TDMON810x - Cours en Ligne - AgroParisTech

hearingstartBiotechnology

Oct 23, 2013 (3 years and 5 months ago)

500 views

Module intégratif «

Gènes et
Nature

»
-

14 Juin 201
3

Karine ALIX et Jean
-
Denis FAURE

TD
de bioanalyse

Etude du transgène du maïs MON810 (reconstruction artificielle d'après document
s
)



Données initiales


1)

Séquence

du

transgè
ne

MON810
.

Séquence nucléique 1
, la construction

=
Séquence
du
transgène inséré
e

dans le
site
Eco
RI du
plasmide
pUC19 (ORI, AmpR, MCS dans le gène LacZ pour sélection
blanc
-
bleu, cf annexe)


2)

Séquence
s

de deux loc
us

"MON810"
,

MON810a et MON810b
,

correspondant aux sites
d’insertion du transgène
chez

deux lignées transformées de maïs

Séquence nucléique 2,
MON810a
_inser
tion 1

Séquence nucléique 3,
MON810b
_insertion 2


Objectif



Analyser ces deux sites d’insertion par une caractérisation fine des séquences codantes
présentes à ces locus (localiser le transgène et identifier où il s’est inséré dans le génome du maïs en
regardant s’il y aurait des gènes d’intérêt dans la région conc
ernée)
afin de déterminer quelle lignée
transformée sera retenue dans le cadre de l’amélioration génétique du maïs.


Restitution écrite


-

Identifier le transgè
ne

o

Définir la structure du transgène en donnant les positions dans la séquence des
différents comp
osants de la construction (promoteur, intron, gène
Bt
, (coordonnées,
origine, fonction))

o

Identifier le transgène dans les séquence
s

2&3

des sites d’insertion

(
par
BLAST
et
notamment BLAST2seq
)

o

Comparer
les
séquence
s

2&3 avec
la
séquence 1 pour identifier
l'événement
d'intégration

:
que s’est
-
il passé lors de l’intégration du tran
s
gène dans le génome de
maïs

? Y a
-
t
-
il eu des pertes de fragment d’ADN

? L’insertion s’est
-
elle faite de la
même manière au niveau des deux lignées de maïs transformées

?


-

C
aracté
riser

le
site
d’
insertion

du transgène,
au niveau de

son environnement génomique

o

Maintenant que vous savez où est exactement le transgène dans chaque séquence au
site d’insertion,
identi
fiez

le

locus maïs
où s’est réalisée l
'insertion


procéde
z

à
l’annotation du fragment génomique fourni



s’agit
-
il d’un gène, d’un élément
transposable,…

o

si
présence d’un
gène au site insertion
,

définissez
-
le

:
nature,
fonction,
structure
exon/intron



analyse
z la

fonction du gène disrupté (expression, activité…)



y

a
-
t
-
il
conservation évolutive du gène
concerné

?

Pour cela,

recherche
z

d’
éventuelles
orthologues chez d’autres espèces végétales et
procédez à une
analyse phylogénétique

succincte,

après réalisation d’un alignement multiple
de séquences




-

Faire un point

di
s
cussion / bilan

o

Quelle
lignée transformée
choisiriez
-
vous en vue de son utilisation
dans les
programmes d’amélioration du maïs

?

Justifiez

votre réponse
.


-

Etablir un protocole de d
étection
du
transgène par PCR

o

dessin
(=ch
o
i
x)
des

amorces dans
le
transgène (séquence

des amorces
, position des
amorces
dans la séquence par rapport à l’annotation que vous aurez réalisée,
taille

et
s
é
quence

de l’ampli
con

à obtenir
) pour détection par PCR



application pour la
traçabilité des lots de semences

o

de même, de
ssin des amorces autour du transgène, pour suivi en back
-
cross par
exemple



le dessin des

amorces
est réalisé
avec le logiciel
P
rimer3



en vue du suivi par backcross, réaliser une recherche par

BLAST
des
amorces
sur
la séquence de maïs, afin d’analyser la
sp
écificité

des amorces choisies


-

Discussion/bilan
du TD



>
Séquence nucléique 1, la construction

tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaag
cggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatg
cggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaat
accgcatcaggcgccattcgccattcaggct
gcgcaactgttgggaagggcgatcggtgcgggcctcttcgctat
tacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgac
gttgtaaaacgacggccagtgaactgtttcctgtgtgaaattgttatccgctcacaattccacacattatacgag
ccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcg
ttgcgctcactgc
ccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggaattgacggatctcctttgccccgga
gatcaccatggacgactttctctatctctacgatctaggaagaaagttcgacggagaaggtgacgataccatgtt
caccaccgataatgagaagattagcctcttcaatttcagaaagaatgctgacccacagatggttagagaggccta
cgcggcaggtctcatcaa
gacgatctacccgagtaataatctccaggagatcaaataccttcccaagaaggttaa
agatgcagtcaaaagattcaggactaactgcatcaagaacacagagaaagatatatttctcaagatcagaagtac
tattccagtatggacgattcaaggcttgcttcataaaccaaggcaagtaatagagattggagtctctaagaaa
ag
ttcctactgaatcaaaggccatggagtcaaaaattcagatcgaggatct
aacagaactcgccgtgaagactggcg
aacagttcatacagagtcttttacgactcaatgacaagaagaaaatcttcgtcaacatggtggagcacgacactc
tcgtctactccaagaatatcaaagatacagtctcagaagaccaaagggctattgagacttttcaacaaagggtaa
tatcgggaaacctcctcggattccattgcccagctatctgtcacttcatcaaaaggacagtagaaaaggaaggtg
gcacc
tacaaatgccatcattgcgataaaggaaaggctatcgttcaagatgcctctgccgacagtggtcccaaag
atggacccccacccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgat
gtgatatctccactgacgtaagggatgacgcacaatcccactatccttcgcaagacccttcctctatataaggaa
gttcatttcatttggagaggacacgctgaaatcacc
agtctctctctacaaatc
