What is Genetic Engineering? - yusronsugiarto

igocheddarBiotechnology

Dec 14, 2012 (4 years and 6 months ago)

257 views

Genetic Engineering

Biotechnology

The manipulation of a trait in an
organism to create a desired
change

What is Genetic Engineering?

We have been manipulating DNA
for generations!


Artificial breeding


creating new breeds of animals & new
crop plants to improve our food

Animal breeding

Breeding food plants


“Descendants” of the wild mustard


the “Cabbage family”

Breeding food plants

Evolution of
modern corn

(right) from
ancestral
teosinte

(left).

A Brave New World

The code is universal


Since all living
organisms…


use the same DNA


use the same code
book


read their genes
the same way

TACGCACATTTACGTACGCGGATGCCGCGACT
ATGATCACATAGACATGCTGTCAGCTCTAGTAG
ACTAGCTGACTCGACTAGCATGATCGATCAGC
TACATGCTAGCACACYCGTACATCGATCCTGA
CATCGACCTGCTCGTACATGCTACTAGCTACTG
ACTCATGATCCAGATCACTGAAACCCTAGATC
GGGTACCTATTACAGTACGATCATCCGATCAGA
TCATGCTAGTACATCGATCGATACTGCTACTGA
TCTAGCTCAATCAAACTCTTTTTGCATCATGAT
ACTAGACTAGCTGACTGATCATGACTCTGATCC
CGTAGATCGGGTACCTATTACAGTACGATCATC
CGATCAGATCATGCTAGTACATCGATCGATACT
GCTACTGATCTAGCTCAATCAAACTCTTTTTGC
ATCATGATACTAGACTAGCTGACTGATCATGAC
TCTGATCCCGTAGATCGGGTACCTATTACAGTA
CGATCATCCGATCAGATCATGCTAGTACATCGA
TCGATACT

human genome

3.2 billion bases

Can we mix genes from one creature
to another?

YES
!

Green Fluorosceint Protein (GFP)

How do we do mix genes?


Genetic engineering


find gene


_______

DNA in both organisms


_______

gene from one creature into other
creature’s DNA


_______

new chromosome into organism


organism
_______

new gene as if it were its
own


organism
_______

gene as if it were its own


_____________________________________
:

Remember: we all use the same genetic code!

Uses of genetic engineering


Genetically modified organisms (GMO)


enabling plants to produce new proteins


___________________________
:
BT corn



corn produces a bacterial toxin that kills corn
borer (caterpillar pest of corn)


___________________________
:
fishberries



strawberries with an anti
-
freezing gene from
flounder


___________________________
:
golden rice



rice producing vitamin A

improves nutritional value

Basic steps in genetic engineering

1.
Isolate the gene

2.
Insert it in a host using a vector

3.
Produce as many copies of the host as
possible

4.
Separate and purify the product of
the gene

Gene Cloning Techniques

1
-

Grow the target
microorganism

2.Extract/isolate
DNA

DNA target

3
-

Digest
fragment DNA
with
restriction
enzymes

4
-

Insert DNA
fragments in a
plasmid cloning
vector

Recombinant

Each bacteria will grow to
form an individual colony

Continued


Vibrio

DNA
library”

5
-

Transform
E. coli

with
library

Each bacteria will receive
a single plasmid from the
library

Tools

1.
DNA you want to clone

2.
Restriction endonucleases
(molecular scissors)

3.
Cloning vector
(e.g. pGEM, pBR322…)

4.
Ligase enzyme
(molecular glue)

Step 1: Isolating the gene

Step 1: Isolating the gene

Cutting DNA


DNA “scissors”


____________________________


____________________________


used by bacteria to cut up DNA of

attacking viruses


EcoRI, HindIII, BamHI


cut DNA at specific sites


enzymes look for specific base sequences

GTAAC
GAATTC
ACGC
TT

CATTG
CTTAAG
TGCG
AA

GTAAC
G
|
AATTC
ACGC
TT

CATTG
CTTAA
|
G
TGCG
AA

Restriction enzymes


Cut DNA at specific sites


____________________________

GTAAC
G AATTC
ACGCTT

CATTG
CTTAA G
TGCGAA

GTAAC
GAATTC
ACGC
TT

CATTG
CTTAAG
TGCG
AA

restriction enzyme cut site

restriction enzyme cut site

Sticky ends


Cut other DNA with same enzymes


leave “sticky ends” on both


can glue DNA together at “sticky ends”


GTAAC
G AATTC
ACGCTT

CATTG
CTTAA G
TGCGAA

gene

you want

GGACCT
G AATTC
CGGATA

CCTGGA
CTTAA G
GCCTAT

chromosome

want to add

gene to

GGACCT
G AATTC
ACGCTT

CCTGGA
CTTAA G
TGCGAA

combined

DNA

Restriction Endonucleases


Restriction
endo
nucleases, a.k.a.
“restriction enzymes” or “enzymes” by
molecular biologists.




