ενισχύεται.
γ) Αναζήτηση της πληροφορίας, παρουσίαση της θε!ατικής ενότητας από το !αθητή
και συνεργασία !έσα στην ο!άδα.
Πρόκειται για εφαρ ογή των γνωστικών θεωριών άθησης (εποικοδο ισ ός ή
κονστρουκτιβισ ός). Η άθηση στις θεωρίες αυτές δεν εταδίδεται, αλλά είναι ια
διαδικασία προσωπικής κατασκευής της γνώσης, η οποία εδράζεται πάνω σε προγενέστερες
γνώσεις (οι οποίες φυσικά τροποποιούνται κατάλληλα ώστε να συζευχθούν ε τη νέα
γνώση). Η άθηση απαιτεί δηλαδή την αναδιάταξη και αναδό ηση των νοητικών δο ών του
ατό ου, έτσι ώστε αυτές να προσαρ οστούν ε τη νέα γνώση, αλλά και να “προσαρ όσουν”
τη νέα γνώση στις υφιστά ενες νοητικές δο ές. Ο εποικοδο ισ ός του J. Piaget θεωρεί ότι η
ανάπτυξη της λογικής και επιστη ονικής σκέψης του παιδιού είναι ια εξελικτική διαδικασία
ε διάφορα στάδια. Ο J. Bruner πρότεινε ως βασική θεωρία για τη άθηση την ανακαλυπτική

10
άθηση. Οι αθητές ανακαλύπτουν τη γνώση (κανόνες, αρχές, ανάπτυξη δεξιοτήτων) έσα
από ανακαλυπτικές διαδικασίες – ε το πείρα α, τη δοκι ή, την επαλήθευση ή τη διάψευση.
Η σταδιακή ανακάλυψη των εσωτερικών δο ών, αρχών και νό ων που διέπουν ένα
φαινό ενο συντελούν στη βαθύτερη κατανόησή του από το αθητή. Η ιδέα της σταδιακής
ανακάλυψης της γνώσης πορεί να αποτελέσει ένα ιδιαίτερα ση αντικό κίνητρο για το
αθητή, τον οποίο ο εκπαιδευτικός πορεί να βοηθήσει ή και να καθοδηγήσει ακό η
(καθοδηγού ενη ανακάλυψη). Σύ φωνα ε τις θεωρίες του Bruner, o εκπαιδευτικός έχει το
ρόλο του ε ψυχωτή, του διευκολυντή, του καθοδηγητή στη διαδικασία της ανακάλυψης: ο
αθητής έρχεται αντι έτωπος ε προβλή ατα τα οποία καλείται να επιλύσει και ο
εκπαιδευτικός τον υποστηρίζει στην προσπάθεια του αυτή, την οποία ο αθητής ό ως
πραγ ατοποιεί ε το δικό του ρυθ ό και ε βάση τις δικές του αποφάσεις και επιλογές. Ο J.
Bruner, ε νεότερες θεωρίες του, έδωσε ιδιαίτερη βαρύτητα στον κοινωνιοπολιτισ ικό
παράγοντα, πλησιάζοντας έτσι τη σχολή των κοινωνιοπολιτισ ικών θεωριών άθησης. Στην
ίδια σχολή (των γνωστικών θεωριών άθησης) εντάσσονται και άλλες θεωρίες, όπως η
θεωρία της επεξεργασίας της πληροφορίας, και γενικότερα όλες οι νεότερες απόψεις που
στηρίζονται στις σύγχρονες προόδους της Βιολογίας και της νευροφυσιολογίας.
Οι θεωρίες της δραστηριότητας (activity theory) και οι θεωρίες της εγκαθιδρυ ένης
άθησης και της κατανε η ένης νόησης (situated cognition, distributed cognition) είναι
νεότερες θεωρίες, οι οποίες επίσης εντάσσονται στη γενικότερη ο άδα των
κοινωνιοπολιτισ ικών και κοινωνιογνωστικών θεωριών. Είναι σαφές ότι οι
κοινωνιοπολιτισ ικές θεωρίες υποστηρίζουν τη συνεργατική άθηση σε όλες τις ορφές της
και επο ένως ένα άθη α οργανω ένο έτσι ώστε να λα βάνει υπόψή του τις θεωρίες αυτές
πρέπει να είναι προσεκτικά σχεδιασ ένο, έτσι ώστε να ενθαρρύνει τη συνεργασία εταξύ των
αθητών και γενικότερα την κοινωνική αλληλεπίδραση. Ο καθηγητής έχει καθήκον να αντλεί
ιδέες, εθόδους και στρατηγικές έσα από ένα ευρύ ρεπερτόριο διδακτικών προσεγγίσεων
και να διαλέγει κάθε φορά αυτές που θα ταιριάζουν στις ιδιαιτερότητες και ιδιο ορφίες της
κάθε περίστασης. Καλή έθοδος διδασκαλίας δε είναι εκείνη που θα γε ίσει το νου ε
γνώσεις, αλλά εκείνη που θα πορέσει να θέσει σε ενέργεια τις πνευ ατικές δυνά εις των
αθητών για την απόκτηση νέων γνώσεων.
Στα βασικά στάδια του αθησιακού οντέλου του συνεργατικού εποικοδο ισ ού
( αθησιακό οντέλο των 5Ε) περιλα βάνονται τα εξής:
o Ε πλοκή
των αθητών/τριών στο διδακτικό στόχο,
o Εξερεύνηση
από τους αθητές/τριες του διδακτικού στόχου και αναθεώρηση των
αρχικών εσφαλ ένων ή η ιτελών αντιλήψεών τους,
o Επεξήγηση
και διασαφήνιση από τους αθητές/τριες των νέων εννοιών και
διαδικασιών που κατακτήθηκαν,
o Επεξεργασία
και αξιοποίηση από τους αθητές/τριες των νέων εννοιών για την
ανάπτυξη γενικεύσεων και εφαρ ογών στην καθη ερινή ζωή,
o Εκτί ηση (αξιολόγηση)
από τον εκπαιδευτικό και τους αθητές/τριες των γνώσεων
και δεξιοτήτων που απέκτησαν.
δ) ιαδικτυακή αναζήτηση – Ιστοεξερεύνηση (webquest).

Βασική επιλογή στη διεξαγωγή του σεναρίου είναι η ιστοεξερεύνηση. Μία
ιστοεξερεύνηση αποτελεί ένα σενάριο κατευθυνό ενης διερεύνησης, που χρησι οποιεί πηγές
από το διαδίκτυο, στο πλαίσιο της εικονικής εκτέλεσης ιας αυθεντικής αποστολής από τους
αθητές. Στοχεύει να κινητοποιήσει τους αθητές να διερευνήσουν ανοιχτά ερωτή ατα, να
επεκτείνουν την προσωπική τους ε πειρία και να συ ετέχουν σε ο αδικές εργασίες
επιδιώκοντας παράλληλα στόχους αθησιακούς αλλά και την καλλιέργεια δεξιοτήτων
πληροφορικού γρα ατισ ού (Dodge 1997).
wς έσο λοιπόν το ?ιαδίκτυο είναι ένα αντίβαρο στο ονοπωλιακό καθεστώς των
παραδοσιακών έσων διδασκαλίας. Ελλοχεύει ό ως το πρόβλη α της ετουσίωσης της
πληροφορίας σε γνώση, αφού η υπερπροσφορά της δη ιουργεί εκτός από την ανάγκη
ύπαρξης νοητικών και τεχνικών εργαλείων για την ανάδυση, αξιολόγηση και αξιοποίηση της
πληροφορίας, ια σειρά παράπλευρων συ πτω άτων (information anxiety) που εκφράζονται

11
ως αίσθηση ανικανοποίητου, αδυνα ία συγκέντρωσης, έλλειψη ενδιαφέροντος, αποστροφή
για το διάβασ α, επιφανειακή γνώση.
Η εποικοδο ιστική προσέγγιση της γνώσης αποτελεί το συνδετικό ιστό ενός
ε πλουτισ ένου αθησιακού περιβάλλοντος, όπου η εξατο ικευ ένη διδασκαλία, η ενεργός
πολυαισθητηριακή συ ετοχή και η συνεργατικότητα, αναδεικνύονται ε τον πλέον
ε φατικό τρόπο ε τη χρήση κατάλληλα δο η ένων εφαρ ογών όπως είναι ένα WebQuest.
Μια %ικτυακή Αποστολή(WebQuest) επιδιώκει την ανάδειξη:
• Της κριτικήςCστοχαστικής σκέψης
• Της δυνατότητας επίλυσης προβλη άτων
• Της συνεργατικότητας, της αλληλεγγύης, του ο αδικού πνεύ ατος
• Της κοινωνικοποίησης, της κατανόησης της διαφορετικότητας και της
πολυπολιτισ ικότητας
• Της περιβαλλοντικής συνείδησης και
• Της διαθε ατικής και ολικής προσέγγισης των γνωστικών αντικει ένων.
Επιπλέον δύο ση αντικές αρχές που κρίνουν την επιτυχία ιας δικτυακής αποστολής
είναι:
• η ενεργός συ ετοχή των αθητών στη αθησιακή διαδικασία και
• η προκαθορισ ένη έθοδος ε την οποία οι αθητές καθοδηγούνται προς την
ερευνητική διαδικασίας
Οι ?ικτυακές Αποστολές χρησι οποιούν την υπάρχουσα ε πειρία των αθητών στη
διαδικασία εξερεύνησης των πηγών, καθώς και στην ανάδυση, ανάλυση, αξιολόγηση και
χρήση των πληροφοριών του ?ιαδικτύου. Κινητοποιούν ταυτόχρονα και αναδεικνύουν νέες
δεξιότητες επίλυσης προβλη άτων που δε στηρίζονται στην απο νη όνευση αλλά στην
ανάπτυξη της κριτικής σκέψης.

ε) ιδακτική επανάληψη της θε!ατικής ενότητας από τις διαφορετικές ο!άδες.

Η διδακτική αυτή προσέγγιση στα πλαίσια της διεξαγωγής του σεναρίου, έχει τη βάση της
στο οντέλο επεξεργασίας της πληροφορίας. Το οντέλο επεξεργασίας πληροφοριών
αποτελεί ουσιαστικά ένα οντέλο της ανθρώπινης νή ης. Τα βασικά δο ικά έρη του
συστή ατος είναι: τα νη ονικά αποθέ ατα και ονο άζονται αισθητηριακή συγκράτηση ή
αισθητηριακή νή η, βραχύχρονη νή η η οποία περιλα βάνει και τη νή η εργασίας ή
ενεργό νή η και τη ακρόχρονη νή η. Οι διαδικασίες που πλαισιώνουν όλο το νη ονικό
σύστη α αναφέρονται στην αντίληψη, στην προσοχή, στην κωδικοποίηση, στη συγκράτηση
και στην ανάσυρση των πληροφοριακών ερεθισ άτων. Η λειτουργία αυτών των διαδικασιών
ελέγχου στηρίζεται στις εταγνωστικές ικανότητες του ατό ου.




12
Στο πλαίσιο του Μοντέλου Επεξεργασίας των Πληροφοριών ένας από τους βασικούς
στόχους του εκπαιδευτικού είναι να βοηθήσει τους αθητές να προσλα βάνουν να
συγκρατούν και να ενθυ ούνται ευκολότερα τις πληροφορίες C γνώσεις. Για τη διευκόλυνση
της αθησιακής διαδικασίας εφαρ όζου ε ερικές εκπαιδευτικό Cδιδακτικές αρχές για τη
βελτίωση της νη ονικής διαδικασίας.
1. Παροχή εκτετα ένων γενικών και εξειδικευ ένων γνώσεων.
2. Οι νέες πληροφορίες και γνώσεις πρέπει να έχουν νόη α και ση ασία και να
συνδέονται ε τις ήδη υπάρχουσες αρχειοθετη ένες γνώσεις.
3. Ενεργητική συ ετοχή του αθητή.
4. Παραγωγή της επεξεργασ ένης πληροφορίας.
5. Συχνή αξιολόγηση της επίδοσης .
6. Η υπερ άθηση
7. Χρησι ότητα της νέας γνώσης.
8. Σύνδεση της νέας γνώσης ε καταστάσεις εφαρ ογής.
9. Ανάπτυξη ετα νη ονικών δεξιοτήτων.
10. Η ελέτη κι εξάσκηση είναι αποτελεσ ατικότερες όταν γίνονται ε κατατ η ένο
τρόπο.
11. Ανάπτυξη και διατήρηση της προσοχής.
12. Χρήση κατάλληλων τεχνικών επανάληψης.
13. Οργάνωση της νέας γνώσης.