gtttgtgctctcctacctcct
gatggtatctgatatctacgaacgtacactatattgcttctcttacatacgtatcttgctcgatgccttctccca
gtattgaccagtgtactcacatagtcttgctcattcattgtaatgcaatggctcagagaatagaacagaatatta
ggcaaccacatcttatggatatccttaataggataaccatttatactgatgtgcatagaggctttaa
ttattggt
cagggcatcaaataacagcttctcctgtagggttttcaggaccagaattcgcattccctttatttgggaatgcgg
ggaatgcagctccacccgtacttgtctcattaactggtttggggatttttagaacattatcttcacctttatata
gaagaattatacttggttcaggcccaaataatcaggaactgtttgtccttgatggaacggagttttcttttgcct
ccctaacgaccaacttgccttcc
actatatatagacaaaggggtacagtcgattcactagatgtaataccgccac
aggataatagtgtaccacctcgtgcgggatttagccatcgattgagtcatgttacaatgctgagccaagcagctg
gagcagtttacaccttgagagctccaacgttttcttggcagcatcgcagtgctgaatttaataatataattcctt
catcacaaattacacaaatacctttaacaaaatctactaatcttggctctggaa
cttctgtcgttaaaggaccag
gatttacaggaggagatattcttcgaagaacttcacctggccagatttcaaccttaagagtaaatattactgcac
cattatcacaaagatatcgggtaagaattcgctacgcttctactacagatttacaattccatacatcaattgacg
gaagacctattaatcagggtaatttttcagcaactatgagtagtgggagtaatttacagtccggaagctttagga
ctgtaggttt
tactactccgtttaacttttcaaatggatcaagtgtatttacgttaagtgctcatgtcttcaatt
caggcaatgaagtttatatagatcgaattgaatttgttccggcagaagtaacctttgaggcagaatatgatttag
aaagagcacaaaaggcggtgaatgagctgtttacttcttccaatcaaatcgggttaaaaacagatgtgacggatt
atcatattgatcaagtatccaatttagttgagtgtttatca
gatgaattttgtctggatgaaaaacaagaattgt
ccgagaaagtcaaacatgcgaagcgacttagtgatgagcggaatttacttcaagatccaaacttcagagggatca
atagacaactagaccgtggctggagaggaagtacggatattaccatccaaggaggcgatgacgtattcaaagaga
attacgttacgctattgggtacctttgatgagtgctatccaacgtatttatatcaaaaaatagatgagtcga
aat
taaaagcctatacccgttatcaattaagagggtatatcgaagatagtcaagacttagaaatctatttaattcgct
acaatgcaaaacatgaaacagtaaatgtgccaggtacgggttccttatggccgctttcagcccaaagtccaatcg
gaaagtgtggagagccgaatcgatgcgcgccacaccttgaatggaatcctgacttagattgttcgtgtagggatg
gagaaaaatgtgcccatcattcccatca
tttctccttggacattgatgttggatgtacagacttaaatgaggact
taggtgtatgggtgatattcaagattaagacgcaagatggccatgcaagactaggaaatctagaatttctcgaag
agaaaccattagtaggagaagcactagctcgtgtgaaaagagcggagaaaaaatggagagacaaacgtgaaaaat
tggaatgggaaacaaatattgtttataaagaggcaaaagaatctgtagatgctttattt
gtaaactctcaatatg
atagattacaagcggataccaacatcgcgatgattcatgcggcagataaacgcgttcatagcattcgagaagctt
atttgcctgagctgtctgtgattccgggtgtcaatgcggctatttttgaagaattagaagggcgtattttcactg
cattctccctatatgatgcgagaaatgtcattaaaaatggtgattttaataatggcttatcctgctggaacgtga
aagggcatgtagatg
tagaagaacaaaacaaccaccgttcggtccttgttgttccggaatgggaagcagaagtgt
cacaagaagttcgtgtctgtccgggtcgtggctatatccttcgtgtcacagcgtacaaggagggatatggagaag
gttgcgtaaccattcatgagatcgagaacaatacagacgaactgaagtctagcaactgtgtagaagaggaagtat
atccaaacaacacggtaacgtgtaatgattatactgcgactcaaga
agaatatgagggtacgtacacttctcgta
atcgaggatatgacggagcctatgaaagcaattcttctgtaccagctgattatgcatcagcctatgaagaaaaag
catatacagatggacgaagagacaatccttgtgaatctaacagaggatatggggattacacaccactaccagctg
gctatgtgacaaaagaattagagtacttcccagaaaccgataaggtatggattgagatcggagaaacggaaggaa
ca
ttcatcgtggacagcgtggaattacttcttatggaggaataagatcgttcaaacatttggcaataaagtttct
taagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataa
ttaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacg
cgatagaaaacaaaatatagcgcgcaaactagg
ataaattatcgcgcgcggtgtcatctatgttactagatcgaa
ttcgatttcgagctcggtacccggggatcctctagagtcgacctgcaggcatgcaagcttggcgtaatcatggtc
atagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaa
agcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttc
cagtcgggaaa
cctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgc
ttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaat
acggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccg
taaaaaggccgcgttgctgg
cgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaag
tcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcc
tgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctc
acgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctg
tgtgcacgaaccccccgttcagcc
cgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagc
agccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaacta
cggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtag
ctcttga
tccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaa
aaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagg
gattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaat
ctaaagtatatatgagtaaacttggtctgacagttacc
aatgcttaatcagtgaggcacctatctcagcgatctg
tctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctgg
ccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccgg
aagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccggga
agctag
agtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtc
gtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaa
agcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggc
agcactgcataattctcttactgtc
atgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtc
attctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatag
cagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgag
atccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactt
tcaccagcgtttctgggtg
agcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactctt
cctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaa
aaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcat
gacattaaccta
taaaaataggcgtatcacgaggccctttcgtc


