1 Submitted to Applied and Environmental Microbiology, Physiology ...

mumpsimuskneesBiotechnology

Feb 12, 2013 (4 years and 4 months ago)

155 views

1

Submitted to Applied and Environmental Microbiology, Physiology and Biotechnology section 1
2
3
Production of the Phytohormone Indole-3-acetic Acid by Estuarine Species of the Genus Vibrio 4
5
Casandra K. Gutierrez, George Y. Matsui, David E. Lincoln, and Charles R. Lovell*

6
7
Department of Biological Sciences 8
University of South Carolina 9
Columbia, South Carolina 29208 10
11
*
Corresponding author contact information: 12
Mailing Address: Dept. of Biological Sciences, 700 Sumter St., Columbia, SC, 29208 13
Phone: 803-777-5084 14
FAX: 803-777-4002 15
Email: lovell@biol.sc.edu 16
17
Running title: IAA production by Vibrio species 18
Keywords: Vibrio, indole acetic acid, estuarine grasses 19
Copyright © 2009, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
Appl. Environ. Microbiol. doi:10.1128/AEM.02072-08
AEM Accepts, published online ahead of print on 13 February 2009
2

Abstract 20
21
Strains of Vibrio isolated from roots of the estuarine grasses Spartina alterniflora and Juncus 22
roemerianus produce the phytohormone indole-3-acetic acid (IAA). The colorimetric Salkowski 23
assay was used for initial screening of IAA production. Gas chromatography-mass spectroscopy 24
(GC-MS) was then employed to confirm and quantify IAA production. The accuracy of IAA 25
quantification by the Salkowski assay was examined by comparison to GC-MS assay values. 26
Indole-3-acetamide, an intermediate in IAA biosynthesis by the indole-3-acetamide pathway, 27
was also identified by GC-MS. Multilocus sequence typing of concatenated 16S rRNA, recA 28
and rpoA genes was used for phylogenetic analysis of environmental isolates within the genus 29
Vibrio. Eight Vibrio type strains and 5 additional species-level clades containing a total of 16 30
environmental isolates and representing 5 presumptive new species were identified as IAA 31
producing Vibrio species. Six additional environmental isolates allied with 4 of the Vibrio type 32
strains were also IAA producers. To our knowledge, this is the first report of IAA production by 33
species of the genus Vibrio or by bacteria isolated from an estuarine environment. 34
3

Introduction 35
36
Estuaries along the east coast of temperate North America are ecologically valuable, productive 37
systems dominated by only a few species of plants. Spartina alterniflora (smooth cord grass, 38
Spartina hereafter) is a keystone species responsible for very high rates of primary production in 39
Atlantic coast marshes and is a major contributor to the global cycling of several elements (10, 40
14, 15, 35, 38, 39, 45). Juncus roemerianus (black needle rush, Juncus hereafter) is a common 41
subdominant species (28) residing in areas of higher elevation, having lower salinity and less 42
frequent tidal inundation. The roots of these macrophytes are associated with a diverse 43
assemblage of microorganisms, including N
2
fixing and sulfate reducing bacteria, which greatly 44
contribute to their productivity (30, 31). 45
46
The phytohormone indole-3-acetic acid (IAA) is the most commonly occurring naturally 47
produced auxin and the most thoroughly studied plant growth regulator. IAA directs several 48
aspects of plant growth and development (37), including the induction and regulation of a variety 49
of processes: e.g. cell division, root extension, vascularization, apical dominance and tropisms 50
(6, 32). The effects of IAA on plant root tissue are concentration dependent and can be species 51
specific. Responses to increasing IAA concentrations advance from stimulation of primary root 52
tissue, to development of lateral and adventitious roots, to complete cessation of root growth (1, 53
6, 16, 29, 32, 37, 44). 54
55
Many microorganisms interact with and affect their environment through the production and 56
transudation of signal compounds (17). Numerous studies demonstrate that a variety of plant-57
4

associated terrestrial bacteria produce and exude IAA (e.g. 8, 23, 25, 37). Auxin synthesis by 58
cynanobacteria has also been reported (40). IAA is thought to reduce the integrity of plant cell 59
walls by upregulating the production of cellulases and hemicelluloses, resulting in the leakage of 60
some simple sugars and other nutrients that would benefit root-associated microorganisms (17). 61
Likewise, root growth would be an advantage to resident bacteria due to increased availability of 62
root exudates and root surface for growth. Microorganisms that produce IAA can influence the 63
host plant and function as pathogens, symbionts or growth regulators depending on how their 64
IAA production influences the concentration of the plant’s endogenous IAA pool, and based 65
upon the sensitivity of the plant to auxin. Organisms such as Erwinia chrysanthemi, 66
Pseudomonas savastanoi and Agrobacterium tumefaciens are phytopathogens of many host 67
plants (11, 21, 23, 46). Other species including Azospirillum brasilense and Pseudomonas 68
putida GR12-2 have proven beneficial to plants and many IAA producers have been shown to 69
stimulate increases in root mass and or length (20, 37, 44). 70
71
The aim of the present study was to assess IAA synthesis by Vibrio strains isolated from the 72
roots of highly productive salt marsh grasses. The Salkowski assay was used to perform an 73
initial screening for the presence of IAA, gas chromatography-mass spectroscopy (GC-MS) 74
verified and quantified IAA production, and MLST analysis placed all isolates within the genus 75
Vibrio. 76
77
Materials and Methods 78
79
5

