Tucson High School Biotechnology Course Spring 2010

lessfrustratedBiotechnology

Oct 23, 2013 (3 years and 10 months ago)

82 views

Tucson High School

Biotechnology Course

Spring 2010

What do marine viruses do?

Infect and Kill

What do marine viruses do?

Transfer Genes

+

+

Ex: Photosynthesis genes!!

10
28

base pairs of DNA per year in world’s oceans


10,000,000,000,000,000,000,000,000,000

What do marine viruses do?

Alter their hosts

Vibrio

cholerae

+

Cholera

toxin

What do they infect?

What genes do they transfer?

How do they alter their host?

We need to use genetics…

UNIVERSAL genes


Bacteria have 16S gene

Eukaryotes have 18S gene

NO universal gene for viruses!!

So we use CONCERVED genes

How will WE use genetics?

… to find out what type of virus we have.

Myovirus

Podovirus

psbA

DNA
pol

g23

X

X

X

X

PCR

DNA
pol

Forward primer

Reverse primer

standard

standard

psbA

DNA

pol

g23

How will WE use genetics?

… to find out what type of virus we have.

Myovirus

Podovirus

psbA

DNA
pol

g23

X

X

X

X

Transmission Electron Microscope

Myovirus
???

e
-

e
-

e
-

What then?

PCR only tells us PRESENCE or ABSENCE

DNA Sequencing

a
t
a
t
gg
a
t
c
g
a
g
c
tt
g
a
c

A string of letters…
yay
.

We need BIOINFORMATICS!

Bioinformatics and Genomics

Bonnie Hurwitz

Graduate student

TMPL

What can you do with a sequence?

Gene Sequence

Align it with

g
ene sequences from

o
ther species

Create a phylogeny

s
howing how closely

r
elated species are to

one another

Understand Functionally

Meaningful Genetic Diversity

15
T4
-
like
myoviruses

from a
diversity of hosts

0.1 substitutions per position

GP2

MIT 9302

MIT 9201

MIT 9312

MIT 9401

AS9601

SB

MIT 9314

MIT 9301

MIT 9215

RS810

MIT 9107

MB11F02

MB11E08

MED4

MIT 9515

MIT 9211

NATL2A

PAC1

NATL1A

SS120

MIT 9303

MIT 9313

RS8015

WH 8406

WH 8112

WH 8102

WH 8103

MB11A04

MB11E09

EBAC392

WH 6501

WH 8012

WH 8005

WH 8002

WH 8109

WH 8020

WH 9908

WH 8015

MIT S9220

WH 8017
, WH 8018

RS9705

WH 7803

WH 8101

WH 5701

PCC 6307

High light

Prochlorococcus

Low light

Prochlorococcus

Marine

Synechococcus

100/100

100/100

100/98

100/88

100/98

69/
--

89/83

97/94

99/64

100/99

70/
--

59/
-
-

66/
--

95/93

100/98

Rocap et al. 2002. AEM


What can you do with a lot of
sequences?



What
is a (
meta
)
genome
?


isolate


Genomics


Metagenomics


community

sequencing

Genome assembly

Genome assembly

Shotgun
sequencing
(WGS)

…ACGGCTGCGTTACATCGATCAT

ACATCGATCATTTACGATACCATTG…

sheared

clone library

(insert sizes of 1
-
2, 3
-
4, 30
-
40, 100kb)

end sequence

clones

(f / r)

assemble reads by

alignment identity

genomic DNA

1

2

3

4

5

6

7

8

break

A

B

C

D

E

F

G

H

A

B

C

D

F

G

H

E’

E’’

mate pair linkage

contig

“composite” genome scaffold

Genome scaffolding

Genome
annotation is
never done …

The first four

Prochlorococcus

cyanophage genomes

-

variations

on
coliphages

(
e.g., T4, T7
1

and “lambda”
2
)


-

contain
core photosynthesis

genes
3,4
:

-

expressed during infection
5,6


-

diversity generator for their hosts
4


-

comprise ~60% of surface ocean microbial
psbA

genes
7


-

contain
other ‘host’ genes

(
Auxilliary

Metabolic Genes =
AMGs

8
) …
phycobilin

biosynthesis,

P stress
,
C metabolism,

nucleotide metabolism

1


References
:
1

Sullivan et al. 2005.
PLoS Biol.
,
2

Sullivan et al.
in prep
.,
3

Lindell & Sullivan et al. 2004.
PNAS
,
4
Sullivan & Lindell et al. 2006.
PLoS
Biol.
,
5
Lindell et al. 2005.
Nature,
6
Lindell et al. 2007.
Nature,
7

Sharon et al.

2007. ISMEJ ,
8

Breitbart, Thompson, Suttle & Sullivan. 2007.

Oceanography

Cyano

11%

Hypothetical

60%

15%

T4
-
like

14%

“phage”

“bacterial”

P
-
SSM4

Metagenome assembly

Metagenome assembly

Metagenome assembly

1


10


100


1000


10000

Acid mine drainage

Sargasso Sea

Soil

Species complexity

Community complexity

Environmental

Sample

Extract DNA

Clone

High throughput

sequence

Assemble reads

Call genes

Bin fragments

Library Type:

Shotgun (small
-
insert) 3kb

Fosmid

(large
-
insert) 40 kb

BAC (large
-
insert) BIG STUFF
!

Sheared

Size selection

Community genomics (a.k.a. metagenomics)

= Environmental Gene Tags

Predict

ORFs (genes) in sequence data


Assign a
function

to ORFs


Compare
relative abundance

across habitats


What
to do with the data?


EGTs

genome

transcriptome

proteome

bacteria & archaea

viruses

genome

transcriptome

proteome

genome

transcriptome

proteome

eukaryotes

microbial communities

DNA

RNA

protein

Metagenomics is but the first level

Summary


The smallest but arguably most important ocean
inhabitants are microbes and phages


Using
metagenomics

to sequence previously
undetectable microbes and phages has expanded
our knowledge of the oceans’ ecosystems


Looking a genes in genomes can give us an idea
of the potential function and role these
organisms play in ocean ecology


Looking at gene expression can tell us which
genes are playing an active role in the ecosystem
and who the major players are


Our goals


Assemble and annotate a phage genome


Next Tuesday and Thursday


Build a gene phylogeny and determine what
phage you have based on it’s relationship to
other phages


April 6th

phyto
-

plankton

grazers

higher
trophic
levels

bacteria

Dissolved

viral
lysis