>
Séquence nucléique 2, MON810a
_
i
nsertion 1

tatttggttgattgagttttgtaaagtgtaaactagtgtattacattgtgatatatattagacccctattacttt
tggggccttggccgtcgcctctgttgcatgcgcttaaaactgaccctgcacatgagacattatggcttagtgtgg
cctccgccgtacccctaattttaaagcgt
ttatgtatattctattttaatcacagaaggtctggtgtgttggata
ggttgctgtgttttaagttgtacgttatgagtttataatcacactgcttgtatattttgttttttttctcagcca
taccatatttttcttttatcctccgctgctgtaatcaattagatgtgttagatggaaaatagaaaacacacccga
tggaggagatttgattagatatgttagaatgtggataggataatttaggatgagcccttt
tttttgctcttttta
tatgtagagaggttaaaaaacagaaaacgtgcccctaatccaacagttctgtttcacaaaactgaaaaaatccat
tacacaacagaggaagctccacaggttacaagaacaggtacacggcaatggcagagccatacggttctgtattta
ctaatacatagctcgtacctcgtgtaataaaattttgcaccaaactcatgctagaaacaacacctgctctagctc
cccctcatgctaggca
gcttatgcacctgcacaagacatcaccaccaccccgtcaccgatgctggaaataaaagt
caagcgttcgaccttctcggcggcatgggcgaatcgcccgctcttgagctgaacactgatcttgggtactgggaa
tcgatcatcatctcctgcgaatttcccatcgaatgctcgtctcagttatgcctacaagttcgttagtcgtgttgg
aaaaaatgttagttgctttggattgaggaagcttacggcgtgtgacc
gtgagatgttgctgtggaacggcgacga
gctgtgcatgccgccgccgccgccacccctgatgatggcgccgcagtactgcatgttgtcctcgccgagcgcgcg
cagccggttgagttccgggagcacgacagcgccgaggtccgggcggtccttgcggcgcagctcgcagcaccggag
cgccatctcggcgaggcactgcgcctcctccaggggccagtcgggcacggcggggtcaagcatgtcctgcagctc
gcc
gcgctccagggcgcgtccgacgtggtgcgacagccccatgggcggcttcgccgtgatgatctgcagcagcat
gacgccgaaggagtagacgtcggacttgacgccgagcatgcccgtctgctggtactccgggtcgatgtagcagaa
ggtccccgcggtggacgtcatccggtactgcgtcacggtgtcggcgacggacggcggcacgagccgcgccagccc
gacgtcgctgatcttgctcacgtagttgcggtcc
agcaggatgttccccggcttgaggtcccggtgcaccagcgg
ctcgggcttggtctggtgcaggaacagcagccccgtcgcgatctcggcgcagatgcggaaccggtgctgccaggg
gatgacgggcccgccggcgccgccggagcgccggaacaggcagtcgtccaggctgccgctggccatgtattcgta
cacgaggcagccgtactccgggcacgcgccgaggaggagcaccatgttggggtgccggatgcagc
tcagcacctc
cacctcctgctggaactgcgaccggccctgcgccgcgtcgggccggagcaccttgatggccacctgcgtgtggtc
gaggaagcccttgtacacggggccgtacccgccctcgcccaccttgcgcgcgtcgttgaagttgtccgtcgcctg
ctcgatctcctcgatgctgtagcgccggtaccgggcctcgtgggacatgccgctgccgccgcggttcttgcgctc
ctcggcctccttgagcagctt
cttctccgcgctgatccgcttctggacctccatctccgcgatccgctgcgacgc
ctccgccgcctccatggccgccttcgcccgagccttctcccgctcgatcatcgccatcgcggagtcctccgttat
ccgcgagtcttgcgtcttctgctcctcctccatcttccaccgctgcagctccatggccttctgtttcgccgtcag
cgcctccttgcaggccgtgctgtacatgtccattgtctgcttgagctccagg
cgaagcctcttcatctccgcctc
cacgtcgtcctgctgttatcattagggaaacagagagcttccctcgtcaagaattcaagatgcttgctaggaatg
gagatctgagtcgaccgagggagtacagagtactcaccatgccgagggagcagaaggaagagctgctgctctgcg
agaaggtggtgtggtccatgccgccgaaggagtcgccgccccacttgctgggcgtgcgtgacatctcgaagctgt
ggtcgtag
ctgtccacggagccgttggacatccgcggcgggatcgccgggtggtggtcgacgctccggcggccgg
tgctgctgacaaacgagatgtcggccgagtccggcatggacatgtggctgaggtcggcgtacgacttgcgcgtgt
tcgcggggcccccgcgcgcgaacggcgagcggaagttgtccacccgcggcgtctcgccgtgctcgtggcctctcg
acgacgaggaccaccggtgcgactgcggcggctcgggct
tgagcgttgcggcaatctgcgacgactggatctgcg
accggagcggcgacacccgcggcgcggcgcgggtggagttgcgctgcgacgagaccttccccttgttgacgatgt
acaccgagcagaagtctggggcgcccttggagatggtggtcgggatgtccgccttgaaccggacgaagccgcccc
tcgtcgtggcgccgaggacgagcttctccacggccgcctgcgccgagaactcgatgatggacttggccac
gtcgt
gctcgtccagcaccacgtccttgcaattgatctgcaatgcaacagacatatgtcacagcctgatcaaatccatcg
gtgcacgatcgacgacatgtatcctccgatcgtcgtgtacgtctttgcgggtgcagaagcatcggaacgggacga
agaggtccttcatgtgcgggtccgtcggctgcttgaacccggccgcgtcctccacgccgccggaggtgcccttgg
tgttgacgtggacaaggacgatggtc
tgccccttctgtaccagcgagtcgatggcccacttgagcgcgttctggc
tgttcttgtccttgtcgatgcacacggccaccagcgggtacccaaggtccgcccccgcgtcccgcccgccttcaa
ggtatgaccgccccatccgtcagttgtcaacggcggcgtacgtgattgtcctcctagccgccgccgccgcaatgg
ccccgcccccgcgtccgccggattaacgttcggctcacgacgacgaggatctcagtg
ttgtgccatggccagatc
gatcaacggacgggaggacgacgggggcacgccgggagggcacgtcgtcggtcttcttcgcagctcctgctccaa
gattgacgtctcttattaaagcacgccattttagggatgtggtggccgtttgggccgtacgcgccggccaaaaat
agagctgtttatcgggggcttcaacctcgttcaacgggtggccactggacaacggattcatgttcctgtggaaca
cgtttggttactc
gactttttatttacactttggaaacaaacagtcaaacaccatcacaaaactaccatggctca
cgagcgcacacgattgtaacctatatacttattcgctaaggggtgtttgagagtgaagttttttcacagttttgg
aagaataaaatactacggtattatatacagaattgtgtttggcaagttggctaaaatctctgtttttaaaactga
agtattgcaaatactatagttgttttaagttattctaaacttag
gtctggacctcagttttcaaaattgtggtat
tgtaaactgcagtattgtcataactaaagtatactgtagtatttcaaaaactgtggttttcaaaaactttgttcc
caaacagggcctaaatgggtaggcactaagcacagtacgacccgcgatgctttgacacgacacggacacgattta
tataatgtcatacggcacaggtttagtcacatctttggaccacgacctccgcacaatggactgacatgaacacga
cagtttagaccagatcccgtgacaatccggcacaatccagtgccccatcccctggtccacagccttcacagctct
ggcccggccttgccatatcgtgcacgggggtgtgtccagaatgtacctactggagcgcgctgcacgctggcgagc
gatccactcaccgttgatcccaacaaactccggtccccaaactccacggcaccaacagctaagcccgatgcgctg
cgtgcgcggcgatccaaccgccggctcacct
aaaaatttcggcacgtctaactgcgactggcaggtgcgcacgcg
tggtcgcgcggaataaagcggacacgttgcgcccccagcgaagcccgcacgcatcgcattcgcatcgcatcgcag
gtcgcatccgacgctagcggctagcctagccgaacagcctgagcgcgcgaag
atggcgcccgccgacggcgagtc
ctccccgccgccgcacgtggccgtggtcgccttcccgttcagctcccacgcggcggtgctgc
tctccatcgcgcg
cgccctggctgccgccgcggcgccgtccggggccacgctctcgttcctctccaccgcgtcctccctcgcgcagct
ccgcaaggccagcagcgcctccgccgggcacgggctcccggggaacctgcgcttcgtcgaggtaccggacggcgc
gcccgcggccgaggagaccgtgccggtgccgcggcagatgcagctgttcatggaggccgcggaggccggcggggt
gaaggcctggctggaggc
ggcccgcgccgcggcgggcggcgccagggtgacctgcgtggtgggcgacgcgttcgt
gtggccggcggcggacgcggccgcctccgcgggggcgccgtgggtgccggtgtggacggccgcgtcgtgcgcgct
cctggcgcacatccgcaccgacgcgctccgggaggacgttggcgaccagg
gtgcgttggattctactactactac
ttctctcccttccttgtcccttcattgcgcgcgggtttgatgatcgaatggctgttgcatttccatcgttcgcag
cagcaaacagggtggacgggctactgatctcccacccgggcctcgccagctaccgcgtccgtgacctcccagacg