Η νή η έχει αποφασιστικό ρόλο στο οντέλο HIPM. ?ιακρίνονται τρία είδη νή ης:
Αισθητήρια !νή!η,
?ιαφορετική για κάθε αισθητήριο αγωγό (ακουστική νή η, οπτική
νή η κλπ), η οποία συντηρεί την πληροφορία της ερικά δέκατα του
δευτερολέπτου.
Βραχύβια !νή!η ή !νή!η εργασίας
Σε αυτή συντηρείται η πληροφορία για ερικά δευτερόλεπτα. Σχετικά
πειρά ατα, έχουν αποδείξει ότι τα αντικεί ενα που πορούν να
παρα είνουν στην βραχύβια νή η είναι 7 +/C 2. Τα νη ονεύσι α
στοιχεία είναι πακέτα πληροφοριών το έγεθος των οποίων βρίσκεται
στον έλεγχο του αθητευό ενου. Τα νη ονεύσι α στοιχεία πορεί να
είναι ένας όνος αριθ ός ή ένα όνο γρά α ή ο αδοποιη ένα κο άτια
πληροφοριών.
Μακροχρόνια !νή!η
Σε αυτή συντηρείται η πληροφορία για εγάλο χρονικό διάστη α και
στην οποία φυλάσσονται οι γνώσεις ε πειρίες ας κλπ.

Η νή η εργασίας είναι το τ ή α του εγκεφάλου που συγκρατεί
, οργανώνει
,
επεξεργάζεται
και τέλος κωδικοποιεί
σε ένα σχή α τη νέα πληροφορία πριν αυτή
καταγραφεί στη ακροπρόθεσ η νή η για ελλοντική χρήση (Baddeley, 1986).

13
Τα χαρακτηριστικά της νή ης εργασίας είναι: η !ικρή χωρητικότητα και η !ικρή
διάρκεια. Στην ηλικία των 14 ετών η χωρητικότητα φτάνει τα 5 τε άχια (chunks). Ο όρος
chunks αναφέρεται στην εγαλύτερη ονάδα πληροφορίας που είναι φορτισ ένη ε νόη α
και που πορεί να τοποθετηθεί στην βραχυπρόθεσ η νή η.
Επίσης, χωρίς συνεχή επανάληψη τα δεδο ένα πορούν να παρα είνουν στη
βραχυπρόθεσ η νή η για περισσότερο χρόνο.
Η ?ιάρκεια της εξαρτάται από την ηλικία:
Πριν την εφηβεία – 5 – 10 min.
Έφηβοι και Μεγάλοι – 10 – 20 min
Κούραση ή βαρετό υλικό οδηγούν στο να χάνου ε την εστίασηC εκτός
και αν υπάρξει αλλαγή του τρόπου που το άτο ο αντι ετωπίζει το υλικό.
Επο ένως, οι πληροφορίες εταφέρονται από τους αισθητηριακούς καταγραφείς στην
βραχυπρόθεσ η νή η έσω της προσοχής και παρα ένουν στην βραχυπρόθεσ η νή η ε
την επανάληψη. Ό ως για να εταφερθεί η πληροφορία από την βραχυπρόθεσ η νή η
στην ακροπρόθεσ η νή η χρειάζεται συγκέντρωση. ?εν γίνεται ε απλή επανάληψη αλλά
απαιτεί κωδικοποίηση, δηλαδή ετασχη ατισ ό της πληροφορίας και αναπαράσταση ε
έναν άλλο τρόπο. Στη διεξαγωγή του σεναρίου γίνονται επαναλήψεις και καταβάλλεται
προσπάθεια κωδικοποίησης.

στ) Συ!πλήρωση του φύλλου αξιολόγησης.

Η αξιολόγηση είναι απαραίτητη για την ανατροφοδότηση και εφαρ όζεται σε διάφορες
φάσεις κατά την διεξαγωγή του σεναρίου.
Οι Το!είς Αξιολόγησης
Α. Γνώση και κατανόηση
Β. Εφαρ ογή των γνώσεων και της κατανόησης, ανάλυση και εκτί ηση
Γ. ?εξιότητες ?ιερεύνησης
?. Συνολική δράση C εξέλιξη της προσωπικότητας του/της αθητή/ αθήτριας

Είδη αξιολόγησης !αθητών
G Αρχική διαγνωστική αξιολόγηση
• Γίνεται στην αρχή του αθή ατος και σκοπό έχει τον εντοπισ ό των
αρχικών/εναλλακτικών ιδεών (παρανοήσεων) και δυσκολιών που πιθανόν να
αντι ετωπίζουν οι αθητές.
• Βοηθά τον εκπαιδευτικό ώστε να παρέχει αυξη ένη εξατο ικευ ένη στήριξη στους
αθητές που παρουσιάζουν αδυνα ίες και παρανοήσεις.
G ια!ορφωτική αξιολόγηση.
• Γίνεται κατά την διάρκεια της διδακτικής παρέ βασης για ανατροφοδότηση για την
πρόοδο των αθητών
• ανατροφοδότηση για την επίτευξη των αθησιακών επιδιώξεων
• τροποποίηση της διδασκαλίας ώστε να συνάδει ε τις ανάγκες του αναλυτικού
προγρά ατος, αλλά και των αθητών.
G Τελική αξιολόγηση
• Αξιολογεί τη συνολική επίδοση των αθητών (γνώσεις, δεξιότητες, εταγνώση)

Μέσα και Εργαλεία αξιολόγησης !αθητών
• Παρατήρηση.
• Παιδαγωγικό η ερολόγιο ε αφηγη ατικές καταγραφές.
• Συνέντευξη – προφορική εξέταση.
• Πρακτική αξιολόγηση εργαστηριακών δεξιοτήτων.
• Ατο ικά φύλλα εργασίας.
• Φύλλα ο αδικής εργασίας.
• Τετράδιο εργασιών (εργαστηριακών ασκήσεων,
εργασίας πεδίου κ.λπ.).

14
• ?η ιουργικές διερευνητικές εργασίες (τύπου project, posters).
• Φύλλα αυτοαξιολόγησης και ετεροαξιολόγησης.
• Φάκελος εργασιών C επιτευγ άτων (portfolio).
• Γραπτά διαγνωστικά δοκί ια.

ζ) Παιδαγωγική αξία της χρήσης ΤΠΕ

Ένας τυπικός ορισ ός της άθησης θεωρεί τη άθηση ως ια διαδικασία η οποία οδηγεί σε
διαρκή εταβολή της συ περιφοράς ενός ατό ου και η οποία προκύπτει ως αποτέλεσ α
ε πειρίας ή άσκησης. Η άθηση έτσι, ως αίτιο της εταβολής της συ περιφοράς ενός ατό ου,
αντιδιαστέλλεται από άλλα αίτια όπως η βιολογική ωρί ανση, η κόπωση κλπ. Η άθηση
πορεί λοιπόν να είναι αποτέλεσ α ιας οργανω ένης διαδικασίας (διδασκαλίας,
εκπαίδευσης), αλλά να προέρχεται επίσης και αποκλειστικά από την εν γένει ε πειρία του
ατό ου. wστόσο, υπάρχουν και άλλοι ορισ οί της άθησης, ευρύτεροι, που θεωρούν τη
άθηση ως τη εταβολή της κατανόησης, των στάσεων, των γνώσεων, των πληροφοριών,
των δεξιοτήτων και των ικανοτήτων του άτο ου. Κατ’ αυτόν τον τρόπο εντάσσονται στις
διαδικασίες της άθησης και εταβολές οι οποίες αναφέρονται στις γνώσεις, στις δεξιότητες,
στις συνήθειες του ατό ου και γίνεται, κατά τον τρόπο αυτό, ια αναφορά και σε εσωτερικές
διεργασίες του ατό ου, ηCπαρατηρήσι ες. Πολλές από τις διδακτικές εθόδους που
αποκαλούνται σύγχρονες, εφαρ όζονται ε πολύ ικανοποιητικό τρόπο ε τη βοήθεια των
ΤΠΕ, δηλαδή η εφαρ ογή τους ευνοείται ιδιαίτερα από τη χρήση των ΤΠΕ. Η ύπαρξη των
ΤΠΕ διανοίγει νέες δυνατότητες που δεν είναι δυνατόν να αγνοηθούν. Έτσι, η πρόσβαση των
αθητών στο διαδίκτυο καθιστά πιο εύκολη την πρόσβαση σε ένα τεράστιο απόθε α
πληροφοριών για οιοδήποτε σχεδόν θέ α από αυτά που περιλα βάνονται στη σχολική ύλη.
Το κατάλληλο εκπαιδευτικό λογισ ικό δίνει στο αθητή ευκαιρίες να:
• Είναι ενεργητικός,
• Εκφράζει τις ατο ικές του διαφορές στη άθηση,
• Αναστοχάζεται,
• Κατασκευάζει γνώση και όχι να είναι απλός δέκτης πληροφοριών,
• Αυτοδιορθώνεται,
• ?ιερευνά,
• Υποθέτει, γενικεύει, οδηγείται σε συ περάσ ατα
Στον πίνακα προτείνεται ια τυπολογία των δυνατών σή ερα χρήσεων της υπολογιστικής
τεχνολογίας στην εκπαίδευση, η οποία συνθέτει τις διαφορετικές τάσεις ενώ εκφράζει
ταυτόχρονα τις συνακόλουθες δραστηριότητες, την περιρρέουσα παιδαγωγική αντίληψη ή το
ακολουθού ενο ψυχολογικό ρεύ α καθώς και τους κύριους εκπροσώπους της. Οι
δραστηριότητες που τη συνιστούν δεν αποτελούν πάντα κλειστούς κόσ ους χωρίς κα ία
σχέση εταξύ τους. Αντιθέτως πορού ε να φανταστού ε εγκάρσιες χρήσεις που ανακινούν
περισσότερες από ια δραστηριότητες και που συνδυάζουν διαφορετικούς παιδαγωγικούς
στόχους.

Πίνακας 1.
Τυπολογία των
χρήσεων των νέων
εκπαιδευτικών
τεχνολογιών
Προσέγγιση
?ραστηριότητες
Παιδαγωγικοί
Στόχοι
Ψυχολογικό Ρεύ α

εκπρόσωποι
?Ι.Β.Υ.
(Tutorial, drill and
practice)
Ερωτη ατολόγια
Εξάσκηση και πρακτική,
Ερωτη ατολόγια πολλαπλών
επιλογών, συστη ατική και
ά εση διόρθωση των
απαντήσεων
συνεχής και
σταθερή
δραστηριότητα του
αθητευό ενου,
παρατήρηση
συγκεκρι ένων
συ περιφορών
Σχολή της
Συ περιφοράς ή
πιχεβιορισ ός
Skinner
Crowder
Suppes
Αυτόνο η άθηση
Ευρετική άθηση
Προγρα ατισ ός ε
συναρτησιακές γλώσσες,
Υπολογιστής έσο
προσωπικής
Γνωστική
ψυχολογία,
Piaget
Papert

15
LOGO
δη ιουργία διαδικασιών
εκσφαλ άτωση, επίλυση
προβλη άτων, γραφικά,
υλοποίηση προσωπικών
σχεδίων, εξερεύνηση
γεω ετρικών & εννοιολογικών
ικρόκοσ ων
έκφρασης,
αυθόρ ητη άθηση
προγρα ατισ ού,
άθηση πάνω στη
άθηση, γνωστική
αυτοεξερεύνηση
ανάπτυξη
αθη ατικών
εννοιών, λογική
ανάλυση, χρήση
συ βόλων,
αξιοποίηση
παρα ετρικού
περιβάλλοντος για
γενίκευση C
αφαίρεση
Παιδαγωγική της
Ανακάλυψης,
Κονστρυκτιβισ ός
Μάθηση έσω
ανακάλυψης
Bruner
?ιερευνητική
άθηση
Ανοικτά
Προγρα ατιστικά
Περιβάλλοντα
Μάθησης
Μαθη ατικές δραστηριότητες,
επίλυση προβλη άτων,
προγρα ατισ ός σε ανοικτό
και φιλικό περιβάλλον,
πειρα ατισ ός
Μάθηση σε ικρές
ο άδες, διαλογική
σχέση δασκάλουC
αθητή, συ βολική
έκφραση,
διερεύνηση
λογικο αθη ατικών
εννοιών έσω
προγρα ατιστικών
εφαρ ογών,
έκφραση και
διερεύνηση δεών,
συνειδητοποίηση
ηχανισ ών της
σκέψης (αναλυτικήC
συνθετική σκέψη,
αφαίρεση),
πειρα ατισ όςC
επίλυση
προβλή ατος σε
προγρα ατιστικό
περιβάλλον
Συνεργατική
άθηση,
ΕυρετικήC
βιω ατική άθηση
Ολοκληρω ένο
πρότυπο χρήσης
υπολογιστών
Papert Olson
DiSessa
Noss Hoyles