Bacterial Strains and Growth Conditions: All environmental strains used in this study were 80
isolated from the rhizoplanes of Spartina and Juncus collected from the North Inlet salt marsh 81
near Georgetown, S.C. (33°20′N: 79°12′W) by Bagwell et al. (3). Briefly, short form Spartina 82
was collected in January 1994, tall form Spartina and Juncus were collected in June 1995. Roots 83
measuring ~1.25mm or less in diameter, from several plants were rinsed with deionized water, 84
then stab inoculated into nitrogen free semisolid media having a pH of either 7.0 or 7.5 and 85
containing various carbon sources (3). These root cultures were incubated in the dark at 30°C 86
until bacterial outgrowths from the root surfaces were apparent, then the outgrowths were 87
transferred by stab inoculation into fresh semisolid media. Strains were isolated by streaking on 88
nitrogen free medium plates and maintained on Bacto Marine Agar (Difco, Sparks, Md.). Strain 89
designations indicate the source plant (J for Juncus, S for short form Spartina, T for tall form 90
Spartina), carbon source used in the enrichment medium (C for citrate, G for glucose, M for 91
malate, and S for sucrose), and pH of the medium (1 for pH 7.0, 2 for pH 7.5). For example, J-92
C2-35 was isolated from Juncus (J) using citrate as a carbon source at pH 7.5 (C2) and was the 93
thirty fifth strain streaked to isolation (35). These rhizoplane isolates were characterized by 94
Bagwell et al. (3) for Gram reaction, cell size, shape, arrangement, motility, production of 95
endospores, production of cytochrome oxidase, peroxidase, and several extracellular enzymes, 96
then further characterized using API test strips (Fisher, Pittsburg, Pa.) and BIOLOG plates 97
(Hayward, Calif.) for a variety of physiological properties and the utilization of various 98
substrates. The 25 strains employed in this study were identified as Vibrio species on the basis 99
of the above tests and 16S rRNA sequencing (see below). Eight Vibrio type strains (Table 1) 100
were included in the Salkowski and GC-MS analyses and sequences from 39 type strains were 101
included in the multilocus sequence analysis (Fig 1). 102
6

103
The minimal medium employed by Bagwell et al. (3) was used for experiments examining IAA 104
production. The basal medium contained (g L
-1
): NaCl, 28; Na
2
MoO
4
, 0.01; Tris HCL, 6.0; 105
NH
4
Cl, 5.0, pH 7.0. After autoclaving this medium was amended with the following (final 106
concentrations): 2 mM MgSO
4
, 400 µM CaCl
2
, 11 mM glucose, 30 mM K
2
HPO
4
, 50 µM FeCl
3
107
and 0.98 mM (200 g ml
-1
) tryptophan (Trp). IAA production was not detectable in media 108
lacking Trp. 109
110
Quantification of IAA using the Salkowski Assay: All strains were incubated in triplicate, in 2 111
ml of minimal medium at 30°C in the dark with shaking for 72 h. Culture supernatants were 112
recovered after centrifugation at 6000 × g for 10 min. One ml of supernatant was mixed with 1 113
ml of Salkowski’s reagent R1 (12 g L
-1
FeCl
3
in

429 ml L
-1
H
2
SO
4
). After room temperature 114
incubation in the dark for 20 min, absorbance was determined at 535 nm (18). IAA 115
concentrations were determined using triplicate standard curves of authentic IAA (Sigma-116
Aldrich, St. Louis, Mo.), prepared in basal medium. 117
118
Quantification of IAA by Gas Chromatography-Mass Spectroscopy (GC-MS): Triplicate 119
ten ml cultures of each isolate were grown, with shaking, at 30°C in the dark. After incubation 120
for 72 h, the internal standard 5-methoxy-indole-3-acetic acid (5-Me-IAA, Sigma-Aldrich) was 121
added to a final concentration of 5 g ml
-1
. Supernatants were collected immediately after 122
centrifugation at 4°C (6000 × g) for 10 min. IAA and similar compounds were extracted from 123
the supernatants as described by Minamisawa et al. (34) with minor modifications. Briefly; 5 ml 124
of supernatant was adjusted to pH 2.5-3.0 with HCl and partitioned 3 times against 1/3 volume of 125
7