Type II restriction enzymes recognize and
cut specific DNA sequences


5’
-
NNNAAGCTTNNN
-
3’

3’
-
NNNTTCGAANNN
-
5’

Example


Hin
d III (
Haemophilus influenza Rd
)


Recognizes: AAGCTT


Cuts in between the two A’s


AAGCTT A AGCTT

TTCGAA TTCGA A

Types of Sticky Ends

5’ overhangs (HindIII)


5’
AAGCTT
3’

5’
A
5’

AGCTT
3’

3’
TTCGAA
5’

3’
TTCGA
5’

A
5’



3’ overhangs (KpnI)


5’
GGTACC

3’ 5’
GGTAC
3’

C
3’

3’
CCATGG
5’ 3’
C

3’
CATGG
5’

Types of Overhangs


Sticky ends


Examples include HindIII & KpnI


Blunt Ends


Example SmaI


Recognize CCCGGG


Cut between C and G


CCCGGG CCC GGG

GGGCCC GGG CCC

Sticky ends help glue genes together

TTGTAAC
GAATTC
TACGAATGGTTACATCGCC
GAATTC
A
CGCTT

AACATTG
CTTAAG
ATGCTTACCAATGTAGCGG
CTTAAG
T
GCGAA

gene you want

cut sites

cut sites

AATGGTTACTTGTAAC
G
AATTC
TACGATCGCCGATTCAACGCTT

TTACCAATGAACATTG
CTTAA
G
ATGCTAGCGGCTAAGTTGCGAA

chromosome want to add gene to

cut sites

AATTC
TACGAATGGTTACATCGCC
G


G
ATGCTTACCAATGTAGCGG
CTTAA

isolated gene

sticky ends

chromosome with new gene added

TAAC
GAATTC
TACGAATGGTTACATCGCC
GAATTC
TACG
ATC

CATTG
CTTAAG
ATGCTTACCAATGTAGCGG
CTTAAG
ATG
CTAGC

sticky ends stick together

DNA
ligase

joins the strands

________________

DNA molecule

Why mix genes together?

TAAC
GAATTC
TACGAATGGTTACATCGCC
GAATTC
TACG
ATC

CATTG
CTTAAG
ATGCTTACCAATGTAGCGG
CTTAAG
ATG
CTAGC


Gene produces protein in different
organism or different individual

aa

aa

aa

aa

aa

aa

aa

aa

aa

aa

“new” protein from organism

ex:

human insulin from bacteria

human insulin gene in bacteria

bacteria

human insulin

How can

bacteria read

human DNA?

Step 2: Inserting gene into vector


Vector



molecule of
DNA which is used to
carry a foreign gene
into a host cell

Plasmid Vector:
pBR322


First modern cloning vector (1976)


pBR322


Contains:


1.
colE1 origin of replication (ORI)


Bacteria plus
plasmid

Non
-
transformed
bacteria

Nutrient media
plus antibiotic

Overnight
growth

Only colonies

from bacteria that

have plasmid

pBR322


Contains:


2. Selectable Markers:


Ampicillin Resistance
(
β
-
lactamase

gene)


and Tetracycline
Resistance (
tet

gene)



pBR322


Contains:


3. A few good restriction sites for inserting
foreign DNA


PstI

Eco
RI

Bam
HI

BamH1

BamH1

Your favorite
DNA

Digest

with
BamH
1

and
ligate

PstI

Eco
RI

Bam
HI

Bam
HI

Your
favorite
DNA

pBR322


Nice Features:



200 copies per
E. coli

cell


Makes double stranded DNA


All modern cloning vectors are based on
pBR322



Advantages over pBR322

1.
Makes 1000’s of copies/cell

2.
Small size at 2.7 kilobase pairs (kb) = easier
uptake by
E. coli



Next Generation:
pUC Plasmids

Step 3: inserting vector into host

Bacteria


Bacteria are great!


one
-
celled organisms


reproduce by mitosis


easy to grow, fast to grow


generation every ~20 minutes


A way to get genes into bacteria easily


insert new gene into plasmid


insert plasmid into bacteria


bacteria now expresses new gene


bacteria make new protein

+

transformed

bacteria

gene from

other organism

plasmid

cut DNA

recombinant

plasmid

vector

glue DNA

Blue/White Selection

Bacteria plus empty
plasmid

Non
-
transformed bacteria

Only colonies

from bacteria that

have plasmid

Nutrient media plus
antibiotic plus X
-
Gal

Overnight growth

Bacteria with
plasmid plus insert

Colonies with insert
-

white

Colonies w/o insert
-

blue

Grow bacteria…make more

grow

bacteria

harvest (purify)

protein

transformed

bacteria

plasmid

gene from

other organism

+

recombinant

plasmid

vector

Applications of biotechnology

any Questions?