Τεχνητή νοη οσύνη
Έ πειρα ?ιδακτικά
Συστή ατα
Αλληλεπιδραστικά
Περιβάλλοντα
Μάθησης ε
Υπολογιστή
Παρουσίαση συγκεκρι ένων
προβλη άτων Χρήση φυσικής
γλώσσας, ?εδο ένα αβέβαια και
η πλήρη, Αναπαράσταση
γνώσεων, όχι
προκατασκευασ ένες
ερωτήσεις. Πραγ ατοποίηση
συλλογισ ών
αλληλεπιδραστικότη
τα στη επίλυση
προβλή ατος,
οντελοποίηση
εκπαιδευτήC
εκπαιδευό ενου,
σύλληψη
προσαρ οστικών
και εξελισσό ενων
συστη άτων,
οντελοποίηση των
συλλογισ ών
Γνωστική
ψυχολογία, θεωρία
της πληροφορίας,
Γνωστικές
Επιστή ες
Παιδαγωγική
Μηχανική,
Κυβερνητική
Turing
Simon
Newell
Minsky
Wienner
Πολυ έσα.
Υπερ έσα Παιγνίδια
Ρόλων
ελεύθερη ή καθοδηγού ενη
πλοήγηση, προσωπική
ανακάλυψη και ε πειρία
αναζήτηση πληροφοριών
Συσχέτιση εννοιών, Συλλογική
ανάπτυξη εργασιών
συσχέτιση εννοιών
και συλλογική
ανάπτυξη
εφαρ ογώνC
εργασιών,
εξατο ίκευση
αθησιακών
διαδρο ών,
ελευθερία επιλογής,
συνειρ οί ιδεών,
γνωστικοί χάρτες
Μη
καθοδηγού ενη
εκπαίδευση,
Ανοικτή
παιδαγωγική,
Μάθηση έσω
ανακάλυψης
Bush Nelson
Engelbart
Επαγγελ ατικό
Λογισ ικό:
Κει ενογράφοι.
Επιτραπέζια
Εκδοτικά
γραπτή έκφραση, ελεύθερη και
γρα ική σχεδίαση,
ολοκλήρωση τεχνικών γραφής
και σχεδίασης στο τελικό
προϊόν, διαχείριση αρχείων και
καινοτό ες
εφαρ ογές
αναβάθ ιση της
εκπαιδευτικής
διαδικασίας.
Σχολείο Εργασίας
Freinet
Dewey

16

?υνητική
Πραγ ατικότητα
ε βύθιση, εγκλεισ ός σε υπαρκτούς
ή φανταστικούς κόσ ους,
προσο οιώσεις υπαρκτών ή
φανταστικών καταστάσεων, ά εσος
χρόνος, αλληλεπιδραστικότητα
ά εση παρατήρηση της
"πραγ ατικότητας"
ανάπτυξη πολυδιάστατων
νοητικών χώρων, χειρισ ός
αφηρη ένων
αναπαραστάσεων,
αλληλεπίδραση σε απόσταση
ε εικονικά αντικεί ενα ή
άτο α
Κυβερνοχώρος,
Ενεργός τρόπος
εκπαίδευσης,
Βιω ατική
εκπαίδευση
J. Lannier
Ph. Quiau
Ηλεκτρονικά
παιγνίδια
παιγνίδι, ορφές ψυχαγωγίας,
παιγνίδια ρόλων, άθηση χρήσης
του υπολογιστή, κοινωνικέςC
συλλογικές δραστηριότητες
ανάπτυξη αντανακλαστικών,
κινητικές δεξιότητες, έρευνα
στρατηγικών, προσωπική
ε πλοκή, έλεγχος γεγονότων



Ρο ποτική
κατασκευές και τεχνολογία ελέγχου,
προγρα ατισ ός αυτο άτων,
ελέτη κινήσεων, χειρισ ός
αυτο άτων από απόσταση
συνειδητοποίηση του τρόπου
λειτουργίας του ατό ου,
εξερεύνηση του χώρου εξ
αποστάσεως, ανάλυση C
σύνθεση κινήσεων,
χειρισ ός εξ αποστάσεως,
αλγοριθ ική οικοδό ηση
δρο ολογίων

Papert
Minsky

Συστή ατα,
Σχεδιαστικά Βάσεις
?εδο ένων,
Επεξεργασία
Εικόνας, κλπ.
συλλογή, οργάνωση, αυτό ατη
αναζήτηση πληροφοριών
κατανόηση των
χρήσεων της
υπολογιστικής
τεχνολογίας,
καλλιέργεια
διαχρονικών
δεξιοτήτων στη
χρήση εφαρ ογών
?ίκτυα
επικοινωνία χρηστών,
ηλεκτρονικό ταχυδρο είο,
αναζήτηση, πρόσβαση σε ευρύ
φάσ α στοιχείωνCαρχείων.
Τηλεδιασκέψεις, Πρόσβαση από
απόσταση σε συστή ατα
πληροφορικής
αρτιότερη
οργάνωση της
διδασκαλίας,
συλλογικές
καταστάσεις
άθησης, πλοήγηση
σε ένα αφηρη ένο
σύστη α στοιχείων,
οικονο ία χώρου,
χρόνου και πόρων
Κοινοτική
Παιδαγωγική
Negroponte
Προσο οιώσεις
Πειρα ατισ ός οντέλων,
καταστάσεων, φαινο ένων
ανάπτυξη
πρωτοβουλίας
κινήσεων,
ανακάλυψη
οντέλων,
παρα έτρων
Κοινωνική άθηση

Vygotsk
y Bandura

17
9. Φύλλα εργασίας
Μάθη α: Βιολογία Γ΄ Γυ νασίου Η ερο ηνία:
Ονο ατεπώνυ ο:
Τ ή α:
ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ 1

1. Τίτλος
Το γενετικό υλικό και η οργάνωσή του σε χρω!οσώ!ατα

2. Ε!πλεκό!ενες γνωστικές περιοχές
Βιολογία, Χη εία, Περιβαλλοντική εκπαίδευση, Βιοτεχνολογία, Κληρονο ικότητα,
Ασθένειες.

3. Προαπαιτού!ενες γνώσεις
Οργανικές ενώσεις, νουκλεοτίδιο, η δο ή των νουκλεϊκών οξέων, δο ή του DNA,
συ πληρω ατικότητα των αζωτούχων βάσεων, γα έτες, ζυγωτό κύτταρο.

4. Στόχοι
Στο τέλος της διδασκαλίας της θε ατικής ενότητας ο αθητής θα πρέπει:
￿ Να αναγνωρίζει την ση ασία των πρωτεϊνών ως δο ικών και λειτουργικών
συστατικών του κυττάρου που ευθύνονται για την εκδήλωση των φαινο ένων της ζωής.
￿ Να αντιλα βάνεται την συσχέτιση DNACγενετικό υλικό – χρω ατίνη – χρω όσω α
και το ρόλο των πρωτεϊνών στην συγκρότηση της χρω ατίνης και του χρω οσώ ατος.
￿ Να αναγνωρίζει τη δο ή της χρω ατίνης και των νουκλεοσω άτων.
￿ Να συσχετίζει την ορφή του γενετικού υλικού ε τις διάφορες φάσεις του κυτταρικού
κύκλου και να συνδέει την κυτταρική διαίρεση ε την ε φάνιση των χρω οσω άτων στο
οπτικό ικροσκόπιο.
￿ Να αντιλα βάνεται ότι το κάθε χρω όσω α αποτελείται από δύο χρω ατίδες και η
κάθε χρω ατίδα αποτελεί ένα όριο DNA, που δη ιουργείται κατά τον αυτοδιπλασιασ ό του
DNA.
￿ Να αντιλα βάνεται ότι το κάθε χρω όσω α αποτελείται από σύνολο γονιδίων, που
καθορίζουν τα γενετικά χαρακτηριστικά.
￿ Να αντιλα βάνεται ότι τα χρω οσώ ατα βρίσκονται σε ζεύγη ό οιων (σε σχή α και
έγεθος) χρω οσω άτων που ονο άζονται ο όλογα και προέρχονται από τον αρσενικό και
θηλυκό γα έτη.
￿ Να διακρίνει τα κύτταρα σε διπλοειδή και απλοειδή.
￿ Να διακρίνει τα χρω οσώ ατα σε αυτοσω ικά και φυλετικά.
￿ Να περιγράφει τον τρόπο ε τον οποίο καθορίζεται το φύλο στον άνθρωπο.
￿ Να ταξινο εί τα χρω οσώ ατα σε ζεύγη ο ολόγων, κατά ελαττού ενο έγεθος και να
κατασκευάζει έναν καρυότυπο.
￿ Να αντιλα βάνεται την ση ασία του καρυότυπου στην διάγνωση ασθενειών,
απόρροια αλλαγών στη δο ή και τον αριθ ό των χρω οσω άτων.

18
5. ιδακτική προετοι!ασία των !αθητών
α) Από το σχολικό βιβλίο προετοι άστε την ενότητα 5.1, σελίδα 96C97.
β) Αναζητήστε πληροφορίες από το διαδίκτυο για την δο ή του γενετικού υλικού, τα
νουκλεοσώ ατα, τα χρω οσώ ατα, τον καρυότυπο. Στο ιστολόγιο School Biology
(
http://blogs.sch.gr/kekbio/
) αναζητήστε πληροφορίες και υλικό. Το υλικό συλλέγεται,
αξιολογείται και ο αθητής που εκπροσωπεί την ο άδα αναλα βάνει την παρουσίαση του
υλικού και την πλήρη και σαφή ανάπτυξη της θε ατικής ενότητας.
γ) Στο You Tube αναζητήστε: Chromosome, D2A, and gene video και επιλέγετε τα
βίντεο που σχετίζονται ε την δο ή των χρω οσω άτων.
δ) Στην ιστοσελίδα eCyliko.gr (
http://www.eCyliko.gr/default.aspx
) στο εκπαιδευτικό υλικό
και στον αλφαβητικό κατάλογο αναζητήστε το λογισ ικό Βιολογία Α΄ και Γ΄ Γυ νασίου. Να
κάνετε λήψη του λογισ ικού και εγκατάσταση στον υπολογιστή σας.


Από το βασικό ενού επιλέξτε «Γενετική» και περιηγηθείτε στις επι έρους ενότητες.

6. Παρουσίαση στην τάξη
Αξιοποιείστε το διαδικτυακό υλικό και προετοι άστε την παρουσίασή σας προφορικά
χρησι οποιώντας εποπτικό υλικό. Η παρουσίαση συ πληρώνεται και γίνεται πληρέστερη ε
την παρέ βαση των υπολοίπων αθητών της ο άδας και του καθηγητή. Το τελευταίο
20λεπτο της 2ης διδακτικής ώρας οι αθητές απαντούν σε ερωτήσεις του φύλλου
αξιολόγησης και συ πληρώνουν τους πίνακες της γενικότερης αποτί ησης ατό ων και
ο άδων.

7. ραστηριότητες στη τάξη
α) Προβολή διαφανειών – βίντεο
Οι αθητές έχουν ήδη περιηγηθεί στο Ιστολόγιο “School Biology” και έχουν ανακτήσει:
ι) από τη θέση «Συγγρά ατα» το αρχείο «Βιολογία Γ΄ Γυ νασίου», ιι) από την αρχική
σελίδα, Βιολογία Γυ νασίου, το αρχείο «Η οργάνωση του γενετικού υλικού», ιιι) από τη θέση
«Εκπαιδευτικό υλικό», τα αρχεία: «%ο ή νουκλεϊκών οξέων», «Βιο όρια».
Στην τάξη οι αθητές διενεργούν την ίδια διαδικασία ε την καθοδήγηση του καθηγητή
και ταυτόχρονα γίνεται προβολή διαφανειών και σχετικών βίντεο: 1Α, 1Β, 1Γ, 1?, 1Ε, 1Ζ,
1Η και 2Α (α΄ έρος). Ο καθηγητής επεξηγεί, αίρει τις παρανοήσεις, αντλεί ιδέες, εθόδους
και στρατηγικές. Η γνώση δο είται ενεργά από τους αθητές ε τη χρήση ενός ευρύ
ρεπερτορίου διδακτικών προσεγγίσεων.