spectranalyzed grade diethyl ether (Fisher). Ether phases were combined and evaporated to 126
dryness in the dark under a stream of N
2
gas. Samples were then reconstituted in 5 ml of Optima 127
LC/MS grade acetonitrile (Fisher) and stored overnight in the dark at 4°C. A 1 ml sample was 128
removed from each extract and evaporated to dryness in a rotary evaporator. Samples were 129
reconstituted in 50 l of acetonitrile, mixed 1:1 with bis(trimethylsilyl)trifluoroacetamide 130
(BSTFA, Sigma-Aldrich), and trimethylsilyated for 15 min at 70°C. Samples were analyzed 131
with a Hewlett Packard 5890 Series II Gas Chromatograph-5971 Series Mass Selective Detector 132
system with autosampler. Electron impact ionization at 70eV was used. GC-MS conditions 133
were as follows: column, DB-5 (30 m × 0.25 mm × 0.025 mm film thickness); carrier gas, He; 134
injection temperature, 280°C; initial temperature, 100°C for 3 min. followed by an increase of 135
5°C min
-1
to a final temperature of 230°C; detector temp, 280°C. The mass to charge ratio (m z
-
136
1
) was monitored from 50-335 using scan mode. Integrated IAA and 5-Me-IAA peak areas were 137
compared to triplicate standard curves of authentic IAA and 5-Me-IAA and used to calculate 138
IAA quantities. Cell counts were performed using a hemocytometer (Hausser Scientific, 139
Horsham, Pa.) with phase contrast microscopy at a total magnification of 1,000X. 140
141
Multi-Locus Sequence Typing (MLST): Bacterial genomic DNA was extracted using the 142
Wizard Genomic DNA Purification Kit (Promega, Madison, Wis.). PCR was performed to 143
amplify the near full-length 16S rRNA gene sequences using primers 27F and 1492R (26), and 144
partial recA and rpoA sequences using recA1F, recA2R, rpoAF1 and rpoA3R (43) as listed in 145
Table 2. Taq DNA polymerase (Qiagen, Valencia, Calif.) was used for all PCR reactions. The 146
PCR program for the amplification of 16S rRNA gene sequences was: initial denaturation, 94°C 147
for 1 min; three cycles of 95°C for 1 min, 40°C for 1 min, 72°C for 1 min 30 s; thirty cycles of 148
8

95°C for 1 min, 43°C for 1 min, 72°C for 1 min 30 s; final elongation, 72°C for 5 min. The PCR 149
program used for amplification of the recA and rpoA sequences consisted of an initial 150
denaturation at 95°C for 5 min, then three cycles of 95°C for 1 min, 55°C for 2 min 15 s, and 151
72°C for 1 min 15 s, followed by thirty cycles of 95°C for 35 s, 55°C for 1 min 15 s and 72°C for 152
1 min 15 s and a final elongation at 72°C for 7 min (43). PCR products were sequenced using 153
primers 519F, 529R, 907R, 1099F and 1240R for 16S rRNA genes (26, 47), and primers recA1F, 154
recA2R, recA3F, recA4R, rpoA1F, rpoA3R, rpoA5F and rpoA6R (43) (Table 2). Sequencing of 155
amplicons was performed using Big Dye Terminator version 3.1 Cycle Sequencing Kit (Applied 156
Biosystems, Foster City, Calif.) and an ABI Prism 3730 DNA analyzer. Sequences were edited 157
using BioEdit version 7.0.9 (http://www.mbio.ncsu.edu/BioEdit/BioEdit.html) and ClustalX2 158
(27). Neighbor-joining trees were constructed using the Jukes-Cantor nucleotide substitution 159
model from concatenated 16S rRNA, recA and rpoA gene sequences with Mega version 4.0 (42). 160
Sequence data of reference Vibrio species were obtained from GenBank. 161
162
GenBank Accession Numbers: Nucleotide sequences determined in this study were submitted 163
to GenBank under the accession numbers FJ176405-FJ176467 and FJ464357-FJ464371. 164
165
Results and Discussion. 166
167
Eight Vibrio type strains and 25 environmental strains of Vibrio species isolated from Spartina 168
and Juncus rhizoplanes were screened for IAA production using the colorimetric Salkowski 169
assay and GC/MS (Table 1). Uninoculated media contained no detectable IAA. The Salkowski 170
assay indicated a range of from 0.00 g ml
-1
IAA by Vibrio fischeri (ATCC 700601) to 171
9

21.43±3.58 (mean±S.D.) g ml
-1
by strain J-S2-8 (Table 1). Of the eight type strains, only V. 172
fischeri was negative for IAA production by the Salkowski assay. All of the Vibrio type strains 173
and all 25 environmental isolates listed in Table 1 were analyzed using GC-MS for verification 174
and quantification of auxin production. IAA production was quantified in 22 of the 25 175
environmental isolates and all 8 type strains. The other 3 environmental strains had no 176
detectable IAA, with detection sensitivity of 0.01 g ml
-1
. IAA from Vibrio culture supernatants 177
had an observed retention time of 25.4 min and produced a spectrum identical to that of authentic 178
IAA with a parent ion of 319 m z
-1
and daughter ions of 304, 276, 202, 186 and 147 m z
-1
(Fig. 179
2A, B). Strain T-S2-9 produced a considerably higher concentration of IAA (13 g ml
-1
) than 180
the others and strain J-C1-1a-GR2 produced the lowest concentration (0.12 g ml
-1
). GC-MS 181
results were substantially lower than those of the Salkowski assay for 32 of the 33 IAA 182
producing strains. This is likely due to reaction of the Salkowski reagent with indole derivatives 183
other than IAA (13, 18). Considering this potential for cross-reaction with other compounds, the 184
Salkowski assay would be considered less accurate than the GC/MS assay, though still useful for 185
screening large numbers of strains due to its relative ease of use and low cost. As data from V. 186
fischeri indicate (Table 1), the relative insensitivity of the Salkowski assay can lead to false 187
negative results from strains producing low levels of IAA. Confirmation of the Salkowski assay 188
by GC/MS is important for assurance of accurate IAA detection and quantification. 189
190
Indole-3-acetamide (IAM) was detected in the culture supernatants of 21 of the 22 IAA 191
producing environmental isolates and in 6 of the 8 type strains analyzed. The observed spectrum 192
matched that of authentic IAM (33), with a retention time of approximately 28.2 min, a parent 193
ion of 318 m z
-1
and daughter ions of 303, 202 and 130 m z
-1
(Fig. 2C). V. diazotrophicus 194
10

