Chapter 13 (Genetic Engineering)

neighgreasycornerBiotechnology

Dec 14, 2012 (4 years and 10 months ago)

182 views

Molecular
Biology



DNA Fingerprint


a sequence of bands that shows a
persons DNA sequence


How to make a DNA Fingerprint

1.
DNA Extraction


Cell is opened and the DNA is separated from the
other cell parts

2. Cutting
DNA


DNA is so long we cut it into smaller fragments


Restriction Enzymes


cut DNA at a specific sequence
of nucleotides



EcoRI

-

CTTAA



Ex:
ACTGCTTAAGGCATTGCCTTAACAGGCTA




Bam I
-

CCTAG








Ex: GCTTACCCTAGATGACGTTACTTACAGGC




Hae

III
-

CCGG




Ex: CCGATACGCTCCGGACTACCGGATCCGGAT


3.
Separating DNA


Gel Electrophoresis


a technique for separating DNA


DNA is negatively charged


Load DNA into gel


Apply electric voltage to gel


DNA will move through gel to positive


Smaller DNA fragments move faster and further



How do you end up with different size fragments that are
unique to each individual?


Tandem Repeat


region of a chromosome that
contains multiple copies of a DNA sequence


The origin and significance of tandem repeats is a
mystery


For forensic scientists they offer a means of
distinguishing one individual from another through DNA
fingerprinting


30% of human genome is composed of tandem repeats.


Tandem repeats seem to act as filler or spacers
between the gene regions of DNA



Fig. 16.7, p. 259

FROM

BLOOD

AT CRIME

SCENE

1

2

3

4

5

6

7

PCR



PCR


Polymerase Chain Reaction


process
of making
many copies of genes


Heat DNA to separate two strands


As it cools DNA polymerase starts making copies


Repeat this process and end up with millions of copies


DNA heated to
separate strands

PCR cycles

DNA copies

1

2

3

4

5 etc.

1

2

4

8

16 etc.

Polymerase Chain Reaction (PCR)

DNA polymerase adds
complementary strand

DNA fragment to be
copied

13
-
3 Cell
Transformation



Transformation


one organism is changed by a gene or
genes from another organism


Genetic Engineering


method of cutting DNA from one
organism and inserting the DNA into another organism


Recombinant DNA


DNA made by recombining fragments
of DNA from different sources


Plasmid


Extra circular DNA found in some bacteria


Very useful for DNA transfer from one organism into
another



Process of Transformation

1.
Cut out gene of interest with restriction enzyme

2.
Use same restriction enzyme to cut plasmid


This creates ends on each that will match up

3.
Combine the gene of interest with the plasmid

4.
Place the recombinant DNA into a bacteria cell

5.
Bacteria will replicate this new DNA and make many
copies of the gene of interest



13
-
4 Applications of Genetic
Engineering



When recombinant DNA is put into a host that organism
will use the foreign DNA as if it were its own.


Transgenic Organisms


contain functional foreign DNA


Ex. Glowing bacteria


Fig. 16.12, p. 263

Application of DNA
Technology



Transgenic bacteria in agriculture


A bacteria on strawberry plants promotes frost damage
on leaves. The gene for this protein is removed and
frost damage is prevented.


A bacteria that lives in soil and in the roots of plants
can be engineered to increase the rate of conversion of
atmospheric nitrogen to nitrates, a natural fertilizer, to
help cut back on fertilizer use and cost


Transgenic bacteria in industry


Used to clean up oil spills


Extract valuable minerals from ores



Transgenic bacteria in medicine


The production of growth hormone to treat dwarfism


Human insulin used to treat diabetes


Transgenic plants


Have been genetically engineered to resist herbicides,
produce internal pesticides or increase their protein
production.


Produce rice with vitamin A


In 2000 52% of soybeans and 25% of corn grown in US
was genetically modified



Transgenic Animals


Make animals grow faster and produce leaner meat


Trying to produce chickens resistant to bacterial
infections that cause food poisoning


Cows produce different human proteins in their milk




Cloning



Clone


genetically identical offspring produced from a
single cell


In 1997 Scottish scientist Ian
Wilmut

cloned first mammal,
a sheep named Dolly




14
-
3 Human Molecular Genetics

Human Genome
Project



Human Genome Project


An international effort to completely map and sequence
the human genome


Started in 1990 and completed in 2000


How did they do it?


First determined markers


a sequence of bases in
widely separated regions of DNA


Cut DNA into random fragments


Determined sequences of the fragments


Computers found areas of overlap between the
fragments



One surprise was how few genes humans have


Fruit fly


14,000


Tiny worm


20,000


Human


25,000




A human diploid cell contains more than 3 billion base
pairs


Only about 2% of the DNA in your chromosomes functions
as genes


The average human gene consists of about 3000 base
pairs


The largest gene in the human genome has more than 2
million base pairs



Chromosome 22 and 21 were the first 2 human
chromosomes sequenced


Chromosome 22


Contains approximately 43 million base pairs


545 genes


1 causes leukemia


1 neurofibromatosis


Chromosome 21


Approximately 32 million base pairs


225 genes


Lou
Gehrigs

disease (ALS)


loss of muscle control due
to destruction of nerves in the brain and spinal cord