19
β) Ανάλυση καρυότυπου

1) ?η ιουργείστε ένα δικό σας καρυότυπο ακολουθώντας τις παρακάτω οδηγίες:
￿ Στο φύλλο εργασίας, σας δίνεται ία ετάφαση ανθρώπινου κυττάρου, διαφορετική για τον
κάθε αθητή. Αρχικά ετρήστε τον αριθ ό των χρω οσω άτων που περιέχει η ετάφασή σας και
ση ειώστε τον.
￿ Κόψτε προσεκτικά, ε κατάλληλο ψαλιδάκι που θα σας δοθεί, όλα τα χρω οσώ ατα που
βρίσκονται στη ετάφαση, έτσι ώστε να προκύψουν όλα τα χρω οσώ ατα σε ε ονω ένα κο άτια.
Πριν αρχίσετε να κόβετε παρακολουθήστε ια αντίστοιχη επίδειξη από τον καθηγητή σας.
￿ Μετρήστε τον αριθ ό των ε ονω ένων χρω οσω άτων ο οποίος θα πρέπει να συ πίπτει ε
τον αριθ ό που ση ειώσατε προηγου ένως.
￿ Σας δίνεται ένα φύλλο λευκό ε αριθ η ένες 23 θέσεις. Σε κάθε αριθ η ένη θέση αντιστοιχεί
και ένα ζευγάρι ο ολόγων χρω οσω άτων
￿ Τοποθετήστε τα χρω οσώ ατα σε ζευγάρια πάνω στο αριθ η ένο φύλλο εργασίας έτσι ώστε
το κάθε ζευγάρι να τοποθετείται στην κατάλληλη αριθ η ένη θέση ε βάση το αντίστοιχο πρότυπο
ζωνώσεων που δίνει το κάθε χρω όσω α ύστερα από χρώση GCbanding.
￿ Για τη σωστή τοποθέτηση των χρω οσω άτων στην κατάλληλη θέση θα πρέπει να
συ βουλευτείτε τις διαφάνειες που έχετε προστά σας και οι οποίες αντιστοιχούν σε καρυότυπο ε
χρώση GCbanding.
￿ Αφού ολοκληρώσετε την τοποθέτηση των χρω οσω άτων δείξτε την στον καθηγητή σας ο
οποίος θα διορθώσει τυχόν λάθη που κάνατε στην τοποθέτηση
￿ Μετά τον έλεγχο κολλήστε τα χρω οσώ ατα, ε κατάλληλη ταινία που θα σας δοθεί, χωρίς
να τα ετακινήσετε από τη θέση που τα τοποθετήσατε
￿ Μελετήστε προσεκτικά τον καρυότυπο που κάνατε και αποφανθείτε για το είδος της
αριθ ητικής χρω οσω ικής ανω αλίας που έχει
￿ Γράψτε το γονότυπο της ετάφασης στο επάνω έρος του φύλλου του καρυοτύπου.
￿ Συγχαρητήρια έχετε δη ιουργήσει ένα καρυότυπο!




20


Ση!είωση:
η δραστηριότητα ολοκληρώνεται από τον κάθε αθητή στο σπίτι του.



21
γ) Περιήγηση στο λογισ!ικό Βιολογίας
Γίνεται ανασκόπηση της ενότητας έσα από το λογισ ικό της Βιολογίας. Οι αθητές, αν
υπάρχει δυνατότητα (εργαστήριο πληροφορικής ή έστω ένας υπολογιστής ανά ο άδα),
εργάζονται στον υπολογιστή, ε τις οδηγίες του καθηγητή.
Η τελική δραστηριότητα είναι τα παιχνίδια 1 και 2 του λογισ ικού, όπου οι αθητές
ελέγχουν τις γνώσεις τους και χαλαρώνουν δη ιουργώντας ιδανικές συνθήκες
κοινωνικοποιη ένης και βιω ατικής δράσης.







22
Μάθη α: Βιολογία Γ΄ Γυ νασίου Η ερο ηνία:
Ονο ατεπώνυ ο:
Τ ή α:
ΦΥΛΛΟ ΑΞΙΟΛΟΓΗΣΗΣ 1

1
η
Θε!ατική ενότητα: Το γενετικό υλικό και η οργάνωσή του σε χρω!οσώ!ατα

Θέ!α 1
ο

Να επιλέξετε από τις προτεινό ενες φράσεις αυτή που συ πληρώνει σωστά τις παρακάτω
προτάσεις:
ι) Όλοι οι οργανισ!οί ε!φανίζουν συγκεκρι!ένα δο!ικά χαρακτηριστικά και
επιτελούν συγκεκρι!ένες λειτουργίες. Οι οργανικές ενώσεις που είναι υπεύθυνες γι’
αυτές τις ιδιότητες είναι:
α) τα νουκλεϊκά οξέα
β) τα λίπη
γ) οι πρωτεΐνες
δ) τα σάκχαρα
ιι) Το αρσενικό φύλο στον άνθρωπο καθορίζεται από την παρουσία του:
α) του ζεύγους των φυλετικών χρω οσω άτων.
β) του Χ χρω οσώ ατος.
γ) των αυτοσω ικών χρω οσω άτων
δ) του Υ χρω οσώ ατος.
ιιι) Να βάλετε σε σειρά ώστε το προηγού ενο να περιέχεται στο επό ενο, τις παρακάτω
έννοιεςC λέξεις: α) χρω όσω α β) γονίδιο γ) αζωτούχος βάση δ) πυρήνας ε) νουκλεοτίδιο, στ)
δίκλωνο όριο DEA
α) α, β, γ, δ, ε, στ
β) γ, ε, β, α, στ, δ
γ) γ, ε, β, στ, δ, α
δ) γ, ε, β, στ, α, δ
Θέ!α 2
ο

α) Να εξηγήσετε σε ποιο στάδιο της ζωής του κυττάρου τα χρω οσώ ατα γίνονται ορατά
ε το οπτικό ικροσκόπιο.

β) Με ποιο τρόπο «πακετάρεται» το DNA για να σχη ατιστεί η χρω ατίνη.


23

Θέ!α 3
ο


α) Να δώσετε την έννοια (ορισ ό) των παρακάτω βιολογικών όρων: καρυότυπος,
διπλοειδείς κύτταρα, ο όλογα χρω οσώ ατα.

β) Στο διπλανό σχή α απεικονίζονται δύο χρω οσώ ατα σε
διαφορετικές φάσεις του κυτταρικού κύκλου. Ποιο από τα δύο
χρω οσώ ατα βρίσκεται στη φάση της κυτταρικής διαίρεσης;
Εξηγήστε την απάντησή σας.



Α Β

Θέ!α 4
ο


α) Να συ!πληρώσετε τα κενά στο κεί!ενο που ακολουθεί:

Η δράση των πρωτεϊνών εξαρτάται από την σύστασή τους, δηλαδή από την σειρά των
............................. που περιέχουν. Τη σειρά αυτή καθορίζει το ................... .....................,
το DNA. Κάθε άνθρωπος έχει .... ζεύγη χρω οσω άτων, που έχουν το ίδιο σχή α και
................. και ονο άζονται ........................ . Σε κάθε ζεύγος χρω οσω άτων το ένα είναι
...................... και το άλλο ....................... προέλευσης. Σε άλλους οργανισ ούς , όπως οι
........................ και οι περισσότεροι ονοκύτταροι ευκαρυωτικοί, τα χρω οσώ ατα δεν είναι
ανά δύο ό οια και δεν τοποθετούνται σε ζεύγη. Οι οργανισ οί αυτοί χαρακτηρίζονται ως
......................... .

β) Να χαρακτηρίσετε ως σωστές ή λάθος τις ακόλουθες προτάσεις:
1. Στα κύτταρα των διπλοειδών οργανισ ών ε φανίζονται ζεύγη ο ολόγων
χρω οσω άτων.
2. Η παρουσία του χρω οσώ ατος Χ καθορίζει το θηλυκό φύλο στον άνθρωπο.
3. Κάθε σω ατικό κύτταρο ενός άνδρα περιέχει ένα Χ και ένα Υ χρω όσω α.
4. Στους ευκαρυωτικούς οργανισ ούς το DNA βρίσκεται στον πυρήνα των κυττάρων.
5. Τα κύτταρα όλων των οργανισ ών περιέχουν 46 χρω οσώ ατα.
6. Τα χρω οσώ ατα αποτελούνται κυρίως από γενετικό υλικό.


Καλή επιτυχία


24
Μάθη α: Βιολογία Γ΄Γυ νασίου Η ερο ηνία:
Ονο ατεπώνυ ο:
Τ ή α:
ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ 2

1. Τίτλος
Η ροή της γενετικής πληροφορίας – Αντιγραφή του DNA.

2. Ε!πλεκό!ενες γνωστικές περιοχές
Βιολογία, Χη εία, Περιβαλλοντική εκπαίδευση, Βιοτεχνολογία, Κληρονο ικότητα,
Ασθένειες.

Λέξεις κλειδιά
Νουκλεοτίδια, διπλή έλικα DNA, συ πληρω ατικότητα των βάσεων, φωσφοδιεστερικός
δεσ ός, ένζυ α, DNA πολυ εράσες, πρι άση, ελικάση, δεσ άση, αλυσίδα οδηγός, αλυσίδα
συνοδός.

3. Προαπαιτού!ενες γνώσεις
Χη ική δο ή των νουκλεοτιδίων, αζωτούχες βάσεις (αδενίνη, γουανίνη, κυτοσίνη,
θυ ίνη), συ πληρω ατικότητα των βάσεων, ζεύγη βάσεων ΑCΤ, GCC, δεξιόστροφη έλικα του
DNA.







25
4. Στόχοι
Στο τέλος της διδασκαλίας της θε ατικής ενότητας ο αθητής θα πρέπει:
￿ Να περιγράφει ο αθητής ότι το DNA είναι ένα όριο ε δύο αλυσίδες που
αποτελείται από χιλιάδες ή εκατο ύρια νουκλεοτίδια που ενώνονται ε φωσφοδιεστερικούς
δεσ ούς.
￿ Να αντιλα βάνεται ότι το DNA είναι ένα αυτοαντιγραφό ενο όριο, δηλαδή έχει την
δυνατότητα να δίνει ακριβή αντίγραφα του εαυτού του.
￿ Να αντιλα βάνεται ότι η αντιγραφή προηγείται της κυτταρικής διαίρεσης και η
διαδικασία της αντιγραφής εξασφαλίζει την εταβίβαση της γενετικής πληροφορίας στα
θυγατρικά κύτταρα και στους απογόνους.
￿ Να διακρίνει ότι κατά την αντιγραφή απαιτείται να ανοίξει η διπλή έλικα και η κάθε
αλυσίδα λειτουργεί ως καλούπι για την κατασκευή της νέας αλυσίδας.
￿ Να αντιλα βάνεται ότι η αντιγραφή γίνεται δυνατή χάρη στην παρουσία ενζύ ων που
επιτελούν συγκεκρι ένο ρόλο.

5. ιδακτική προετοι!ασία !αθητών
α) Από το σχολικό βιβλίο προετοι άστε την ενότητα 5.2, σελίδα 99C100.
β) Αναζητήστε πληροφορίες από το διαδίκτυο για την δο ή του γενετικού υλικού, την
διαδικασία αντιγραφής του γενετικού υλικού. Στο ιστολόγιο School Biology
(
http://blogs.sch.gr/kekbio/
) αναζητήστε πληροφορίες και υλικό.
γ) Στο You Tube αναζητήστε: replication of D2A και επιλέγετε τα βίντεο που σχετίζονται
ε την αντιγραφή του DNA.
δ) Περιηγηθείτε στο λογισ ικό της Βιολογίας Α΄ και Γ΄ Γυ νασίου.