(ATCC 33466), V. hispanicus (LMG 13240), and J-C2-38 supernatants did not contain IAM. 195
The three known pathways for microbial synthesis of IAA are 1) the indole-3-acetonitrile (IAN) 196
pathway (Trp → indole-3-acetaldoxime → IAN → IAA), 2) the indole-3-acetamide (IAM) 197
pathway (Trp → IAM → IAA), and 3), and the indole-3-pyruvic acid (IPA) pathway (Trp → 198
IPA → indole-3-acetaldehyde → IAA). The IAM and IPA pathways appear to be more 199
commonly utilized by bacteria, though there have also been reports of auxin production via the 200
IAN route (22, 23). While these pathways are all Trp dependent, Trp independent pathways, as 201
yet uncharacterized, have also been proposed (6). 202
203
The presence of IAM in culture supernatants of these Vibrio species may indicate the use of the 204
IAM pathway for synthesis of IAA, but microorganisms have been shown to use multiple IAA 205
synthesis pathways (8) and this may be the case with some of these strains. At present, our 206
investigations of these strains have not yielded any evidence of the IPA pathway, as we did not 207
detect the IPA pathway intermediate indole-3-acetaldehyde (IAAld). IAAld may not be 208
produced by these vibrios or it may have spontaneously oxidized to IAA or indole-3-ethanol (6, 209
13, 24). Detection of IAM in culture supernatants provides a useful starting point for 210
investigations of the pathway(s) employed by vibrios for auxin production, which will be a 211
subject of future studies. 212
213
Multilocus sequence typing, employing concatenated near-full length 16S rRNA gene sequences 214
and >80% length of recA and rpoA gene sequences (43), was used to determine phylogenetic 215
affiliations of the 25 environmental isolates analyzed for IAA production (Fig. 1). We included 216
39 reference species (sequence data obtained from GenBank) in our analysis. Estuarine isolates 217
11

were found to form 5 clades. Clade 1 includes J-C1-1a-GR2 and J-C1-25; clade 2, J-M2-6; clade 218
3 includes J-S2-12, J-S2-17, J-S2-25, J-S2-26 and T-G2-12w-B2; clade 4 includes J-S2-6, T-G2-219
10-B2, T-S2-7, T-S2-8 and S-G1-1-B1; finally clade 5 is composed of J-S2-8, T-C2-3, T-C2-8 220
and T-S2-9. Isolates J-C2-35, J-C2-40 and T-C2-11 grouped closely to Vibrio natriegens while 221
J-C2-20op, S-C1-5 and S-C1-13 grouped with Vibrio parahaemolyticus. Isolates S-M2-14-B1 222
and J-C2-38 appear to be strains of Vibrio pacinii and Vibrio fluvialis, respectively (Fig. 1). 223
Production of IAA was broadly distributed across the genus Vibrio and species recovered from 224
quite different niches produced auxin in culture. This may imply a broader association of Vibrio 225
species with marine and estuarine plants than previously thought, which is consistent with the 226
frequent recovery of these organisms (e.g. 3, 4, 7, 28) and their signature sequences (e.g. 5, 9, 30, 227
31) from such sources. 228
229
Synthesis of IAA by many terrestrial bacteria has been well documented (for a recent review see 230
41). IAA production by freshwater wetland rhizosphere bacteria (19) and an ascosporogenous 231
yeast (Pichia spartinae) associated with Spartina in Louisiana marshes (36) has also been 232
reported, but prior to this study, auxin production had not been examined in marine or estuarine 233
bacteria. Auxin production by estuarine Vibrio presents the potential for dynamic interspecies 234
communication. To date, the highly diverse assemblage of microorganisms in the salt marsh 235
remains largely unexplored. In these systems primary production and decomposition are limited 236
by combined nitrogen, which is primarily obtained through diazotrophy (2, 35). Most of the 237
Vibrio strains analyzed in this study are diazotrophic

and were recovered from the rhizoplane 238
(Lovell, unpublished data). N
2
fixation activity of salt marsh diazotrophs has been shown to 239
increase in response to treatments that encourage plant growth and development, indicating a 240
12

tight coupling between plant productivity and closely associated diazotrophs (2). An increase in 241
root surface area, due to stimulation by IAA, would provide enhanced opportunity for the 242
synthesis of usable nitrogen. 243
244
The Vibrio strains examined in this study have the capacity to interact with their host plants 245
through molecular signaling pathways, possibly contributing to cycles of growth and senescence. 246
Though we presently know very little of these interactions or their consequences, they may play 247
a role in shaping the estuarine landscape, contributing to the accretion of plant biomass and the 248
cycling of carbon. While physical factors such as drought, season and semidiurnal tidal flushing 249
of the rhizosphere are likely to affect exogenous IAA concentration and therefore its effects on 250
host plants, the finding of IAA production by plant associated Vibrio species is certainly of 251
interest and is being explored through ongoing plant inoculation studies. 252
253
Acknowledgements 254
This research was supported by NSF award MCB-0237854 to C.R.L. C.K.G. also received 255
support from NIH award R25 GM076277 to Bert Ely. We acknowledge Mike Friez for 256
assistance with DNA sequencing. 257
258
259
260
261
262
263
13