gcgtcgtctccggcgacttcaactacgtcatcaacctcctcgtccaccgcatggggcagtgcctcccgcgctctg
ccgccg
ccgtggcactcaacacgttcccaggcctggacccgcccgacgtcaccgcggcgctcgcggagatcctgc
ccaactgcgtcccgttcggcccctaccacctcctcctcgccgaggacgacgccgacaccgccgcaccagccgacc
cgcacggctgcctcgcctggctgggccgccaacccgcgcgcggcgtcgcgtacgtcagcttcggcacggtggcgt
gcccgcggcccgacgagctccgcgagctggcggccgg
gctggaggactcgggcgcgccgttcctgtggtcgctgc
gcgaggactcgtggccgcacctcccgccgggtttcctggaccgcgccgcgggcaccgggtccgggctcgtggtgc
cctgggcgccgcaggtggccgtgctgcgccacccttccgtgggcgcgttcgtgacgcacgccgggtgggcgtcgg
tgctggagggcttgtccagcggggtgcccatggcgtgccgccccttcttcggcgaccagcggatgaac
gcgcggt
ccgtggcgcacgtgtgggggttcggcgccgcgttcgagggcgctatgacgagcgccggagtggccacggccgtgg
aggagctgctgcgcggggaggaaggggcgcggatgagggcaagggccaaggagctgcaggccttggtggccgagg
cgttcgggccaggcggtgagtgcaggaagaacttcgacaggttcgtcgagata
gtctgtcgcgcgtgaaaggtcg
tcttgctgttcagaggttttacca
acagaagaacataatgaattggatggcatgctacgtcgtattctctttttt
tgttgatccctgagttgatacattttgtacttgatacatgagttgcagcagcagcagcaacagccttctgtacct
tggctttggatctgtattcttgtcaccagttatctgaaagcatcaataaccttctgtcttctagcagttgcctct
ccagattgccaaaatagcatttattataaggtcttatgcaatgttttcag
attgt
tccgattaaatctacgatta
gcattttagcccagcagtccagcccattgaaggcttattcagttatttttaatccatataaatcaaaaaagattg
atatagattag
aaaatattttagtttactaggaattaaaacccctcaatttttcttaatccatataaattgtggc
agaactgaacaatccggtgcccataagcaacacggctgccagcctgccagaccgcccagcccaggtgcccacacc
cagctgccact
ccgcaagcgaccgccgtgagccgaactgaggaaccggcgacggatacagcggcagctccctcct
cctccgtcccggcgcagctgcgcccggttgatttggtgacaataggatcataggggattagagaagattgaggaa
aaataaactaatttttcctttaatcctttctaatcttcccatgataccgaatcaccaaatcagctctgatgctgc
aggtagggctcccgggctccacgcctccaccttttttcccta
gtccccactccccaatacacgttcatctcttct
agtgctaggtaactgtgattgtggcctgtgggtgctcggtttagatttagactgctgaatgatgaatgctgatga
gggcgatcagaaaagatcatccgattagaaaacattggtattatggttttttcataataatatacattgactttt
tgttctccaactaattaaatgatatatcttttttttggtaaccatgtataaccacgctttttatctggagaaa
ga
gaaattttacaacactatccttgcaaagcgaatttcacaaggagcatcaacaaagttaaatagcagctaattaca
tgactacatgagaaagaggcaactgaagatgaaacacaaagtagcagctaaaaacaaacactctttagagcatct
ctaacaatgcctcaaacttgtgtctcaaattgaaataaatggcttcacgtagaaaaactactccaacagtgtctt
attttacaaaatttggttaaaaaatatag
agcaccctctcaagtgcctcaaatatactgcactatagtgggctgt
cctataatatagatttggtgctttactgttgaaacagaatattttgttagtacactaaatcatataaaatatact
aatttttaaattatatgacacttttataagccaagctgttgaagatgatcttaggctgctggagacagccgcggc
aaactcccccactccctgcaaagcctgccgtacgaagtgaacacaaagaacgcaacaatc
tgtgtcatcacacaa
ccatgcatggggcatcacaactatttaacgaacgtcctaggctatgaaaacaggctccacaaacaacgagtttat
ggtgtctttgatgacatggcaatttgtgtacgcgtcatcattcttgtacatatacaccattgttcttgtcaggtt
gaagatcctctcgagcagctccgccggctggtgcttgttcatgttcagccactcctcgttgaaatctttccatgt
ttcatctatcatttcc
tgtatcttcacgcgagccacttcgagcgggacctcgtgctctctcatgcagctttctat
tgtcgaggcaacatgcggggccattttctctcgctgcatgcacatgcagttccttggttatatatacttccagga
aggcgccaacgctgtaaaggtcaggcagcatgtatgtatgtatgtgcaacaatgtctcctattcttcattttctc
tgacaatattcagtaccaaaaactatgtgtagctttatgatatggtg
cagtagacccatttatgttataactgaa
aaccaaaatgattattacctcatatgacttgagatcatcggaaagtctgagaatgatgcagagcgcctgcactag
tttaggcacactgcacacccattcgaaagcttcttcacctgcaacatctcccattccaacaaatgatgcgcacga
caagaggtgacaagcgccacttcttgctgaaacctgcaggtgctcctcaacggttgcaggcacatacccttgttc
gcg
ccatcttacctccttgttgtatgctcttactagatctataatctgcatgttaagggacaaaaacgtaggtaa
gtaaaaccacataattagctgtacctcatatcatacgtatgaatattttaaggagaaaaaaataaagagcaacta
tacttcacttaattttttgaactaaagttcatcttaggatttattgaaattgggatggctaagctgctggagata
gtcttacgtctccctacaaacaatgcagtctacc
gtgctaaacaatgcatggccatatgggtaaactgctggaat
cggtctaacctaagcacaggagatattgacaaaatgggaaaagtttgctcacaaaattttttatgtagggcatgc
ggtatttctcttccggcgctaactcttcctcaatgctttggtaagtatccaaaatttttccaaaaatgaacttca
tgttctctggaagacctccagcaactgcagggtcccagctggaccaaagtaattttcagacaaaa
aaagtcattc
atcatctaacttgataaaaggtttacaaatagggaatggcaagagatagttgccactggacaagggatgcatacc
atatacaacccagaacataatgaaagaaagggtccattttaacacgaaaaatatttctgtttgcacatgcaacct
gttgggaaaccttgaatcactatgaatttcattttcacttctagtgaatggcctttttatttatcaaattcaata
atattgcgctacttttatgct
atgttgttgtttaggcacatagtcctacttttagtagctatttgtctatagttt
ataaaattgtggaccggtaccgcttccatgaagagatttaagccaaattttcatccattatctgtggagatgact
ttaaccactaggcctgagttttatgtaggtcatactcaactaaagtatgcattgagttaatatttttttttgaat
aacctgttgcttgctatgttctttccttcttgcgttattcttgcattgagaa
aagagtttaatcagtcatcgaga
acacaaacctttctatacactcggtaaataactcgcactcttgtggagttccatagacatcataagtgtcgtcca
atagggacacgatggcgatgacttttgttagtattattcgagctcgagagtagcttggctcaaaatatactccca
cgatccagaagtagcactccacaactctgtctcgagcaaacgatagccttgactgaagctctagaccattccacc
acctgcac
attcttaattgaacagcaactgcaaatatgaattgtgtaatgtccatgaaaacattgaaatcttggc
aatctccactttttttctgttgtgattaggaatgcaagttttgttttgtggaccattaggagacccaagacacat
taggttgtacttctttcgattctaaagtaaataaattgggcatgcatgaactgcctgggccctgggctagaacta
tctattggtgtcgcccgttcaaatataatggcaatttgc
gatagtttggctaagaacattgctaagcgacctata
atttccagtggagggagtaagtaactcgaccttgttatgatcttcagctcttgttgatactggagttgcacgaga
ttatagttgagctttgctagctccattaccagttcatcagcctcagcctctcttccatattcagctatacgagat
ttagcctcgtaaattcttacacgtcttgggagggggatctcgagcgcacgctttatttcacatgctaacg
acgct
gctcccgtatacggcgctgttgatttcaaactcttggctgtgaaggaaatggcctcgtcaagtatcgtctctcca
cgcgtcgcgagacaagcagcgcagtgaaggctcagcagatcccttgcactgtttgctgtaaaaccacccccctgt
tcgtctctgaacttggcaaagacatctggaacaacaggtaattcgatagttatattatttttgtacttagaacaa
aaataatctttgttctaaagtacgat
gccgtttagtatccttaacgagcgaaataattttgccttgtaataacag
gctgcaaactaggagttcagttcagtaacgcgtgtcttggttacctgacgagacactgtatccgtgctttcggag
aagatagaaccacatggccaccgtttgaaggtcgcagccactgacatcgacgtcgttcattcgagctagcatgtc
gctgatctcgtcctcgaagagatgatccagacagagacgctccaagacgtggatgag
atgaatcctacggtgcag
