Bt Corn – Bacillus thuringiensus(a bacteria) - Parrott

kissimmeemisologistBiotechnology

Dec 14, 2012 (4 years and 11 months ago)

166 views


State that, when genes are transferred
between species, the amino acid
sequence of the polypeptides translated
from them is unchanged because the
genetic code is universal


Vector
: a bacteriophage, plasmid, or other agent
that transfers genetic material from one cell to
another.


Plasmids
: circular bits of genetic material carrying 2
to 30 genes


Host Cell
: A cell that has been introduced with DNA
(or RNA), such as a bacterial cell acting as a host cell
for the DNA isolated from a bacteriophage.


Restriction Enzymes
: An enzyme that catalyzes the
cleavage of DNA at restriction sites, producing small
fragments used for gene splicing in recombinant DNA
technology and for chromosome mapping
.


DNA Ligase
: Enzymes the form bonds
attaching the DNA fragments of the
lagging strand to become one strand.


Sticky Ends
: The end of unevenly cut
DNA, easily matches with complimentary
base over hang

EX. 5
'
-
ATCTGACT

GATGCGTATGCT
-
3
'




3
'
-
TAGACTGACTACGCATACGA
-
5
'



Genetic Engineering
: Refers to the
deliberate manipulation of genetic
material.


The genetic code is universal


Possible to move genetic material
between species




For every organism the same RNA codon
codes for the same amino acid in an
mRNA strand for every species


E.g. UUU,UUC both code for the amino acid
phenylalanine


Makes it possible to transfer genetic material
from one species to another


Outline a basic technique used for gene
transfer involving plasmids, a host
cell(bacterium, yeast, or other cell),
restriction enzyme(
endonucleases
) and
DNA
ligase


Restriction enzymes(
endonucleases
)


used
to cut a desired section of the DNA


Insulin


Gene which codes for insulin is put into a
plasmid


That plasmid is then put into a host
cell(bacterium)


That host cell can now synthesis insulin to be
collected and used by diabetics



More in depth


mRNA that codes for insulin is taken from a
human pancreatic cell that produces insulin


DNA copies are next made from the mRNA using
the enzyme reverse transcriptase


Extra guanine nucleotides are added to create
sticky ends


A selected plasmid is cut using restriction
enzymes(cut the DNA at specific base
sequences)


Extra cytosine nucleotides are added to create
sticky ends


Plasmid and gene are mixed together


The cytosine and guanine nucleotides
match together


DNA ligase makes sugar phosphate bonds


Plasmids with human insulin gene is mixed
with host cells


Host cell takes in the plasmid and starts
producing insulin


Insulin is collected and purified



State two examples of current uses of
genetically modified crops or animals


Tomatoes


Altered to stay
fresher longer



Flavr

Savr
” by
adding a gene that
blocked the
enzyme that
caused rotting


Bt Corn


Bacillus
thuringiensis

has been
incorporated into
the DNA of the
corn, corn now
produces a toxin
that makes them
insect resistant



Discuss the potential benefits and
possible harmful effects of one example
of genetic modification


Benefits


Less checking for ECB
-
European Corn Borers


Damage caused by
ECB is reduced,
saving farmer money


Less insecticides
needed, meaning less
impact on
environment and
lower health risks for
workers



Weaknesses


Kills unnecessary
insects



Define
clone


Clone


a group of genetically identical
organisms or a group of cells derived from a
single parent cell


http://www.brainpop.com/science/cellularlif
eandgenetics/cloning/


Outline a technique for cloning using
differentiated animal cells



Dolly


Udder cells were taken from a donor sheep


Cells were cultured


An unfertilized egg was taken from another
sheep


Nucleus was removed from that egg


Egg cells were fused with the udder cells with
electricity


Cells became zygotes and then embryos


Embryos implanted into surrogate sheep


Resulting sheep was identical to the sheep
that donated the udder cells


Discuss the ethical issues of therapeutic
cloning in humans


Fears of it leading to reproductive cloning


Use of embryonic stem cells involves the
creation and destruction of human embryos


Embryonic stem cells are capable of many
divisions and may turn into tumors



"IB Guides."
IB Biology Notes
. Web. 08 Mar. 2012
.

<
http://
www.ibguides.com/biology/notes/genetic
-

engineering
-
and
-
biotechnology
>.