References 264
265
1. Alvarez, R., S. J. Nissen, and E. G. Sutter. 1989. Relationship between indole-3-acetic 266
acid levels in apple (Malus pumila Mill.) rootstocks cultured in vitro and adventitious 267
root formation in the presence of indole-3-butyric acid. Plant Physiol. 89:439-443. 268
269
2. Bagwell, C. E., and C. R. Lovell. 2000. Persistence of selected Spartina alterniflora 270
rhizoplane diazotrophs exposed to natural and manipulated environmental variability. 271
Appl. Environ. Microbiol. 66:4625-4633. 272
273
3. Bagwell, C. E., Y. M. Piceno, A. Ashburne-Lucas, and C. R. Lovell. 1998. 274
Physiological diversity of the rhizosphere diazotroph assemblages of selected salt marsh 275
grasses. Appl. Environ. Microbiol. 64:4276-4282. 276
277
4. Bagwell, C.E., M. Dantzler, P.W. Bergholz, and C.R. Lovell. 2001. Host-specific 278
ecotype diversity of rhizoplane diazotrophs of the perennial glasswort Salicornia 279
virginica and selected salt marsh grasses. Aq. Microb. Ecol. 23:293-300. 280
281
5. Bagwell, C.E., J.R. LaRocque, G.W. Smith, S.W. Polson, M.J. Friez, J.W. 282
Longshore, and C.R. Lovell. 2002. Molecular diversity of diazotrophs in oligotrophic 283
seagrass bed communities. FEMS Microbiol. Ecol. 39:113-119. 284
285
14

6. Bartel, B. 1997. Auxin biosynthesis. Annu. Rev. Plant Physiol. Plant Molec. Biol. 48:51-286
66. 287
288
7. Bergholz, P.W., C.E. Bagwell, and C.R. Lovell. 2001. Physiological diversity of 289
rhizoplane diazotrophs of the saltmeadow cordgrass, Spartina patens: Implications for 290
host specific ecotypes. Microb. Ecol. 42:466-473. 291
292
8. Brandl, M. T., B. Quinones, and S. E. Lindow. 2001. Heterogeneous transcription of 293
an indoleacetic acid biosynthetic gene in Erwinia herbicola on plant surfaces. Proc. Natl. 294
Acad. Sci. 98:3454-3459. 295
296
9. Brown, M.M., M.J. Friez, and C.R. Lovell. 2003. Expression of nifH genes by 297
diazotrophic bacteria in the rhizosphere of short form Spartina alterniflora. FEMS 298
Microbiol. Ecol. 43:411-417. 299
300
10. Capone, D. G., and E. J. Carpenter. 1982. Nitrogen fixation in the marine environment. 301
Science. 217:1140-1142. 302
303
11. Chatterjee, A. K., and M. P. Starr. 1980. Genetics of Erwinia species. Annu. Rev. 304
Microbiol. 34:645-676. 305
306
15

12. Criminger, J. D., T. H. Hazen, P. A. Sobecky and C. R. Lovell. 2007. Nitrogen 307
fixation by Vibrio parahaemolyticus and its implications for a new ecological niche. 308
Appl. Environ. Microbiol. 73:5959-5961. 309
310
13. Crozier, A., P. Arruda, J. Jasmim, A. M. Monteiro, and G. Sandberg. 1988. Analysis 311
of indole-3-acetic acid and related indoles in culture medium from Azospirillum 312
lipoferum and Azospirillum brasilense. Appl. Environ. Microbiol. 54:2833-2837. 313
314
14. Czako, M., X. Feng, Y. He, D. Liang, and L. Marton. 2006. Transgenic Spartina 315
alterniflora for phytoremediation. Environ. Geochem. Heal. 28:103-110. 316
317
15. Dame, R. F., and P. D. Kenny. 1986. Variability of Spartina alterniflora primary 318
production in the euhaline north inlet estuary. Mar. Ecol. Prog. Ser. 32:71-80. 319
320
16. Davies, P. J. 1995. The plant hormone concept: concentration, sensitivity, and transport, 321
p. 13-18. In P. J. Davies (ed.), Plant hormones: physiology, biochemistry, and molecular 322
biology. Kluwer Academic Publishers, Dordrecht, The Netherlands. 323
324
17. Fry, S. C. 1989. Cellulases, hemicelluloses and auxin-stimulated growth: a possible 325
relationship. Physiol. Plant. 75:532-536. 326
16

327
18. Glickmann, E., and Y. Dessaux. 1994. A critical examination of the specificity of the 328
Salkowski reagent for indolic compounds produced by phytopathogenic bacteria. Appl. 329
Environ. Microbiol. 61:793-796. 330
331
19. Haida-Alija, L. 2003. Identification of indole-3-acetic acid producing freshwater 332
wetland rhizosphere bacteria associated with Juncus effuses L. Can. J. Microbiol. 333
49:781-787. 334
335
20. Holguin, G., C. L. Patten, and B. R. Glick. 1999. Genetics and molecular biology of 336
Azospirillum. Biol. Fertil. Soils. 29:10-23. 337
338
21. Hugouvieux-Cotte-Pattat, N., G. Condemine, W. Nasser, and S. Reverchon. 1996. 339
Regulation of pectinolysis in Erwinia chrysanthemi. Annu. Rev. Microbiol. 50:213-257. 340
341
22. Kobayashi, M., H. Izui, T. Nagasawa, and H. Yanada. 1993. Nitrilase in biosynthesis 342
of the plant hormone indole-3-acetic acid from indole-3-acetonitrile: cloning of the 343
Alcaligenes gene and site directed mutagenesis of cysteine residues. Proc. Natl. Acad. 344
Sci. 90:147-251. 345
346
17