gctacaggcgctcgacgaagctgctaccagttttgctgccacttgttccttcagctggtctgctcgatgtaccat
ccatgcctgtcgagatgttatgttttcagacgcatgcatgcatgggcggatcaacgctgagcgcaaaattaaacg
agtcttagatcaacaaggtggcagttaaatacgggtttgctaacaaaccttgtgaagggacgacgtggccagagg
gctggagtaggtg
aggaagaaatcgccccagatggatggctcaaagcccgagacgtttctgctcgcgccgtcgtc
ctctttcgcctgcctactactactagcggtggcggcgacggtggcactagcagagacggcgacgtcgctggcggc
cctgctggtgcaaccaattggtgacggcgggattcgcttgcccggcgacgccacggcgccggccatgacaactgg
tggtggcggcggcggcggccctccagcagaggggtcaacggcag
aacggcggccaccgctggaccgtgctgctag
cttcgtgctgatggagcggaaggccgtgcacgtgcaggcgtagctgctgcctgtcattttccagtgtgcttgggg
ggttggaatatgcctgctggctgctgctaccaccatctgcaatggcgccagcaaagccgaaactgttttcagaat
tcagagttcaaaacctttctgtctttatgaaccaccatgtcagctattaaccgaattatcgaccacgctgtcaat
cattatcaactaaaatctgttgataccgtctgattccatccaaggcatataatcgatatcgatcgatcgttactg
attacaccgacctggtcgactgacctgacctactaactggtcggcgttgggacaaacgcgattgattgatactga
caacaacgcattagtgactcacatggaaaatatgtcacgccctcgggctgaattagtggctcacgagtgcctact
gctggatccagcctcacgtggactatgttat
gtcctcggattggattagtggatagctaaacaaaagccttgtag
ttatggatgaagatgatgatgatgataacacataatatttaagtttggtgtgtggctaagcagtggaaacacaca
cgcatgcatatatagaaaaaacaatgaaactttaaactagaacgacaagaagacgagagctaatattatggaagg
gtcttgatattgctcaaaacaaaaccatctccacgaactacaacacaacaaaaaagctagat
ggcgtgatactta
aggttggcttttaaaaagggcatgtgaaaaagggtagaacggtcttttttctaattcatcagatgctctgcgtat
ggagaggttaagacagcaattaatttgatgccgtcctatatatcggaaaacgtgtcaaagtgctgggagagacgg
tgtagtaggggggctccaaaacattcacactaaaatggtgccataaaggacactacttccaaacaaagaaaaaaa
atggtagagttgggagag
ttttttcggtacaaatttggtaccctctcagcctctctccactctaggcttcccaca
gtgggccagacaccttggcgctaggcttgacgatacttttgggcctgctgttgggcttgtgccgctggtcacgcg
ggccttgtggcacacattgggatgactgacactctcttcctcgttgggcttgcggaaactgttggcgcgagcaag
gctttgcccctctttggtttagcttttttctgaccagcttttctaagaa
tctggctgtgaggagaatctgagtat
tattaggattacgtgcggaggaagataaagatgttcatagggttcaggatctagaaagtgatggattcctactat
tgcaacaactcaatcgattatatatttatgttgactttgaatagtttttacctaaacaaattttatagaagctgg
ctgaaaagctgacgcgtttggcagtccgcagcagcttttggtgaccagaagctgcaaaaagctgaaacaaacagg
ggctt
tgagacttcgcaggtagccgagtgttgcttgctggcatgtgtgatgtgattccacagggacgacgacgag
tgacccaatactaacatcgacaatattaactacatcggagttcacaaacaattgatgtatgctcctcggattgcc
acagtgggccgaatactttggcactaggcttcacggtgctcctgggcctagcgttcagagtgagctcgcttccaa
tgttgggcctgtgtaatgcatgccctatgagtcaga
ttggctaagactatcttcggctgcttacctatctccgta
tctatattcaaactccactctagaaattatagtataatatatctccgtatctatattcaaactccactctagaaa
ttatagtataatatagtgatttgagtgactatatgggtggactgctggagacgacctaaccatgaggaaagaaaa
actttgaacatcaagagcaaaaagaaaaaaaatgatacgtaataacgtgtgtacgcgagtacaaaat
aaccaaaa
tatcttagaatgcatctagttaatcaaattaggttctttgagcctaaacactgaaagagcagtttgtttctagac
caaatttcatggtagttgggagcctacccaaatttcacaattaattgtgctattgaattgttgaaaatgattgtg
tctgtcatatccgacggataacggaaacccgtccgaaattcgatgggcatgggcatggatatagatctgtaccca
ctagtatggtcgcaggcggatat
tggttgcaaccgcagatatagtttcagggaaaaggattaggctcagctccat
ccctagaccccacttgtgtggggggtctacccttcaaaaggaaaaaaaaactacacacagtgcatataagaagat
gaatattccaaaattcagcagtcaagaagccctgataaactgtctggcatagctagtactttatacacttcaaga
ccaaaagaaatcactaagtacagattttagtgactcgtaagtacagatatcatc
ttacaaggcccagcccagcga
cctattacacagcccgctcgggcccgcgacgtcgggacacatcttcttcccccttttggtgaagctctgctcgca
gctgtccggctccttggacgttcgtgtggcagattcatctgttgtctcgtctcctgtgcttcctgggtagcttgt
gtagtggagctgacatggtctgagcaggcttaaaatttgctcgtagacgaggagtaccagcacagcacgttgcgg
atttctctgc
ctgtgaagtgcaacgtctaggattgtcacacgccttggtcgcgtcgcgtcgatgcggtggtgagc
agagcagcaacagctgggcggcccaacgttggcttccgtgtcttcgtcgtacgtacgcgcgcgccggggacacgc
agcagagagcggagagcgagccgtgcacggggaggtggtgtggaagtggagccgcgcgcccggccgcccgcgccc
ggtgggcaacccaaaagtacccacgacaagcgaaggcgcca
aagcgatccaagctccggaacgcaacagcatgcg
tcgcgtcggagagccagccacaagcagccgagaaccgaaccggtgggcgacgcgtcatgggacggacgcgggcga
cgcttccaaacgggccacgtacgccggcgtgtgcgtgcgtgcagacgacaagccaaggcgaggcagcccccgatc
gggaaagcgttttgggcgcgagcgctggcgtgcgggtcagtcgctggtgcgcagtgccggggggaacgggta
tcg
tggggggcgcgggcggaggagagcgtggcgagggccgagagcagcgcgcggccgggtcacgcaacgcgccccacg
tactgccctccccctccgcgcgcgctagaaataccgaggcctggaccgggggggggcccgtcacatccatccatc
gaccgatcgatcgccacagccaacaccacccgccgaggcgacgcgacagccgccaggaggaaggaataaactcac
tgccagccagtgaagggggagaagtgta
ctgctccgtcgaccagtgcgcgcaccgcccggcagggctgctcatct
cgtcgacgaccaggttctgttccgttccgatccgatccgatcctgtccttgagtttcgtccagatcctggcgcgt
atctgcgtgtttgatgatccaggttcttcgaacctaaatctgtccgtgcacacgtcttttctctctctcctacgc
agtggattaatcggc
atggcggctctggccacgtcgcagctcgtcgcaacgcgcgccgg
cctgggcgtcccggac
gcgtccacgttccgccgcgg
ttggagtctctaagaaagtagttcctactgaatcaaaggccatggagtcaaaaat
tcagatcgaggatctaacagaactcgccgtgaagactggcgaacagttcatacagagtcttttacgactcaatga
caagaagaaaatcttcgtcaacatggtggagcacgacactctcgtctactccaagaatatcaaagatacagtctc
agaagaccaaagggc
tattgagacttttcaacaaagggtaatatcgggaaacctcctcggattccattgcccagc
tatctgtcacttcatcaaaaggacagtagaaaaggaaggtggcacctacaaatgccatcattgcgataaaggaaa
ggctatcgttcaagatgcctctgccgacagtggtcccaaagatggacccccacccacgaggagcatcgtggaaaa
agaagacgttccaaccacgtcttcaaagcaagtggattgatgtgat
atctccactgacgtaagggatgacgcaca
atcccactatccttcgcaagacccttcctctatataaggaagttcatttcatttggagaggacacgctgaaatca
ccagtctctctctacaaatc
gt
ttgtgctctcctacctcctgatggtatctgatatctacgaacgtacactatat
tgcttctcttacatacgtatcttgctcgatgccttctcccagtattgaccagtgtactcacatagtcttgctcat
tc
attgtaatgcaatggctcagagaatagaacagaatattaggcaaccacatcttatggatatccttaataggat
aaccatttatactgatgtgcatagaggctttaattattggtcagggcatcaaataacagcttctcctgtagggtt
ttcaggaccagaattcgcattccctttatttgggaatgcggggaatgcagctccacccgtacttgtctcattaac
tggtttggggatttttagaacattatcttcacc
tttatatagaagaattatacttggttcaggcccaaataatca
ggaactgtttgtccttgatggaacggagttttcttttgcctccctaacgaccaacttgccttccactatatatag