Βίντεο από το λογισ!ικό Βιολογίας της Γ΄ Γυ!νασίου

Αντιγραφικές θηλιές




26
Έναρξη της αντιγραφής




Η DNA πολυ εράση συνθέτει τον συνεχή κλώνο και την συνοδό αλυσίδα. Η DNA
πολυ εράση ε δράση υδρολύει (αποικοδο εί) το όριο RNACεκκινητή και συ πληρώνει τα
κενά.
Τα τροποποιη ένα κο άτια (ονο άζονται κο άτια Okazaki) συνδέονται ε το ένζυ ο
δεσ άση (ligase).





27

Βίντεο από λογισ!ικό Βιολογίας

ΠΡΟΒΟΛΗ ΒΙΝΤΕΟ

6. Παρουσίαση στην τάξη
Αξιοποιείστε το διαδικτυακό υλικό και προετοι άστε την παρουσίασή σας προφορικά
χρησι οποιώντας εποπτικό υλικό. Η παρουσίαση συ πληρώνεται και γίνεται πληρέστερη ε
την παρέ βαση των υπολοίπων αθητών της ο άδας και του καθηγητή. Το τελευταίο
20λεπτο της 2ης διδακτικής ώρας οι αθητές απαντούν σε ερωτήσεις του φύλλου
αξιολόγησης και συ πληρώνουν τους πίνακες της γενικότερης αποτί ησης ατό ων και
ο άδων.


7. ραστηριότητα στην τάξη
α) Προβολή διαφανειών – βίντεο
Οι αθητές έχουν ήδη περιηγηθεί στο Ιστολόγιο “School Biology” και έχουν ανακτήσει: ι)
από τη θέση «Συγγρά ατα» το αρχείο «Βιολογία Γ΄ Γυ νασίου», ιι) από τη θέση
«Εκπαιδευτικό υλικό», τα αρχεία: «Αντιγραφή και έκφραση του γενετικού υλικού», «Γενετικό
υλικό. Αντιγραφή και έκφραση της γενετικής πληροφορίας».
Στην τάξη οι αθητές διενεργούν την ίδια διαδικασία ε την καθοδήγηση του καθηγητή
και ταυτόχρονα γίνεται προβολή διαφανειών και σχετικών βίντεο: 2Α (β΄ έρος) και 2Β.

β) Περιήγηση στο λογισ!ικό Βιολογίας
Γίνεται ανασκόπηση της ενότητας έσα από το λογισ ικό της Βιολογίας, ε την ενεργή
συ ετοχή των αθητών.


28
Μάθη α: Βιολογία Γ΄ Γυ νασίου Η ερο ηνία:

Ονο ατεπώνυ ο:
Τ ή α:
ΦΥΛΛΟ ΑΞΙΟΛΟΓΗΣΗΣ 2


Η ροή της γενετικής πληροφορίας – Αντιγραφή του DNA.

Θέ!α 1
ο

α) ίνεται η αλληλουχία των βάσεων ενός !ορίου DNA:

CGGTCCTAATTTTTAGGCCTAAAGCCGCTATATGCA
CCCAGGATTAAAAATCCGGATTTCGGCGATATACGT
Να γράψετε την αλληλουχία των δύο ορίων που προκύπτουν ετά την αντιγραφή του
ορίου DNA, ση ειώνοντας την αρχική αλυσίδα σε κάθε περίπτωση.

Μονάδες 3
β) Να τοποθετήσετε στη σειρά τις παρακάτω εικόνες έτσι ώστε να περιγράφεται η
διαδικασία της αντιγραφής του DNA.
Α.
Β.
Γ.
.


Μονάδες 2
Θέ!α 2
ο

Να επιλέξετε από τις προτεινό ενες φράσεις αυτή που συ πληρώνει σωστά τις παρακάτω
προτάσεις:
1) Ποιο από τα προτεινό!ενα δεν συ!βαίνει κατά την αντιγραφή του DNA:
α) ανοίγει η διπλή έλικα.
β) σχη ατίζονται δύο πανο οιότυπα όρια.
γ) συ ετέχουν πολλά ένζυ α.
δ) συντελείται στο κυτταρόπλασ α των ευκαρυωτικών κυττάρων.

2) Κατά την αντιγραφή η διπλή έλικα του DNA:
α) «πακετάρεται» σχη ατίζοντας νουκλεοσώ ατα.
β) ανοίγει σε συγκεκρι ένες θέσεις καθώς σπάνε οι δεσ οί υδρογόνου εταξύ των
αζωτούχων βάσεων.
γ) ανοίγει σε τυχαίες θέσεις καθώς σπάνε οι δεσ οί εταξύ των αζωτούχων βάσεων.
δ) σχη ατίζει ια καινούργια διπλή έλικα.
Μονάδες 4


29

Θέ!α 3
ο

α) Να περιγράψετε τη διαδικασία αντιγραφής του DNA.

Μονάδες 4
β) Να συ!πληρώσετε τα κενά στο κεί!ενο που ακολουθεί:
Κατά τη διαίρεση ενός κυττάρου προκύπτουν ........................... κύτταρα στα οποία
περιέχονται οι ίδιες .............................. πληροφορίες. Το αποτέλεσ α της αντιγραφής είναι ο
σχη ατισ ός δύο .......................... ορίων DNA, καθένα από τα οποία αποτελείται από ια
................... και ια νέα αλυσίδα. Αυτά τα όρια – σε περίπτωση που δεν έχει συ βεί κάποιο
.............. στη συ πληρω ατικότητα των βάσεωνC είναι ...................... εταξύ τους όσο και ε
το αρχικό όριο, δηλαδή έχουν την ίδια ............................. αζωτούχων βάσεων και συνεπώς
τις ίδιες .................... πληροφορίες.
Μονάδες 4

γ) Να χαρακτηρίσετε ως σωστές ή λάθος τις ακόλουθες προτάσεις:
1) Η αντιγραφή προηγείται της κυτταρικής διαίρεσης, ώστε κάθε νέο κύτταρο να περιέχει
ένα αντίγραφο του DNA του αρχικού κυττάρου.
2) Κατά την αντιγραφή του DNA τα νουκλεοτίδια ενώνονται εταξύ τους ακολουθώντας
τον κανόνα της συ πληρω ατικότητας των βάσεων ACG, TCC.
3) Το αποτέλεσ α της αντιγραφής είναι ο σχη ατισ ός δύο ονόκλωνων ορίων DNA.

Μονάδες 3

Καλή επιτυχία


30
Μάθη α: Βιολογία Γ΄ Γυ νασίου Η ερο ηνία:

Ονο ατεπώνυ ο:
Τ ή α:
ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ 3

1. Τίτλος
Μεταγραφή, !ετάφραση G Έκφραση της γενετικής πληροφορίας

2. Ε!πλεκό!ενες γνωστικές περιοχές
Βιολογία, Χη εία, Περιβαλλοντική εκπαίδευση, Βιοτεχνολογία, Κληρονο ικότητα,
Ασθένειες.

Λέξεις κλειδιά
Νουκλεοτίδια, διπλή έλικα DNA, συ πληρω ατικότητα των βάσεων, γονίδιο, ένζυ α,
RNA πολυ εράση, mRNA, ριβόσω α, rRNA, tRNA, α ινοξέα, πρωτεΐνες.

3. Προαπαιτού!ενες γνώσεις
Χη ική δο ή των νουκλεοτιδίων, αζωτούχες βάσεις (αδενίνη, γουανίνη, κυτοσίνη,
θυ ίνη), συ πληρω ατικότητα των βάσεων, ζεύγη βάσεων ΑCΤ, GCC, δεξιόστροφη έλικα του
DNA, αντιγραφή του DNA, δο ή και λειτουργία του RNA, δο ή και λειτουργία του
ριβοσώ ατος, δο ή και λειτουργία των πρωτεϊνών, διαφοροποίηση.






31
4. Στόχοι
Στο τέλος της διδασκαλίας της θε ατικής ενότητας ο αθητής θα πρέπει:
￿ Να αναγνωρίζει και να εξηγεί σε γενικές γρα ές, τον βιολογικό ρόλο των
διαφορετικών ειδών RNA.
￿ Να αντιλα βάνεται ότι η γενετική πληροφορία είναι αποθηκευ ένη ως αλληλουχία
αζωτούχων βάσεων.
￿ Να περιγράφει συνοπτικά τη διαδικασία εταγραφής του DNA σε RNA.
￿ Να εξηγεί πως η διαδοχή των νουκλεοτιδίων στα νουκλεϊκά οξέα καθορίζει τη
διαδοχή των α ινοξέων στις πρωτεΐνες.
￿ Να περιγράφει την διαδικασία της ετάφρασης και να αντιλα βάνεται τον ρόλο των
ορίων RNA, του ριβοσώ ατος και τον τρόπο που ενώνονται τα α ινοξέα για την
συγκρότηση των πρωτεϊνών.
￿ Να προσδιορίζει το «πότε» και το «που» στο κύτταρο διεξάγονται η εταγραφή και η
ετάφραση.
￿ Να αντιλα βάνεται και να περιγράφει το κεντρικό δόγ α της Βιολογίας.
￿ Να διακρίνει ο οιότητες και διαφορές εταξύ αντιγραφής και εταγραφής.
￿ Να συσχετίζει την έκφραση του γενετικού υλικού ε τη διαφοροποίηση.

5. ιδακτική προετοι!ασία !αθητών
α) Από το σχολικό βιβλίο προετοι άστε την ενότητα 5.2, σελίδα 100C101.
β) Αναζητήστε πληροφορίες από το διαδίκτυο για την εταγραφή του γενετικού υλικού,
την δη ιουργία του mRNA και την διαδικασία της ετάφρασής του στα ριβοσώ ατα. Στο
ιστολόγιο School Biology (
http://blogs.sch.gr/kekbio/
) αναζητήστε πληροφορίες και υλικό.
γ) Στο You Tube αναζητήστε: transcription and translation και επιλέγετε τα βίντεο που
σχετίζονται ε τις διαδικασίες εταγραφής και ετάφρασης.
δ) Περιηγηθείτε στο λογισ ικό της Βιολογίας Α΄ και Γ΄ Γυ νασίου.



Η γενετική πληροφορία είναι οργανω ένη σε
γονίδια και κάθε γονίδιο είναι ένα τ ή α του
DNA, που είναι υπεύθυνο για τη σύνθεση ιας
πολυπεπτιδικής αλυσίδας ή ενός RNA (tRNA ή
rRNA).

Η σύνθεση των πρωτεϊνών είναι ένας
πολύπλοκος κυτταρικός ηχανισ ός, στον οποίο
εκτός από το mRNA συ ετέχουν τα
ριβοσώ ατα, τα εταφορικά RNA (tCRNA) και
διάφοροι πρωτεϊνικοί παράγοντες, υπεύθυνοι για
την διεκπεραίωση συγκεκρι ένων σταδίων του
όλου ηχανισ ού.




32
Βίντεο από το λογισ!ικό Βιολογίας της
Γ΄ Γυ!νασίου

Όταν χρειάζεται ια γενετική
πληροφορία να εκφραστεί σε πρωτεΐνη,
το DNA ανοίγει στο ση είο που
βρίσκεται το γονίδιο, η περιοχή
αναγνωρίζεται από πρωτεϊνικούς
παράγοντες και ένζυ α και στην
συνέχεια από την ία ονόκλωνη
αλυσίδα αρχίζει ια διαδικασία που
ονο άζεται εταγραφή, κατά την οποία
σχη ατίζεται ια αλυσίδα RNA πιστό
αντίγραφο της γονιδιακής περιοχής.



Τα ριβοσώ ατα είναι οργανίδια ε δύο
υπο ονάδες που αποτελούνται από τα
ριβοσω ικά RNA και πρωτεΐνες. Τα tRNA
είναι ικρά όρια ήκους 75C85
νουκλεοτιδίων, ε χαρακτηριστική
διάταξη στο χώρο και έχουν την
δυνατότητα να προσδένουν ένα
συγκεκρι ένο α ινοξύ. Ταυτόχρονα
περιέχουν ια τριπλέτα βάσεων, το
αντικωδικόνιο, που αναγνωρίζει τις
τριπλέτες των βάσεων του mRNA.