23. Kobayashi, M., T. Suzuki, T. Fujita, M. Masuda, and S. Shimizu. 1995. Occurrence 347
of enzymes involved in biosynthesis of indole-3-acetic acid from indole-3-acetonitrile in 348
plant-associated bacteria, Agrobacterium and Rhizobium. Proc. Natl. Acad. Sci. 92:714-349
718. 350
351
24. Koga, J., T. Adachi, and H. Hidaka. 1991. IAA biosynthetic pathway from tryptophan 352
via indole-3-pyruvic acid in Enterobacter cloacae. Agric. Biol. Chem. 55:701-706. 353
354
25. Koga, J., T. Adachi, and H. Hidaka. 1992. Purification and characterization of indole 355
pyruvate decarboxylase. J. Biol. Chem. 267:15823-15828. 356
357
26. Lane, D. J. 1991. 16S/23S rRNA sequencing, pp. 115–175. In E. Stackebrandt and M. 358
Goodfellow (ed.), Nucleic acid techniques in bacterial systematics. John Wiley & Sons, 359
Chichester, United Kingdom. 360
361
27. Larkin, M. A., G. Blackshields, N. P. Brown, R. Chenna, P. A. McGettigan, H. 362
McWilliam, F. Valentin, I. M. Wallace, A. Wilm, R. Lopez , J. D. Thompson, T. J. 363
Gibson, and D. G. Higgins. 2007. Clustal W and Clustal X version 2.0. Bioinformatics. 364
23:2947-2948. 365
366
18

28. LaRocque, J.R., P.W. Bergholz, C.E. Bagwell, and C.R. Lovell. 2004. Influence of 367
host plant-derived and abiotic environmental parameters on the composition of the 368
diazotroph assemblage associated with roots of Juncus roemerianus. Antonie Van 369
Leeuwenhoek. 86:249-261. 370
371
29. Leveau, J. H. J. and S. E. Lindow. 2005. Utilization of the plant hormone indole-3-372
acetic acid for growth by Pseudomonas putida strain 1290. Appl. Environ. Microbiol. 373
71:2365-2371. 374
375
30. Lovell, C. R., Y. M. Piceno, J. M. Quattro, and C. E. Bagwell. 2000. Molecular 376
analysis of diazatroph diversity in the rhizosphere of the smooth cordgrass, Spartina 377
alterniflora. Appl. Environ. Microbiol. 66:3814-3822. 378
379
31. Lovell, C.R., P.V. Decker, C.E. Bagwell, M. Friez, and G.Y. Matsui. 2008. Analysis 380
of a diverse assemblage of diazotrophic bacteria from Spartina alterniflora using DGGE 381
and clone library screening. J. Microbiol. Methods 73:160-171. 382
383
32. Meuwly, P., and P.-E. Pilet. 1991. Local treatment with indole-3-acetic acid induces 384
differential growth responses in Zea mays L. roots. Planta 185:58–64. 385
386
19

33. Michalczuk, L., and P. Druart. 1999. Indole-3-acetic acid metabolism in hormone-387
autotrophic, embryogenic callus of Inmil cherry rootstock (Prunus incisa_serrula ‘GM9’) 388
and in hormone-dependent, nonembryogenic calli of Prunus incisa_serrula and Prunus 389
domestica. Physiol. Plant. 107:426-432. 390
391
34. Minamisawa, K., K. Ogawa, F. Hideyuki, and J. Koga. 1996. Indolepyruvate pathway 392
for indole-3-acetic acid biosynthesis in Bradyrhizobium elkanii. Plant Cell Physiol. 393
37:449-453. 394
395
35. Morris, J. T., and B. Haskin. 1990. A 5-year record of aerial primary production and 396
stand characteristics of Spartina alterniflora. Ecology. 71:2209-2217. 397
398
36. Nakamura, T. T. Murakami, M. Saotome, K. Tomita, T. Kitsuwa and S.P. Meyers. 399
1991. Identification of indole-3-acetic acid in Pichia spartinae, an ascosporogenous yeast 400
from Spartina alterniflora marshland environments. Mycologia 83:662-664 401
402
37. Patten, C. L., and B. R. Glick. 2002. Role of Pseudomonas putida indoleacetic acid in 403
development of the host plant root system. Appl. Environ. Microbiol. 68: 3795-3801. 404
405
20

38. Pomeroy, L. R. 1970. The strategy of mineral cycling. Annu. Rev. Ecol. System. 1:170-406
190. 407
408
39. Pomeroy, L. R., and R. G. Wiegert. 1981. The ecology of a salt marsh. Ecol. Stud. 38 409
New York: Springer-Verlag. 410
411
40. Sergeeva, E., A. Liaimer, and B. Bergman. 2002. Evidence for production of the 412
phytohormone indole-3-acetic acid by cyanobacteria. Planta. 215:229-238. 413
414
41. Spaepen, S., J. Vanderleyden, and R. Remans. 2007. Indole-3-acetic acid in 415
microbial and microorganism-plant signaling. FEMS Microbiol. Rev. 31:425–448. 416
417
42. Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007. MEGA4: molecular evolutionary 418
genetics analysis (MEGA) Software Version 4.0. Mol. Biol. Evol. 24:1596-1599. 419
420
43. Thompson, F. L., D. Gevers, C. C. Thompson, P. Dawnydt, S. Naser, B. Hoste, C. B. 421
Munn and J. Swings. 2005. Phylogeny and molecular identification of vibrios on the 422
basis of multilocus sequence analysis. Appl. Environ. Microbiol. 71:5107-5115. 423
424
21