acaaaggggtacagtcgattcactagatgtaataccgccacaggataatagtgtaccacctcgtgcgggatttag
ccatcgattgagtcatgttacaatgctgagccaagcagctggagcagtttacaccttgagagct
ccaacgttttc
ttggcagcatcgcagtgctgaatttaataatataattccttcatcacaaattacacaaatacctttaacaaaatc
tactaatcttggctctggaacttctgtcgttaaaggaccaggatttacaggaggagatattcttcgaagaacttc
acctggccagatttcaaccttaagagtaaatattactgcaccattatcacaaagatatcgggtaagaattcgcta
cgcttctactacagatttac
aattccatacatcaattgacggaagacctattaatcagggtaatttttcagcaac
tatgagtagtgggagtaatttacagtccggaagctttaggactgtaggttttactactccgtttaacttttcaaa
tggatcaagtgtatttacgttaagtgctcatgtcttcaattcaggcaatgaagtttatatagatcgaattgaatt
tgttccggcagaagtaacctttgaggcagaatatgatttagaaagagcaca
aaaggcggtgaatgagctgtttac
ttcttccaatcaaatcgggttaaaaacagatgtgacggattatcatattgatcaagtatccaatttagttgagtg
tttatcagatgaattttgtctggatgaaaaacaagaattgtccgagaaagtcaaacatgcgaagcgacttagtga
tgagcggaatttacttcaagatccaaacttcagagggatcaatagacaactagaccgtggctggagaggaagtac
ggatatt
accatccaaggaggcgatgacgtattcaaagagaattacgttacgctattgggtacctttgatgagtg
ctatccaacgtatttatatcaaaaaatagatgagtcgaaattaaaagcctatacccgttatcaattaagagggta
tatcgaagatagtcaagacttagaaatctatttaattcgctacaatgcaaaacatgaaacagtaaatgtgccagg
tacgggttccttatggccgctttcagcccaaagtccaa
tcggaaagtgtggagagccgaatcgatgcgcgccaca
ccttgaatggaatcctgacttagattgttcgtgtagggatggagaaaaatgtgcccatcattcccatcatttctc
cttggacattgatgttggatgtacagacttaaatgaggacttaggtgtatgggtgatattcaagattaagacgca
agatggccatgcaagactaggaaatctagaatttctcgaagagaaaccattagtaggagaagcactagc
tcgtgt
gaaaagagcggagaaaaaatggagagacaaacgtgaaaaattggaatgggaaacaaatattgtttataaagaggc
aaaagaatctgtagatgctttatttgtaaactctcaatatgatagattacaagcggataccaacatcgcgatgat
tcatgcggcagataaacgcgttcatagcattcgagaagcttatttgcctgagctgtctgtgattccgggtgtcaa
tgcggctatttttgaagaattagaa
gggcgtattttcactgcattctccctatatgatgcgagaaatgtcattaa
aaatggtgattttaataatggcttatcctgctggaacgtgaaagggcatgtagatgtagaagaacaaaacaacca
ccgttcggtccttgttgttccggaatgggaagcagaagtgtcacaagaagttcgtgtctgtccgggtcgtggcta
tatccttcgtgtcacagcgtacaaggagggatatggagaaggttgcgtaaccattc
atgagatcgagaacaatac
agacgaactgaagtctagcaactgtgtagaagaggaagtatatccaaacaacacggtaacgtgtaatgattatac
tgcgactcaagaagaatatgagggtacgtacacttctcgtaatcgaggatatgacggagcctatgaaagcaattc
ttctgtaccagctgattatgcatcagcctatgaagaaaaagcatatacagatggacgaagagacaatccttgtga
atctaacagagg
atatggggattacacaccactaccagctggctatgtgacaaaagaattagagtacttcccaga
aaccgataaggtatggattgagatcggagaaacggaaggaacattcatcgtggacagcgtggaattacttcttat
ggaggaataagatcgttcaaacatttggcaataaagtttcttaagattgaatc
cccgggcgtcggcggcggcgga
cacgctcagcatgcggaccagcgcgcgcgcggcgcccaggcac
cagcagcaggcgcgccgcgggggcaggttccc
gtcgctcgtcgtgtgcgccagcgccggcatgaacgtcgtcttcgtcggcgccgagatggcgccgtggagcaagac
cggcggcctcggcgacgtcctcggcggcctgccgccggccatggcc
gtaagcgcgcgcaccgagacatgcatccg
ttggatcgcgtcttcttcgtgctcttgccgcgtgcatgatgcatgtgtttcctcctggcttgtgttcgtgtatg
t
gacgtgtttgttcgggcatgcatgcag
gcgaacgggcaccgtgtcatggtcgtctctccccgctacgaccagtac
aaggacgcctgggacaccagcgtcgtgtccgag
gtacggccaccgagaccagattcagatcacagtcacacacac
cgtcatatgaacctttctctgctctgatgcctgcaactgcaaatgcatgcag
atcaagatgggagacgggtacga
gacggtcaggttcttccactgctacaagcg
cggagtggaccgcgtgttcgttgaccacccactgttcctggagag
g
gtgagacgagatctgatcactcgatacgcaattaccaccccattgtaagcagttacagtgagctttttttcccc
ccggcctggtcgctggtttcag
gtttggggaaagaccgaggagaagatctacgggcctgtcgctggaacggacta
cagggacaaccagctgcggttcagcctgctatgccag
gtcaggatggcttgctactacaac
ttcagatcatctgt
atgcagcagtatacaccgatgagaaatgcatgctgttctgcag
gcagcacttgaagctccaaggatcctgagcct
caacaacaacccatacttctccggaccatacg
gtaagagttgcagtcttcgtatatatatctgttgagctcgaga
atcttcacaggaaacggcccatcagacggactgtcattttatactgactactgctgctgctcttcgtccatccat
ccatacaag
gggaggac
gtcgtgttcgtctgcaacgactggcacaccggccctctctcgtgctacctcaagagca
actaccagtcccacggcatctacagggacgccgttttcgttctccatgctcgtatatacctcgtctggtag
tggt
ggtgcttctctgagaaactaactgaaactgactgcatgtctgtctgaccatcttcacgtactaccagaccgcttt
ctgcatccacaacatctcctaccagggccggttcgccttctccgacta
cccggagctgaacctcccggagagatt
caagtcgtccttcgatttcatcgacgggtctgttttcctgcgtgcatgtgaacattcatgaatggtaacccacaa
ctgttcgcgtcctgctggttcattatctgacctgattgcattattgcagctacgagaagcccgtggaaggccgga
agatcaactggatgaaggccgggatcctcgaggccgacagggtcctcaccgtcagcccctactacgccgaggagc
tcat
ctccggcatcgccaggggctgcgagctcgacaacatcatgcgcctcaccggcatcaccggcatcgtcaacg
gcatggacgtcagcgagtgggaccccagcagggacaagtacatcgccgtgaagtacgacgtgtcgacggtgagct
ggctagctagctgattctgctgcctggtcctcctgctcatgctggttcggttctgacgcggcaagtgtacgtacg
tgcgtgcgacggtggtgtggtgtccggttcaggcc
gtggaggccaaggcgctgaacaaggaggcgctgcaggcgg
aggtcgggctcccggtggaccggaacatcccgctggtggcgttcatcggcaggctggaagagcagaagggacccg
acgtcatggcggccgccatcccgcagctcatggagatggtggaggacgtgcagatcgttctgctggtacgtgtgc
gccgcccgccacccggctactacatgcgtgtatcgttcgttctactggaacatgcgtgtgagcaac
gcgatggat
aatgctgcagggcacgggcaagaagaagttcgagcgcatgctcatgagcgccgaggagaagttcccaggcaaggt
gcgcgccgtggtcaagttcaacgcggcgctggcgcaccacatcatggccggcgccgacgtgctcgccgtcaccag
ccgcttcgagccctgcggcctcatccagctgcaggggatgcgatacggaacggtacgagagagaaaaaaaacatc
ctgaatcctgacgagagggaca
gagacagattgattatgaatgcttcatcgatttgaattgattgatcgatgtct
cccgctgcgactcttgcagccctgcgcctgcgcgtccaccggtggactcgtcgacaccatcatcgaaggcaagac
cgggttccacatgggccgcctcagcgtcgacgtaagcctacctctgccatgttctttcttctttctttctgtatg
tatgtatgtatgtacgaatcagcaccgccattcttgtttcgtcgtcctctctt
cccagtgcaacgtcgtggagcc
ggcggacgtcaagaaggtggccaccaccttgcagcgcgccatcaaggtggtcggcacgccggcgtacgaggagat
ggtgaggaactgcatgatccaggatctctcctggaaggtacgtacgcccgccccgccagagcagagcgccaagat
cgatcgaccgaccgaccacacgtacgcgcctcgctcctgtcgctgaccgtggtttaatttgcgaaatgcgcaggg
ccctgccaa
gaactgggagaacgtgctgctcagcctcggggtcgctggcggcgagccaggggtcgaaggcgagga
gatcgcgccgctcgccaaggagaacgtggccgcgccctgaagagttcggcctgcagggcccctgatctcgcgcgt
ggtgcaaagatgttgggacatcttctttata