Όταν το mRNA φτάσει στο
κυτταρόπλασ α αλληλεπιδρά ε την ικρή υπο ονάδα του ριβοσώ ατος, ταυτόχρονα
προσεγγίζει ένα tRNA που προσδένεται στην τριπλέτα έναρξης AUG του mRNA. Το tRNA
έχει προσδεδε ένο το α ινοξύ έναρξης, την εθειονίνη. Η εγάλη ριβοσω ική υπο ονάδα
έρχεται να καλύψει το σύ πλοκο mRNA, tRNA, ικρής υπο ονάδας. Η επό ενη τριπλέτα
του mRNA αναγνωρίζεται από ένα δεύτερο tRNA, που φέρει το δεύτερο α ινοξύ. Το ένζυ ο
πεπτιδυλοτρανσφεράση δη ιουργεί πεπτιδικό δεσ ό εταξύ του πρώτου και δευτέρου
α ινοξέος. Στη συνέχεια το ριβόσω α ετακινείται πάνω στην αλυσίδα του mRNA κατά τρία
νουκλεοτίδια (τριπλέτα) έτσι ώστε ελευθερώνεται ια θέση, η οποία πορεί να δεχθεί το
τρίτο α ινοξύ, κ.ο.κ.. Η διαδικασία αυτή συνεχίζεται έχρις ότου από ειδικούς παράγοντες
απελευθέρωσης αναγνωριστεί ένας από τους κωδικούς λήξης UAA ή UGΑ ή UAG πάνω στο
mRNA.


33
ΠΡΟΒΟΛΗ ΒΙΝΤΕΟ: 3Α, 3Β, 3Γ, 3, 3Ε



6. Παρουσίαση στην τάξη
Αξιοποιείστε το διαδικτυακό υλικό και προετοι άστε την παρουσίασή σας προφορικά
χρησι οποιώντας εποπτικό υλικό. Η παρουσίαση συ πληρώνεται και γίνεται πληρέστερη ε
την παρέ βαση των υπολοίπων αθητών της ο άδας και του καθηγητή. Το τελευταίο
20λεπτο της 2ης διδακτικής ώρας οι αθητές απαντούν σε ερωτήσεις του φύλλου
αξιολόγησης και συ πληρώνουν τους πίνακες της γενικότερης αποτί ησης ατό ων και
ο άδων.


7. ραστηριότητες στη τάξη
α) Προβολή διαφανειών – βίντεο
Οι αθητές έχουν ήδη περιηγηθεί στο Ιστολόγιο “School Biology” και έχουν ανακτήσει: ι)
από τη θέση «Συγγρά ατα» το αρχείο «Βιολογία Γ΄ Γυ νασίου», ιι) από τη θέση
«Εκπαιδευτικό υλικό», τα αρχεία: «Αντιγραφή και έκφραση του γενετικού υλικού», «Γενετικό
υλικό. Αντιγραφή και έκφραση της γενετικής πληροφορίας».
Στην τάξη οι αθητές ανακτούν το υλικό ε την καθοδήγηση του καθηγητή και
ταυτόχρονα γίνεται προβολή διαφανειών και σχετικών βίντεο: 3Α, 3Β, 3Γ, 3?, 3
Ε
.

β) Ασκήσεις 1
η
: Μετάφραση δεδο!ένου !ορίου mRNA !ε τη βοήθεια του γενετικού κώδικα.

α) Η αλληλουχία βάσεων ενός mRNA:
1 5' GCUGCAUCAG AAGAGGCCAU CAAGCACAUC ACUGUCCUUC UGCCAUGGCC CUGUGGAUGC
61 GCCUCCUGCC CCUGCUGGCG CUGCUGGCCC UCUGGGGACC UGACCCAGCC GCAGCCUUUG
121 UGAACCAACA CCUGUGCGGC UCACACCUGG UGGAAGCUCU CUACCUAGUG UGCGGGGAAC
181 GAGGCUUCUU CUACACACCC AAGACCCGCC GGGAGGCAGA GGACCUGCAG GUGGGGCAGG
241 UGGAGCUGGG CGGGGGCCCU GGUGCAGGCA GCCUGCAGCC CUUGGCCCUG GAGGGGUCCC
301 UGCAGAAGCG UGGCAUUGUG GAACAAUGCU GUACCAGCAU CUGCUCCCUC UACCAGCUGG
361 AGAACUACUG CAACUAGACG CAGCCCGCAG GCAGCCCCCC ACCCGCCGCC UCCUGCACCG
421 AGAGAGAUGG AAUAAAGCCC UUGAACCAGC 3'

β) Τρόπος διεξαγωγής της δραστηριότητας
Γράψτε, ε τη βοήθεια του γενετικού κώδικα, την πρωτεΐνη που προκύπτει:
• Το κωδικόνιο έναρξης AUG της νουκλεοτιδικής αλληλουχίας ση ειώνεται ε έντονα
γρά ατα (θέση 45).
• Ση ειώστε τις τριπλέτες των νουκλεοτιδίων που ακολουθούν, έχρι να συναντήσετε το
πρώτο κωδικόνιο τερ ατισ ού (UGA, UAG ή UAA).

34
• Αναζητήστε στον πίνακα ε το γενετικό κώδικα τα α ινοξέα που αντιστοιχούν σε κάθε
κωδικόνιο και ση ειώστε τα ε τη σειρά, το ένα ετά το άλλο, έτσι ώστε να σχη ατίσετε στο
τετράδιο σας την αλληλουχία της πεπτιδικής αλυσίδας που προκύπτει.
• Για την εκτέλεση αυτής της άσκησης είναι καλύτερα να συνεργαστείτε ανά δύο άτο α.






35



37

Θέ!α 3
ο

α) Να περιγράψετε τη διαδικασία !ετάφρασης του mRNA.

Μονάδες 4
β) Να συ!πληρώσετε τα κενά στο κεί!ενο που ακολουθεί:

Κάθε τ ή α του ορίου DNA που έχει τη δυνατότητα να εταγραφεί ονο άζεται
........................ και αποτελεί την στοιχειώδη ονάδα της ........................... που εταβιβάζεται
από τους γονείς στα παιδιά τους. Οι διαδικασίες της αντιγραφής, της εταγραφής και της
ετάφρασης γίνονται ε τη βοήθεια ειδικών ........................ Οι διαδικασίες αυτές
συνοψίζονται στο .................. .................... της Βιολογίας, που εικονίζεται παρακάτω.



Μονάδες 4

γ) Να χαρακτηρίσετε ως σωστές ή λάθος τις ακόλουθες προτάσεις:
1) Κάθε φορά που απαιτείται η σύνθεση ιας πρωτεΐνης, το υπεύθυνο γονίδιο
εταγράφεται σε rRNA.
2) Κατά το στάδιο της έναρξης της πρωτεϊνοσύνθεσης το ένα άκρο του mRNA συνδέεται
ε τα όρια rRNA του ριβοσώ ατος.
3) Ο γενετικός κώδικας είναι διπλέτα, δηλαδή δύο αζωτούχες βάσεις αντιστοιχούν σε ένα
α ινοξύ.

Μονάδες 3

Καλή επιτυχία


38
Μάθη α: Βιολογία Γ΄ Γυ νασίου Η ερο ηνία:

Ονο ατεπώνυ ο:
Τ ή α:
ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ 4

1. Τίτλος
Κυτταρική διαίρεση. Μίτωση G Μείωση

2. Ε!πλεκό!ενες γνωστικές περιοχές
Βιολογία, Χη εία, Περιβαλλοντική εκπαίδευση, Βιοτεχνολογία, Κληρονο ικότητα,
Ασθένειες.

Λέξεις κλειδιά
Νουκλεοτίδια, διπλή έλικα DNA, χρω όσω α, χρω ατίδες, κυτταρική δο ή, πυρήνας,
κυτταρικά ινίδια, κυτταρική ε βράνη, διπλοειδή και απλοειδή κύτταρα, ο όλογα
χρω οσώ ατα.

3. Προαπαιτού!ενες γνώσεις
Χη ική δο ή του DNA, δο ή του χρω οσώ ατος, χρω ατίδες, κεντρο ερίδιο, κυτταρική
δο ή, κυτταροσκελετός, κυτταρικά ινίδια, γα έτες.





39
4. Στόχοι
Στο τέλος της διδασκαλίας της θε ατικής ενότητας ο αθητής θα πρέπει:
￿ Να αναγνωρίζει σε ποιες περιπτώσεις και φυσιολογικές λειτουργίες τα κύτταρα του
οργανισ ού διαιρούνται.
￿ Να διακρίνει τα στάδια του κυτταρικού κύκλου.
￿ Να διακρίνει τις διαφορές ανά εσα στα σω ατικά και γεννητικά κύτταρα.
￿ Να αναγνωρίζει ότι η ίτωση αποτελεί τον οναδικό τρόπο διαίρεσης των σω ατικών
κυττάρων και η είωση ο τρόπος δη ιουργίας των γα ετών από τα άωρα γεννητικά κύτταρα.
￿ Να αναγνωρίζει τις διάφορες κυτταρικές δο ές κατά τη διάρκεια της κυτταρικής
διαίρεσης.
￿ Να περιγράφει συνοπτικά τα στάδια της ίτωσης και της είωσης.
￿ Να αιτιολογεί το γεγονός ότι ετά την ίτωση τα θυγατρικά κύτταρα έχουν ένα
ακριβές αντίγραφο του γενετικού υλικού, ε ίδιο αριθ ό χρω οσω άτων, ενώ ετά τη
είωση οι γα έτες διαθέτουν το ισό αριθ ό των χρω οσω άτων.
￿ Να αιτιολογεί τις εταβολές στην ποσότητα του γενετικού υλικού κατά τα στάδια του
κυτταρικού κύκλου.
￿ Να διακρίνει διαφορές και ο οιότητες εταξύ της ίτωσης και της είωσης.

5. ιδακτική προετοι!ασία !αθητών
α) Από το σχολικό βιβλίο προετοι άστε την ενότητα 5.4, σελίδα 104C106.
β) Αναζητήστε πληροφορίες από το διαδίκτυο για την κυτταρική διαίρεση, την ίτωση και
είωση, την ιτωτική συσκευή, την γα ετογέννεση. Στο ιστολόγιο School Biology
(
http://blogs.sch.gr/kekbio/
) αναζητήστε πληροφορίες και υλικό.
γ) Στο You Tube αναζητήστε: cell division mitosis meiosis και επιλέγετε τα βίντεο που
σχετίζονται ε τις διαδικασίες της κυτταρικής διαίρεσης.
δ) Περιηγηθείτε στο λογισ ικό της Βιολογίας Α΄ και Γ΄ Γυ νασίου.


Με βάση τις κυτταρολογικές παρατηρήσεις ο
κύκλος ζωής του ευκαρυωτικού κυττάρου
διαιρείται σε δύο στάδια: τη !εσόφαση και την
κυτταρική διαίρεση. Η δο ή και η λειτουργία του
πυρήνα διαφέρει ση αντικά στα δύο στάδια. Η
εσόφαση και η ίτωση αποτελούν έναν κύκλο
(κυτταρικό κύκλο) και η ετάπτωση από το ένα
στάδιο στο άλλο είναι συνεχής.

Στο στάδιο της κυτταρικής διαίρεσης το
ακανόνιστο δίκτυο της χρω ατίνης οργανώνεται σε
χαρακτηριστικούς σχη ατισ ούς, που ονο άζονται
χρω!οσώ!ατα. Οι περισσότεροι ευκαρυωτικοί
οργανισ οί προέρχονται από την σύντηξη του
αρσενικού !ε το θηλυκό γα!έτη. Το ζυγωτό κύτταρο
που προκύπτει ετά τη γονι οποίηση περιέχει
γενετικό υλικό προερχό ενο και από τους δύο γονείς.
Το κύτταρο αυτό, όπως και κάθε κύτταρο του νέου οργανισ ού ονο άζεται διπλοειδικό και
ο οργανισ ός διπλοειδής και αυτό συ βολίζεται ε 2n. Κατά την κυτταρική διαίρεση ενός
διπλοειδικού κυττάρου, τα χρω!οσώ!ατα βρίσκονται σε ζεύγη, ανά δύο ορφολογικά
ό οια, τα οποία ονο άζονται ο!όλογα και προέρχονται το ένα από τον αρσενικό και το άλλο
από το θηλυκό γα έτη.