44. Tien, T. M., M. H. Gaskins, and D. H. Hubbell. 1979. Plant growth substances 425
produced by Azospirillum brasilense and their effect on the growth of pearl millet 426
(Pennisetum americanum). Appl. Environ. Microbiol. 37:1016-1024. 427
428
45. Turner, R E. 1976. Geographic variations in salt marsh macrophyte production: a 429
review. Contrib. Mar. Sci. 20:47–68. 430
431
46. Yang, S., Q. Zhang, J. Guo, A. O. Charkowski, B. R. Glick, M. A. Ibekwe, D. A. 432
Cooksey, and C. H. Yang. 2007. Global effect of indole-3-acetic acid on multiple 433
virulence factors of Erwinia chrysanthemi 3937. Appl. Environ. Microbiol. 73:1079-434
1088. 435
436
47. Zhou, J.-Z., M. R. Fries, J. C. Chee-Sanford, and J. M. Tiedje. 1995. Phylogenetic 437
analyses of a new group of denitrifiers capable of anaerobic growth on toluene: 438
Description of Azoarcus tolulyticus sp. nov. Int. J. Syst. Bacteriol. 45:500–506. 439
440
441
442
443
444
445
22

Figure Legends 446
447
Figure 1. Neighbor-joining phylogenetic tree of concatenated 16S rRNA, recA and rpoA gene 448
sequences constructed using the Jukes-Cantor method of correction. Strains represented in bold 449
produced IAA. Bootstrap values represent 1000 replications; values less than 50 are not shown. 450
451
Figure 2. Mass spectra of (A) authentic indole-3-acetic acid (IAA) with a parent ion of 319 m z
-1
452
(6) and daughter ions of 147(1), 186 (2), 202 (3), 276 (4), and 304 (5) m z
-1
; (B) IAA extracted 453
from strain J-C1-25 culture supernatant with parent and daughter ions present; and (C) Indole-3-454
acetamide extracted from J-C1-25 culture supernatant with a parent ion of 318 (4) and daughter 455
ions of 130 (1), 202 (2) and 303 (3). 456
457
458
459
460
461
462
463
464
465
466
467
468
469
470
23

Table 1. Comparison of indole-3-acetic acid (IAA) quantification by GC-MS and the Salkowski 471
assay (mean ±standard deviation, n=3). Environmental strain designations are by host plant (J = 472
Juncus, S = short form Spartina, T = tall form Spartina), carbon source used for isolation (C = 473
citrate, G = glucose, M = malate, S = sucrose), pH of isolation medium (1 = 7.0, 2 = 7.5) and 474
strain number. Calculations of cell-specific IAA production employed results from the GC-MS 475
method. 476
477
IAA concentration (g ml
-1
)

Isolate GC-MS Salkowski assay cells ml
-1
fg IAA cell
-1
S-C1-5 0.00 4.75 ± 0.33 1.80 × 10
9
0.00
S-C1-13 0.00 1.46 ± 1.57 1.70 × 10
9
0.00
T-G2-10-B2 0.00 0.92 ± 0.03 5.70 × 10
9
0.00
J-C1-1aGR2 0.12 ± 0.04 10 .00± 1.15 4.00 × 10
8
0.30
V. hispanicus
(LMG 13240)
0.13 ± 0.02 1.09 ± 0.28 4.28 × 10
8
0.30
J-C1-25 0.14 ± 0.01 8.98 ± 0.53 1.32 × 10
9
0.11
V. fischeri
(ATCC 700601)
0.17 ± 0.03 0.00 5.10 × 10
9
0.033

V. alginolyticus
(ATCC 17749)
0.22 ± 0.06 4.06 ± 1.21 1.25 × 10
9
0.18
T-C2-11 0.28 ± 0.05 8.00 ± 0.87 2.48 × 10
9
0.11
S-M2-14-B1 0.28 ± 0.12 3.96 ± 0.15 7.33 × 10
8
0.38
V. diazotrophicus
(ATCC 33466)
0.42 ± 0.05 1.47 ± 0.97 1.22 × 10
9
0.34
V. parahaemolyticus
(ATCC 17802)
0.42 ± 0.06 8.91 ± 0.57 1.81 × 10
9
0.23
T-S2-8 0.46 ± 0.05 5.67 ± 0.11 4.16 × 10
9
0.11
S-G1-1-B1 0.58 ± 0.18 4.83 ± 0.74 1.59 × 10
9
0.36
J-S2-6 0.45 ± 0.19 4.10 ± 0.72 1.58 × 10
9
0.29
T-S2-7 0.77 ± 0.33 4.21 ± 0.17 1.92 × 10
9
0.40
V. fluvialis
(ATCC 33809)
0.88 ± 0.14 12.03 ± 0.58 2.05 × 10
9
0.43
J-C2-38 0.92 ± 0.26 7.74 ± 1.61 2.79 × 10
9
0.33
J-C2-40 1.26 ± 0.43 9.83 ± 0.83 2.09 × 10
9
0.60
J-S2-26 2.01 ± 0.16 5.52 ± 0.36 3.42 × 10
9
0.59
V. natriegens
(ATCC 14048)
2.45 ± 0.42 2.69 ± 0.12 4.85 × 10
8
5.1
J-S2-17 2.46 ± 0.13 4.75 ± 1.09 1.03 × 10
9
2.38
J-S2-12 3.08 ± 0.91 5.53 ± 0.60 2.73 × 10
9
1.13
T-G2-12w-B2 3.40 ± 0.38 5.63 ± 1.02 5.68 × 10
9
0.60
J-S2-25 4.09 ± 0.80 4.85 ± 0.19 2.49 × 10
9
1.64
J-S2-8 4.80 ± 1.15 21.43 ± 3.58 3.64 × 10
9
1.32
24