>
Séquence nucléique 3,
MON810b
_
insertion 2

ggatagctaaacaaaagccttgtagttatggatgaagatgatgatgatgataacacataatatttaagtttggtg
tgtggctaagcagtggaaacacacacgcatgcatatatagaaaaaacaatgaaactttaaactagaacgacaaga
agacgagagctaatattatggaagggtcttgatattgctcaaaacaaaaccatctccacgaactacaacacaaca
aaaaagctagatggcgtgatacttaaggttg
gcttttaaaaagggcatgtgaaaaagggtagaacggtctttttt
ctaattcatcagatgctctgcgtatggagaggttaagacagcaattaatttgatgccgtcctatatatcggaaaa
cgtgtcaaagtgctgggagagacggtgtagtaggggggctccaaaacattcacactaaaatggtgccataaagga
cactacttccaaacaaagaaaaaaaatggtagagttgggagagttttttcggtacaaatttg
gtaccctctcagc
ctctctccactctaggcttcccacagtgggccagacaccttggcgctaggcttgacgatacttttgggcctgctg
ttgggcttgtgccgctggtcacgcgggccttgtggcacacattgggatgactgacactctcttcctcgttgggct
tgcggaaactgttggcgcgagcaaggctttgcccctctttggtttagcttttttctgaccagcttttctaagaat
ctggctgtgaggagaatc
tgagtattattaggattacgtgcggaggaagataaagatgttcatagggttcaggat
ctagaaagtgatggattcctactattgcaacaactcaatcgattatatatttatgttgactttgaatagttttta
cctaaacaaattttatagaagctggctgaaaagctgacgcgtttggcagtccgcagcagcttttggtgaccagaa
gctgcaaaaagctgaaacaaacaggggctttgagacttcgcaggtagcc
gagtgttgcttgctggcatgtgtgat
gtgattccacagggacgacgacgagtgacccaatactaacatcgacaatattaactacatcggagttcacaaaca
attgatgtatgctcctcggattgccacagtgggccgaatactttggcactaggcttcacggtgctcctgggccta
gcgttcagagtgagctcgcttccaatgttgggcctgtgtaatgcatgccctatgagtcagattggctaagactat
cttcg
gctgcttacctatctccgtatctatattcaaactccactctagaaattatagtataatatatctccgtat
ctatattcaaactccactctagaaattatagtataatatagtgatttgagtgactatatgggtggactgctggag
acgacctaaccatgaggaaagaaaaactttgaacatcaagagcaaaaagaaaaaaaatgatacgtaataacgtgt
gtacgcgagtacaaaataaccaaaatatcttagaat
gcatctagttaatcaaattaggttctttgagcctaaaca
ctgaaagagcagtttgtttctagaccaaatttcatggtagttgggagcctacccaaatttcacaattaattgtgc
tattgaattgttgaaaatgattgtgtctgtcatatccgacggataacggaaacccgtccgaaattcgatgggcat
gggcatggatatagatctgtacccactagtatggtcgcaggcggatattggttgcaaccgcagatat
agtttcag
ggaaaaggattaggctcagctccatccctagaccccacttgtgtggggggtctacccttcaaaaggaaaaaaaaa
ctacacacagtgcatataagaagatgaatattccaaaattcagcagtcaagaagccctgataaactgtctggcat
agctagtactttatacacttcaagaccaaaagaaatcactaagtacagattttagtgactcgtaagtacagatat
catcttacaaggcccagcccagc
gacctattacacagcccgctcgggcccgcgacgtcgggacacatcttcttcc
cccttttggtgaagctctgctcgcagctgtccggctccttggacgttcgtgtggcagattcatctgttgtctcgt
ctcctgtgcttcctgggtagcttgtgtagtggagctgacatggtctgagcaggcttaaaatttgctcgtagacga
ggagtaccagcacagcacgttgcggatttctctgcctgtgaagtgcaacgtcta
ggattgtcacacgccttggtc
gcgtcgcgtcgatgcggtggtgagcagagcagcaacagctgggcggcccaacgttggcttccgtgtcttcgtcgt
acgtacgcgcgcgccggggacacgcagcagagagcggagagcgagccgtgcacggggaggtggtgtggaagtgga
gccgcgcgcccggccgcccgcgcccggtgggcaacccaaaagtacccacgacaagcgaaggcgccaaagcgatcc
aagctccgga
acgcaacagcatgcgtcgcgtcggagagccagccacaagcagccgagaaccgaaccggtgggcga
cgcgtcatgggacggacgcgggcgacgcttccaaacgggccacgtacgccggcgtgtgcgtgcgtgcagacgaca
agccaaggcgaggcagcccccgatcgggaaagcgttttgggcgcgagcgctggcgtgcgggtcagtcgctggtgc
gcagtgccggggggaacgggtatcgtggggggcgcgggcgg
aggagagcgtggcgagggccgagagcagcgcgcg
gccgggtcacgcaacgcgccccacgtactgccctccccctccgcgcgcgctagaaataccgaggcctggaccggg
ggggggcccgtcacatccatccatcgaccgatcgatcgccacagccaacaccacccgccgaggcgacgcgacagc
cgccaggaggaaggaataaactcactgccagccagtgaagggggagaagtgtactgctccgtcgaccagtgc
gcg
caccgcccggcagggctgctcatctcgtcgacgaccaggttctgttccgttccgatccgatccgatcctgtcctt
gagtttcgtccagatcctggcgcgtatctgcgtgtttgatgatccaggttcttcgaacctaaatctgtccgtgca
cacgtcttttctctctctcctacgcagtggattaatcggc
atggcggctctggccacgtcgcagctcgtcgcaac
gcgcgccggcctgggcgtcccggacgcg
tccacgttccgccgcggcgccgcgcagggcctgaggggggcccgggc
gtcggcggcggcggacacgctcagcatgcggaccagcgcgcgcgcggcgcccaggcaccagcagcaggcgcgccg
cgggggcaggttcccgtcgctcgtcgtgtgcgccagcgccggcatgaacgtcgtcttcgtcggcgccgagatggc
gccgtggagcaagaccggcggcctcggcgacgtcctcggcggcctgccgccggccatgg
cc
gtaagcgcgcgcac
cgagacatgcatccgttggatcgcgtcttcttcgtgctcttgccgcgtgcatgatgcatgtgtttcctcctggct
tgtgttcgtgtatgtgacgtgtttgttcgggcatgcatgcag
gcgaacgggcaccgtgtcatggtcgtctctccc
cgctacgaccagtacaaggacgcctgggacaccagcgtcgtgtccgag
gtacggccaccgagaccagattcagat
cacagtcacacacac
cgtcatatgaacctttctctgctctgatgcctgcaactgcaaatgcatgcag
atcaagat
gggagacgggtacgagacggtcaggttcttccactgctacaagcgcggagtggaccgcgtgttcgttgaccaccc
actgttcctggagagg
gtgagacgagatctgatcactcgatacgcaattaccaccccattgtaagcagttacagt
gagctttttttccccccggcctggtcgctggtttcag
gtttgggga
aagaccgaggagaagatctacgggcctgt
cgctggaacggactacagggacaaccagctgcggttcagcctgctatgccag
gtcaggatggcttgctactacaa
cttcagatcatctgtatgcagcagtatacaccgatgagaaatgcatgctgttctgcag
gcagcacttgaagctcc
aaggatcctgagcctcaacaacaacccatacttctccggaccatacg
gtaagagttgcagtcttcgtatatatat
ct
gttgagctcgagaatcttcacaggaaacggcccatcagacggactgtcattttatactgactactgctgctgc
tcttcgtccatccatccatacaag
gggaggacgtcgtgttcgtctgcaacgactggcacaccggccctctctcgt
gctacctcaagagcaactaccagtcccacggcatctacagggacgccgttttcgttctccatgctcgtatatacc
tcgtctggtag
tggtggtgcttctctgagaaac
taactgaaactgactgcatgtctgtctgaccatcttcacgta
ctaccagaccgctttctgcatccacaacatctcctaccagggccggttcgccttctccgactacccggagctgaa
cctcccggagagattcaagtcgtccttcgatttcatcgacgggtctgttttcctgcgtgcatgtgaacattcatg
aatggtaacccacaactgttcgcgtcctgctggttcattatctgacctgattgcattattgcag
ctacgagaagc
ccgtggaaggccggaagatcaactggatgaaggccgggatcctcgaggccgacagggtcctcaccgtcagcccct
actacgccgaggagctcatctccggcatcgccaggggctgcgagctcgacaacatcatgcgcctcaccggcatca
ccggcatcgtcaacggcatggacgtcagcgagtgggaccccagcagggacaagtacatcgccgtgaagtacgacg
tgtcgacggtgagctggcta
gctagctgattctgctgcctggtcctcctgctcatgctggttcggttctgacgcg
gcaagtgtacgtacgtgcgtgcgacggtggtgtggtgtccggttcaggccgtggaggccaaggcgctgaacaagg
aggcgctgcaggcggaggtcgggctcccggtggaccggaacatcccgctggtggcgttcatcggcaggctggaag
agcagaagggacccgacgtcatggcggccgccatcccgcagctcatggaga
tggtggaggacgtgcagatcgttc
tgctggtacgtgtgcgccgcccgccacccggctactacatgcgtgtatcgttcgttctactggaacatgcgtgtg