40




Σε όλα τα κύτταρα που διαιρούνται ιτωτικά αναγνωρίζου ε πέντε βασικά στάδια: την
!εσόφαση, όπου το κύτταρο αντιγράφει το γενετικό του υλικό και ανασυγκροτεί τις
κυτταρικές δο ές, την πρόφαση, την !ετάφαση, την ανάφαση και την τελόφαση. Οι
τέσσερις τελευταίες φάσεις συνιστούν τη φάση της !ίτωσης, κατά την οποία συ πυκνώνεται
η χρω ατίνη και ε φανίζονται τα χρω οσώ ατα, διαλύεται η πυρηνική ε βράνη,
συγκροτείται η ιτωτική άτρακτος, τα χρω οσώ ατα συγκεντρώνονται στο ιση ερινό
επίπεδο, οι χρω ατίδες του κάθε χρω οσώ ατος αποχωρίζονται και τα χρω οσώ ατα
κινούνται προς τους πόλους της ατράκτου. Ακολουθεί αποσυ πύκνωση των χρω οσω άτων,
δη ιουργία των θυγατρικών πυρήνων και η κυτταρική διαίρεση ολοκληρώνεται ε την
διαίρεση του κυτταροπλάσ ατος και τη δη ιουργία των δύο νέων κυττάρων. Μιτωτική
διαίρεση συ!βαίνει κατά την ανάπτυξη του οργανισ!ού, κατά την επούλωση των
τραυ!άτων, κατά την ανανέωση των κυττάρων της επιδερ!ίδας που φθείρονται, κ.λ.π.

Τα γεννητικά κύτταρα του οργανισ!ού (ωάρια ή σπερ!ατοζωάρια) περιέχουν το !ισό
αριθ!ό χρω!οσω!άτων σε σχέση ε τα σω ατικά κύτταρα. Επο ένως, είναι ανάγκη τα
κύτταρα αυτά να παράγονται, ε ια διαδικασία που ειώνει τον αριθ ό των χρω οσω άτων
τους στο ισό, χωρίς ό ως να αλλάζει την αντιπροσωπευτικότητα όλων των γονιδίων του
οργανισ ού, τα οποία έστω και σε απλοειδική κατάσταση πρέπει να περιέχονται στα

41
γεννητικά κύτταρα. Η διαδικασία αυτή ονο άζεται !είωση και συνίσταται από οκτώ φάσεις,
όπου στην αρχή χωρίζονται τα ο όλογα χρω οσώ ατα και στην συνέχεια οι χρω ατίδες των
χρω οσω άτων. Με αυτό το ηχανισ ό προκύπτουν τέσσερα απλοειδικά κύτταρα (n) από
κάθε άωρο (πρόδρο!ο) γεννητικό διπλοειδικό κύτταρο. Τα άωρα γεννητικά κύτταρα του
ανθρώπου, τα οποία έχουν 46 χρω οσώ ατα, δη ιουργούν ε τη είωση γα έτες ε 23
χρω οσώ ατα.

Βίντεο από το λογισ!ικό
Βιολογίας της Γ΄ Γυ!νασίου

ΠΡΟΒΟΛΗ ΒΙΝΤΕΟ: 4Α, 4Β, 4Γ, 4, 4Ε, 4Ζ, 4Η



6. Παρουσίαση στην τάξη
Αξιοποιείστε το διαδικτυακό υλικό και προετοι άστε την παρουσίασή σας προφορικά
χρησι οποιώντας εποπτικό υλικό. Η παρουσίαση συ πληρώνεται και γίνεται πληρέστερη ε
την παρέ βαση των υπολοίπων αθητών της ο άδας και του καθηγητή. Το τελευταίο
20λεπτο της 2ης διδακτικής ώρας οι αθητές απαντούν σε ερωτήσεις του φύλλου
αξιολόγησης.

42
7. ραστηριότητες στη τάξη
α) Προβολή διαφανειών – βίντεο
Οι αθητές έχουν ήδη περιηγηθεί στο Ιστολόγιο “School Biology” και έχουν ανακτήσει: ι)
από τη θέση «Συγγρά ατα» το αρχείο «Βιολογία Γ΄ Γυ νασίου», ιι) από τη θέση
«Εκπαιδευτικό υλικό», το αρχείο: «Κυτταρική %ιαίρεση».
Στην τάξη οι αθητές ανακτούν υλικό από το διαδίκτυο, ε την καθοδήγηση του
καθηγητή και ταυτόχρονα γίνεται προβολή διαφανειών και σχετικών βίντεο: 4Α, 4Β, 4Γ, 4?,
4Ε, 4Ζ, 4Η.
β) Παιχνίδι !ε το λογισ!ικό Βιολογίας


γ) Το παρακάτω διάγρα α περιγράφει τον κυτταρικό κύκλο. Να χαρακτηρίσετε τις
διάφορες φάσεις του κυτταρικού κύκλου.


43

δ) Το παρακάτω διάγρα α απεικονίζει την κυτταρική διαίρεση. Να αναγνωρίσετε τους
δύο τρόπους κυτταρικής διαίρεσης, τις επι έρους φάσεις και τις κυτταρικές δο ές.




44

Μάθη α: Βιολογία Γ΄ Γυ νασίου Η ερο ηνία:

Ονο ατεπώνυ ο:
Τ ή α:
ΦΥΛΛΟ ΑΞΙΟΛΟΓΗΣΗΣ 4


Κυτταρική διαίρεση. Μίτωση G Μείωση

Θέ!α 1
ο


Αν τα !εταφασικά χρω!οσώ!ατα στο άλογο είναι 64, να συ!πληρώσεις τον πίνακα
που ακολουθεί:

α) Μόρια DNA σω ατικού κυττάρου πριν την αντιγραφή α)
β) Μόρια DNA στη εσόφαση ετά την αντιγραφή β)
γ) Χρω ατίδες στο τέλος της εσόφασης γ)
δ) Χρω οσώ ατα στη ετάφαση της ίτωσης δ)
ε) Μόρια DNA στη ετάφαση της ίτωσης ε)
στ) Φυλετικά χρω οσώ ατα στο σπερ ατοζωάριο στ)
ζ) ) Αυτοσω ατικά χρω οσώ ατα στο σπερ ατοζωάριο ζ)
η) Φυλετικά χρω οσώ ατα σε ένα νευρικό κύτταρο η)
Μονάδες 4

β) Να αναγνωρίσετε τις φάσεις του κυτταρικού κύκλου και της κυτταρικής
διαίρεσης:

Α. Β. Γ. . Ε.


Μονάδες 2
Θέ!α 2
ο


Να επιλέξετε από τις προτεινό ενες φράσεις αυτή που συ πληρώνει σωστά τις παρακάτω
προτάσεις:
1) Το διπλανό σχή!α παριστάνει ανάφαση:
α. δεύτερης ειωτικής διαίρεσης κυττάρου ε 2 χρω οσώ ατα
β. ίτωσης κυττάρου ε 4 χρω οσώ ατα
γ. ίτωσης κυττάρου ε 2 χρω οσώ ατα
δ. δεύτερης ειωτικής διαίρεσης κυττάρου ε 4 χρω οσώ ατα


45
2) Ποιο διάγρα!!α από τα παρακάτω δείχνει τη σωστή τοποθέτηση των
χρω!οσω!άτων στη !ετάφαση της πρώτης !ειωτικής διαίρεσης, διπλοειδούς κυττάρου
!ε 2 χρω!οσώ!ατα;


3) Στο παρακάτω σχή!α τα , Ε, Ζ και Η είναι τέσσερα θυγατρικά κύτταρα που
προκύπτουν από το κύτταρο Α !ε !είωση. Με δεδο!ένο ότι δεν συ!βαίνει κάποια
χρω!οσω!ική ανω!αλία, ποια κύτταρα !πορεί είναι γενετικά ό!οια;
α. τα Β, Γ
β. τα Α, Β, Γ
γ. τα ?, Ε και Ζ,Η
δ. τα Β, Γ, ?, Ε, Ζ, Η
4) Κατά τη !εσόφαση:
α. Το κύτταρο αυξάνεται σε όγκο και προετοι άζεται για την αντιγραφή και την
κυτταρική διαίρεση.
β. Τα χρω οσώ ατα αυξάνονται σε όγκο και προετοι άζουν το διαχωρισ ό τους.
γ. Το κύτταρο περιέχει διπλάσιο αριθ ό χρω οσω άτων.
δ. Τίποτε από τα παραπάνω.
Μονάδες 8

Θέ!α 3
ο

α) Να συ!πληρώσετε τα κενά στο κεί!ενο που ακολουθεί:

Πριν από την έναρξη της κυτταρικής διαίρεσης έχει προηγηθεί η ____________ του DNA
και συνεπώς ο διπλασιασ ός της γενετικής πληροφορίας. Οι ____________ χρω ατίδες είναι
ενω ένες σε ια περιοχή τους που ονο άζεται ______________ .
Κατά την έναρξη της ίτωσης τα χρω οσώ ατα συσπειρώνονται και αρχίζουν να
____________, ε τη βοήθεια των ___________________, ώστε να διαταχθούν σε ένα
_______________ στο κέντρο του κυττάρου. Στη συνέχεια τα χρω οσώ ατα διαχωρίζονται
και η κάθε ______________ ετακινείται στους πόλους του κυττάρου. Το
________________ διαιρείται και δη ιουργούνται δύο νέα κύτταρα.
Μονάδες 4

β) Να χαρακτηρίσετε ως σωστές ή λάθος τις ακόλουθες προτάσεις:
1) Κατά τη ίτωση τα ο όλογα χρω οσώ ατα διατάσσονται σε ζεύγη, το ένα απέναντι
από το άλλο.
2) Κατά τη 2
η
ειωτική διαίρεση αποχωρίζονται τα ο όλογα χρω οσώ ατα.
3) Κατά την 1
η
ειωτική διαίρεση ο αριθ ός των χρω οσω άτων ειώνεται στο ισό.
4) Κατά τη είωση προκύπτουν τέσσερα διπλοειδή κύτταρα.
Μονάδες 2

Καλή επιτυχία



46
Μάθη α: Βιολογία Γ΄ Γυ νασίου Η ερο ηνία:

Ονο ατεπώνυ ο:
Τ ή α:
ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ 5

1. Τίτλος
Αλληλό!ορφα γονίδια. Κληρονο!ικότητα. Οι νό!οι του Μέντελ.

2. Ε!πλεκό!ενες γνωστικές περιοχές
Βιολογία, Χη εία, Περιβαλλοντική εκπαίδευση, Βιοτεχνολογία, Κληρονο ικότητα,
Ασθένειες.

Λέξεις κλειδιά
?ιπλοειδείς οργανισ οί, γονίδιο, αλληλό ορφα γονίδια, ο όζυγο, ετερόζυγο, επικρατές,
υπολειπό ενο, κληρονο ικό χαρακτηριστικό, επίκτητο χαρακτηριστικό, κληρονο ικότητα,
γονότυπος, φαινότυπος, Μέντελ, νό ος ο οιο ορφίας, νό ος ανεξάρτητου διαχωρισ ού,
αναλογίες φαινοτύπων.

3. Προαπαιτού!ενες γνώσεις
Χη ική δο ή του DNA, αντιγραφή, γονίδιο, κυτταρική διαίρεση, είωση, γα έτες,
γενετικός κώδικας, πρωτεϊνοσύνθεση.





47
4. Στόχοι
Στο τέλος της διδασκαλίας της θε ατικής ενότητας ο αθητής θα πρέπει:
￿ Να αντιλα βάνεται ότι τα αλληλό ορφα αποτελούν διαφορετικές παραλλαγές της
ίδιας γενετικής πληροφορίας.
￿ Να συσχετίζει την δη ιουργία των αλληλο όρφων ε αλλαγές στις αζωτούχες βάσεις
και να αντιλα βάνεται ότι η αλλαγή στην τριπλέτα του γενετικού κώδικα έχει ως συνέπεια
την αλλαγή του α ινοξέος.
￿ Να διακρίνει τα αλληλό ορφα (και τα αντίστοιχα χαρακτηριστικά που καθορίζονται
από αυτά) σε επικρατή και υπολειπό ενα.
￿ Να διακρίνει τους διπλοειδείς οργανισ ούς σε ο όζυγους και ετερόζυγους για
συγκεκρι ένα χαρακτηριστικά.
￿ Να εντοπίζει ο οιότητες και διαφορές ανά εσα σε επικρατή και υπολειπό ενα
χαρακτηριστικά καθώς και ανά εσα σε ο όζυγα και ετερόζυγα άτο α.
￿ Να συνδέει τα αλληλό ορφα ε την ε φάνιση ή η διαφόρων χαρακτηριστικών
(λοβοί αυτιών, πτύχωση γλώσσας, χρώ α αλλιών, κλπ).
￿ Να συσχετίζει τη γενετική ποικιλότητα των οργανισ ών ε την ύπαρξη διαφορετικών
αλληλο όρφων.
￿ Να ορίζει την κληρονο ικότητα και να διακρίνει τα χαρακτηριστικά των οργανισ ών
σε κληρονο ικά και επίκτητα.
￿ Να διατυπώνει τους νό ους του Μέντελ και να εξηγεί τον τρόπο κληρονό ησης
διαφόρων χαρακτηριστικών.
￿ Να επιλύει απλά προβλή ατα ονοϋβριδισ ού.