J-C2-35 4.83 ± 0.74 12.57 ± 0.84 2.36 × 10
9
2.05
T-C2-8 4.90 ± 2.27 20.15 ± 1.99 3.07 × 10
9
1.60
V. pacinii
(LMG 19999)
5.20 ± 0.64 10.39 ± 0.77 6.80 × 10
8
7.65
J-C2-20op 5.22 ± 1.09 8.23 ± 0.91 2.12 × 10
9
2.46
J-M2-6 5.71 ± 1.07 6.69 ± 1.02 7.90 × 10
8
7.23
T-C2-3 8.04 ± 3.12 16.69 ± 1.52 3.20 × 10
9
2.51
T-S2-9 12.78 ± 1.45 18.60 ± 2.77 3.00 × 10
9
4.27
478
479
480
481
482
483
484
485
486
487
488
489
490
491
492
493
494
495
496
25

Table 2. Primers used in this study (5’-3’) for amplification and sequencing of recA, rpoA and 497
16S rRNA genes 498

Primer

Sequence Reference




recA1F TGARAARCARTTYGGTAAAGG

43
recA2R TCRCCNTTRTAGCTRTACC 43
recA3F TYGGBGTGATGTTYGGTAACC 43
recA4R GGGTTACCRAACATCACVCC 43
rpoA1F ATGCAGGGTTCTGTDACAG 43
rpoA3R

GHGGCCARTTTTCHARRCGC 43
rpoA5F GCAGCDCGTGTWGARCARCG 43
rpoA6R

CGYTGYTCWACACGHGCTGC 43
27F AGAGTTTGATCMTGGCTCAG 26
1492R GCYTACCTTGTTACGACTT 26
519F CAGCAGCCGCGGTAA 12
529R CGCGGCTGCTGGCAC 12
907R CCCCGTCAATTCCTTTGAGTTT

12
1099F GCAACGAGCGCAACCC 12
1240R

CCATTGTAGCACGTGT 12

499
500
501
J-C2-40
J-C2-35
V. natriegens (ATCC 14048)
T-C2-11
J-C1-1a-GR2
J-C1-25
V. mytili (ATCC 51288)
V. harveyi (ATCC 14126)
V. campbelli (ATCC 25920)
V. alginolyticus (ATCC 17749)
J-C2-20op
V. parahaemolyticus (ATCC 17802)
S-C1-13
S-C1-5
V. vulnificus (ATCC 27562)
V. aestuarianus (ATCC 35048)
V. diazotrophicus (ATCC 33466)
V. hispanicus (LMG 13240)
V. scophthalmi (CECT 4638)
V. ichthyoenteri (LMG 19664)
S-M2-14-B1
V. pacinii (LMG 19999)
V. orientalis (ATCC 33934)
V. tubiashi (ATCC 19109)
V. gallicus (LMG 21330)
J-M2-6
J-S2-17
J-S2-12
J-S2-25
T-G2-12WB2
J-S2-26
S-G1-1-B1
T-S2-7
T-S2-8
T-G2-10-B2
J-S2-6
V. aerogenes (ATCC 70079)
V. gazogenes (ATCC 29988)
V. cincinnatiensis (ATCC 35912)
V. cholerae (ATCC 14035)
V. mimicus (ATCC 33653)
J-C2-38
V. fluvialis (ATCC 33809)
V. furnissii (ATCC 35016)
V. proteolyticus (ATCC 15338)
J-S2-8
T-C2-3
T-S2-9
T-C2-8
V. mediterranei (CIP 103203)
V. fortis (LMG 21557)
V. chagasii (LMG 13237)
V. pomeroyi (LMG 20537)
V. cyclitrophicus (LMG 21359)
V. kanaloae (LMG 20539)
V. splendidus (ATCC 33125)
V. tasmaniensis (LMG 21574)
V. nigripulchritudo (ATCC 27043)
V. penaeicida (LMG19663)
V. logei (ATCC 15382)
V. fischeri (ATCC 700601)
V. fischeri (ATCC 7744)
Enterovibrio coralii (LMG 22228)
Shewanella oneidensis (ATCC 70050)
100
100
100
52
100
100
100
100
54
68
99
98
100
100
97
100
100
96
99
97
94
91
63
100
100
100
55
51
100
82
73
100
100
100
99
99
72
91
91
87
64
94
99
0.01
CLADE 1
CLADE 2
CLADE 3
CLADE 4
CLADE 5
ABC
6
1 2
3
4
5
1
2
3
4
1
2
3
4
5
6