5. ιδακτική προετοι!ασία !αθητών
α) Από το σχολικό βιβλίο προετοι άστε την ενότητα 5.3, σελίδες 103C104 και την ενότητα
5.5, σελίδες 107C110.
β) Αναζητήστε πληροφορίες από το διαδίκτυο για τα αλληλό ορφα γονίδια, τις έννοιες
ο όζυγοCετερόζυγο, επικρατέςCυπολειπό ενο. κληρονο ικότητα, νό οι του Μέντελ. Στο
ιστολόγιο School Biology (
http://blogs.sch.gr/kekbio/
) αναζητήστε πληροφορίες και υλικό.
Από τη θέση «Εκπαιδευτικό υλικό» ανακτήστε τα αρχεία: «Γενετική», «Μεντελική
κληρονο ικότητα», «Γενετικό υλικό H Κληρονο ικότητα», «Ασκήσεις Γενετικής».
γ) Στο You Tube αναζητήστε: allele, homozygous, heterozygous, recessive and
dominant inheritance, Mendel’s law, monohybrid cross και επιλέγετε τα βίντεο που
σχετίζονται ε την κληρονο ικότητα.
δ) Περιηγηθείτε στο λογισ ικό της Βιολογίας Α΄ και Γ΄ Γυ νασίου.

ΑΛΛΗΛΟΜΟΡΦΑ






48
ΝΟΜΟΙ ΤΟΥ Mendel

1ος νό!ος του Mendel ή νό!ος της ο!οιο!ορφίας
Τα άτο α που προέρχονται από διασταύρωση ο όζυγων γονέων, οι οποίοι διαφέρουν
σε ένα ή περισσότερα χαρακτηριστικά είναι ο οιό ορφα εταξύ τους ως προς τα
χαρακτηριστικά αυτά.

2ος νό!ος του Mendel ή νό!ος του ανεξάρτητου διαχωρισ!ού
Όταν διασταυρώνου ε ετερόζυγα άτο α, επανε φανίζονται στους απογόνους τους τα
χαρακτηριστικά των γονέων τους ε καθορισ ένη αναλογία.

Κληρονο!ικότητα

Είναι γνωστό και εύκολα πορεί να παρατηρηθεί ότι όλα τα άτο α του ίδιου είδους έχουν
την ίδια ορφή. Επίσης, ορισ!ένα χαρακτηριστικά της !ητέρας ή του πατέρα
!εταφέρονται αυτούσια στους απογόνους (χρώ α ατιών, αλλιών, κ.λ.π). Η εταβίβαση
χαρακτηριστικών από τους γονείς στους απογόνους, δηλαδή η κληρονο!ικότητα, είναι
ιδιότητα όλων των οργανισ ών ( ονοκύτταρων και πολυκύτταρων, φυτικών και ζωικών).
Ταυτόχρονα εταξύ των οργανισ ών, που ανήκουν στο ίδιο είδος διακρίνου ε καταπληκτική
ποικιλότητα. Ξεχωρίζου ε τους φίλους ας, το Γιώργο και τον ?η ήτρη και τους
διακρίνου ε από άλλα πρόσωπα όπως ο αδελφός ας. Ο κλάδος της Βιολογίας που
προσπαθεί να κατανοήσει πώς διατηρείται η ποικιλότητα !εταξύ των ειδών και
συγχρόνως πώς προκύπτει και κληρονο!είται !έσα στο είδος ονο!άζεται Γενετική.
Ό ως, αν και η Γενετική αφορά την κληρονο ικότητα, ο ορισ ός της ε τον τρόπο αυτό δεν
είναι επαρκής. Μέχρι το 1865, παρά το εγάλο ενδιαφέρον για την κληρονο ικότητα, δεν
υπήρχε Γενετική επιστή η, αφού δεν είχε βρεθεί ένας τρόπος ανάλυσης της γενετικής
πληροφορίας. Ο τρόπος αυτός επινοήθηκε από έναν Αυστριακό οναχό, τον Γρηγόριο
Μέντελ. Η έθοδος της ανάλυσής του που χρησι οποιείται ακό η και σή ερα λέγεται
Γενετική. Η πιο ση αντική πρόοδος που έκανε ήταν ο καθορισ ός ή η αναγνώριση ιας
ονάδας που σή ερα ονο άζου ε γονίδιο.
Το γενετικό υλικό βρίσκεται στο κύτταρο σε ζεύγη ο!ολόγων χρω!οσω!άτων στους
διπλοειδικούς οργανισ ούς. Αυτό ση αίνει ότι τα γονίδια βρίσκονται σε δύο αντίγραφα, ένα
σε κάθε ο όλογο χρω όσω α. Αυτά τα δύο γονίδια, που βρίσκονται στην ίδια θέση των
ο ολόγων χρω οσω άτων, ελέγχουν την ίδια ιδιότητα και λέγονται αλληλό!ορφα γονίδια.
Τα δύο αλληλό ορφα γονίδια, πολλές φορές εκφράζουν την ιδιότητα ε ποσοτική και
ποιοτική διαβάθ ιση. Όταν τα αλληλό ορφα γονίδια εκφράζουν την ιδιότητα ε τον ίδιο
ακριβώς τρόπο, τότε το συγκεκρι ένο άτο ο λέγεται ο!όζυγο για το χαρακτηριστικό αυτό
και τα γονίδια λέ ε ότι βρίσκονται σε ο!οζυγωτία.
Μια ιδιότητα, όπως το χρώ α των ατιών ή των αλλιών, το σχή α ή το χρώ α ενός
άνθους σε ένα φυτό, πορεί να εκφράζεται ε διαφορετικό τρόπο στα άτο α του ίδιου είδους.
Το χρώ α των ατιών πορεί να είναι γαλανό, πράσινο, καστανό ή αύρο και το χρώ α των

49
αλλιών ξανθό, αύρο, καστανό ή κοκκινωπό. Για όλες αυτές τις εκφράσεις του ίδιου
χαρακτηριστικού, υπάρχουν υπεύθυνα γονίδια, που συνδυάζονται για να δώσουν το
αποτέλεσ α. Όταν τα αλληλό ορφα γονίδια εκφράζουν την ίδια ιδιότητα ε διαφορετικό
τρόπο, για παράδειγ α το ένα γονίδιο να εκφράζει το αύρο χρώ α και το άλλο το γαλανό,
λέ ε ότι τα γονίδια βρίσκονται σε ετεροζυγωτία και το άτο ο λέγεται ετερόζυγο ή υβρίδιο
για το χαρακτηριστικό αυτό.
Στα ετερόζυγα άτο α, από τις δύο διαφορετικές εκφράσεις των αλληλο όρφων γονιδίων,
όνο η ία τελικά υπερισχύει και δίνει το χαρακτηριστικό γνώρισ α στο άτο ο. Το υπεύθυνο
γονίδιο που υπερισχύει ονο άζεται επικρατές, ενώ το δεύτερο αλληλό ορφο ονο άζεται
υπολειπό!ενο. Όταν το επικρατές αλληλό ορφο γονίδιο βρεθεί ε το υπολειπό ενό του, το
επικρατές είναι αυτό που θα επικαλύψει τη δράση του άλλου. Οι επιστή ονες συνηθίζουν
να συ βολίζουν ε κεφαλαίο γρά α το επικρατές γονίδιο και ε το αντίστοιχο ικρό το
υπολειπό ενο.

Παράδειγ!α : Έστω ότι το επικρατές γονίδιο για τα αύρα αλλιά το συ βολίζου ε ε Μ
και το υπολειπό ενο αλληλό ορφο για τα ξανθά αλλιά ε . Η ητέρα είναι ο όζυγη για το
χαρακτηριστικό αύρα αλλιά και ο πατέρας ο όζυγος για τα ξανθά. Συ βολικά πορού ε
να γράψου ε:
!! (πατέρας) X ΜΜ ( ητέρα)
το κάθε γρά!!α συ!βολίζει το κάθε ο!όλογο χρω!όσω!α.
Οι γα!έτες που θα προκύψουν και θα δώσουν τους απογόνους είναι της ορφής: ! για τα
σπερ!ατοζωάρια και Μ για τα ωάρια. Έτσι, τα παιδιά του ζευγαριού θα πάρουν το Μ της
ητέρας και το του πατέρα και θα είναι ετερόζυγα για το χαρακτηριστικό αυτό, δηλαδή θα
είναι Μ και θα έχουν αύρο χρώ α αλλιών, αφού το γονίδιο για το αύρο χρώ α είναι
επικρατές.
Αν οι δύο γονείς είναι ετερόζυγοι ε αύρα αλλιά (Μ ), τότε ο καθένας θα δώσει δύο
ειδών γα έτες (ωάρια ή σπερ ατοζωάρια), Μ και . Μπορού ε να συ βολίσου ε τη
διασταύρωση ως εξής:
γονείς : Μ! (πατέρας) X M! ( ητέρα)
γα έτες : Μ , ! (σπερ ατοζωάρια) και Μ , ! (ωάρια)


παιδιά: ΜΜ Μ! !Μ !!

Οι πιθανότητες να γεννηθούν παιδιά ε αύρο χρώ α αλλιών είναι 75 % και ε ξανθό 25
%. Από τα παιδιά ε αύρο χρώ α αλλιών το 33 % θα είναι ο όζυγα και το 67 %
ετερόζυγα. Οι στατιστικές αυτές αναλογίες δεν πορούν να εφαρ οστούν στον άνθρωπο ή
άλλα θηλαστικά που αφήνουν λίγους απογόνους. Συνεπώς, η γέννηση του παιδιού είναι
ανεξάρτητο γεγονός που δεν σχετίζεται !ε τις προηγού!ενες ή επό!ενες γεννήσεις.
Αν ο ένας γονέας είναι ο όζυγος για τα ξανθά αλλιά και ο άλλος ετερόζυγος ε αύρα
αλλιά, τότε τα παιδιά τους έχουν πιθανότητα 50 % να έχουν ξανθά ή αύρα αλλιά. Η
διασταύρωση πορεί να συ βολιστεί ως εξής:

γονείς : Μ! (πατέρας) X !! ( ητέρα)
γα έτες : Μ , ! (σπερ ατοζωάρια) και ! , ! (ωάρια)


παιδιά: Μ! Μ! !! !!
50 % αύρα αλλιά, 50 % ξανθά αλλιά

50
ΦΑΙΝΟΤΥΠΟΣ G ΓΟΝΟΤΥΠΟΣ


Ο γονότυπος αναφέρεται στο σύνολο των αλληλο όρφων γονιδίων ενός οργανισ ού, ενώ
ο φαινότυπος στα παρατηρού ενα βιοχη ικά, φυσιολογικά ή ορφολογικά χαρακτηριστικά
που καθορίζονται από τον γονότυπο, αλλά και από την αλληλεπίδραση του γονοτύπου !ε το
περιβάλλον.
Με βάση τους παραπάνω ορισ ούς, προκύπτει ότι τα χαρακτηριστικά γνωρίσ ατα το κάθε
άτο ο, τα φέρει από την γέννησή του και είναι απόρροια της έκφρασης του γονότυπου και
συνεπώς είναι κληρονο!ήσι!α. Υπάρχουν ό ως και γνωρίσ ατα που το άτο ο αποκτά κατά
τη διάρκεια της ζωής του ετά την επίδραση ενός περιβαλλοντικού παράγοντα, όπως η ουλή
από ένα τραυ ατισ ό και επο ένως δεν κληρονο ούνται. Αυτά τα χαρακτηριστικά λέγονται