agcaacgcgatggataatgctgcagggcacgggcaagaagaagttcgagcgcatgctcatgagcgccgaggagaa
gttcccaggcaaggtgcgcgccgtggtcaagttcaacgcggcgctggcgcaccacatcatggccggcgccgacgt
gctcgcc
gtcaccagccgcttcgagccctgcggcctcatccagctgcaggggatgcgatacggaacggtacgaga
gagaaaaaaaacatcctgaatcctgacgagagggacagagacagattgattatgaatgcttcatcgatttgaatt
gattgatcgatgtctcccgctgcgactcttgcagccctgcgcctgcgcgtccaccggtggactcgtcgacaccat
catcgaaggcaagaccgggttccacatgggccgcctca
gcgtcgacgtaagcctacctctgccatgttctttctt
ctttctttctgtatgtatgtatgtatgtacgaatcagcaccgccattcttgtttcgtcgtcctctcttcccagtg
caacgtcgtggagccggcggacgtcaagaaggtggccaccaccttgcagcgcgccatcaaggtggtcggcacgcc
ggcgtacgaggagatggtgaggaactgcatgatccaggatctctcctggaaggtacgtacgcccgcccc
gccaga
gcagagcgccaagatcgatcgaccgaccgaccacacgtacgcgcctcgctcctgtcgctgaccgtggtttaattt
gcgaaatgcgcagggccctgccaagaactgggagaacgtgctgctcagcctcggggtcgctggcggcgagccagg
ggtcgaaggcgaggagatcgcgccgctcgccaaggagaacgtggccgcgccctgaagagttcggcctgcagggcc
cctgatctcgcgcgtggtgcaaaga
tgttgggacatcttctttatagatcatttaagagaggaaaagggttgcaa
gagacccgtccttggtggactcttcaatggggagtaggctcttcagaaccaaacctcgggaaacaagtcccttat
gttctttgtgtttgatcattgattgtgatttatttcttcctctcctctctccctagttctcttgcttgcgcttga
tttcatataaactaagttgctgcctaagttctccgcaaattattttgagcaacttc
tgcaagaactctctctctc
tccctcactcatattattgttattctcgttctaacacctaacacctaactaagttctccgtaaatttcaggttta
tcctattcaccccatagacgagtttcaaaagctggttctgggtttgtcaggaagtatattgtaaggcatgggtag
tcaagagagaatttgtgcctctcttcttaagatatatatatatataggatcctcaagtgattggattaagaaatg
catgagtgttaa
cctataaaaggattccaagtcacagcatcgagaaaaaaaaggttagcttagagtcagaccaaa
tatcgtgagataaaaagaactacatgtatataatgttatgatattttgtctaatatgatctttattacacgtaag
agttgacatgtcttgcaagaggctgctgtcaattattggtccaagcaaaagtacttggcccatgtctatgtgtac
gtgaacctataggatcacatacttaagggctagaaccctaatt
cagatagcaacaaaattagattagatttagga
gtgttaataggccttggagtcagaatcccattaggacacctatataatgagaggtggaggcacggttagggttga
ccctagtttgccaaccaacagccgccctcctcgccctcacctagttgcatgtcgcggacctagcagtccagtgtg
tgacacttccttcttgtacatgtggataccttggaggtgatgtatctggagcactagggtgaacaactcgagga
c
gtgaaggacgtcggtggcgcactgctcgacacaatcgtctacatccagacaatttttgctgtgactacgcatcaa
gtggtaatcccgtgatctataatcgtagcagttcttgtttattatgaggttgaaaattttgttttgcgctagcgt
agcctcccgatattccaacaaggtgtcacaggatacgacacgtcaactagccgttagagtttccgttagctaaca
tttgggtaccgtacaactagtgtgtcatcc
agtgtgccaccagttatgtcaggtgcgcctagctcaacttggttc
atttgatatgctctctacaagttgtatccagtgagatgtctagtgtaccatcagatacgtcaggtgcccactgtg
ttctgtaacaccctgaattttggggtataaatttttttttctaaatacccataaaaattcaggtgttaccctccc
ttcatcattctctcctaatttatttcttccttatttgagagagcgttattttcggtatacg
tgtaaagccggaga
ttaaaatccaaagggagtggtgtaatgttgcatcatgttggaccataaatttttgtatggtgtttgttttagtgt
gcattcatttaagtcttgtgaagcatgtttgaatatgggtttaaagaaataaaagagacaaaact
tattccagta
tggacgattcaaggcttgcttcataaaccaaggcaagtaatagaga
ttggagtctctaagaaagtagttcctact
gaatcaaaggccatgga
gtcaaaaattcagatcgaggatctaacagaactcgccgtgaagactggcgaacagttc
atacagagtcttttacgactcaatgacaagaagaaaatcttcgtcaacatggtggagcacgacactctcgtctac
tccaagaatatcaaagatacagtctcagaagaccaaagggctattgagacttttcaacaaagggtaatatcggga
aacctcctcggattccattgcccagctatctgtcacttcatcaaaagg
acagtagaaaaggaaggtggcacctac
aaatgccatcattgcgataaaggaaaggctatcgttcaagatgcctctgccgacagtggtcccaaagatggaccc
ccacccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtgatatc
tccactgacgtaagggatgacgcacaatcccactatccttcgcaagacccttcctctatataaggaagttcattt
catt
tggagaggacacgctgaaatcaccagtctctctctacaaatcttgtgctctcctacctcctgatggtatct
gatatctacgaacgtacactatattgcttctcttacatacgtatcttgctcgatgccttctcccagtattgacca
gtgtactcacatagtcttgctcattcattgtaatgcaatggctcagagaatagaacagaatattaggcaaccaca
tcttatggatatccttaataggataaccatttata
ctgatgtgcatagaggctttaattattggtcagggcatca
aataacagcttctcctgtagggttttcaggaccagaattcgcattccctttatttgggaatgcggggaatgcagc
tccacccgtacttgtctcattaactggtttggggatttttagaacattatcttcacctttatatagaagaattat
acttggttcaggcccaaataatcaggaactgtttgtccttgatggaacggagttttcttttgcctc
cctaacgac
caacttgccttccactatatatagacaaaggggtacagtcgattcactagatgtaataccgccacaggataatag
tgtaccacctcgtgcgggatttagccatcgattgagtcatgttacaatgctgagccaagcagctggagcagttta
caccttgagagctccaacgttttcttggcagcatcgcagtgctgaatttaataatataattccttcatcacaaat
tacacaaatacctttaacaaaa
tctactaatcttggctctggaacttctgtcgttaaaggaccaggatttacagg
aggagatattcttcgaagaacttcacctggccagatttcaaccttaagagtaaatattactgcaccattatcaca
aagatatcgggtaagaattcgctacgcttctactacagatttacaattccatacatcaattgacggaagacctat
taatcagggtaatttttcagcaactatgagtagtgggagtaatttacagtccg
gaagctttaggactgtaggttt
tactactccgtttaacttttcaaatggatcaagtgtatttacgttaagtgctcatgtcttcaattcaggcaatga
agtttatatagatcgaattgaatttgttccggcagaagtaacctttgaggcagaatatgatttagaaagagcaca
aaaggcggtgaatgagctgtttacttcttccaatcaaatcgggttaaaaacagatgtgacggattatcatattga
tcaagtatc
caatttagttgagtgtttatcagatgaattttgtctggatgaaaaacaagaattgtccgagaaagt
caaacatgcgaagcgacttagtgatgagcggaatttacttcaagatccaaacttcagagggatcaatagacaact
agaccgtggctggagaggaagtacggatattaccatccaaggaggcgatgacgtattcaaagagaattacgttac
gctattgggtacctttgatgagtgctatccaacgtattta
tatcaaaaaatagatgagtcgaaattaaaagccta
tacccgttatcaattaagagggtatatcgaagatagtcaagacttagaaatctatttaattcgctacaatgcaaa
acatgaaacagtaaatgtgccaggtacgggttccttatggccgctttcagcccaaagtccaatcggaaagtgtgg
agagccgaatcgatgcgcgccacaccttgaatggaatcctgacttagattgttcgtgtagggatggagaaa
aatg
tgcccatcattcccatcatttctccttggacattgatgttggatgtacagacttaaatgaggacttaggtgtatg
ggtgatattcaagattaagacgcaagatggccatgcaagactaggaaatctagaatttctcgaagagaaaccatt
agtaggagaagcactagctcgtgtgaaaagagcggagaaaaaatggagagacaaacgtgaaaaattggaatggga
aacaaatattgtttataaagaggcaaa
agaatctgtagatgctttatttgtaaactctcaatatgatagattaca
agcggataccaacatcgcgatgattcatgcggcagataaacgcgttcatagcattcgagaagcttatttgcctga
gctgtctgtgattccgggtgtcaatgcggctatttttgaagaattagaagggcgtattttcactgcattctccct
atatgatgcgagaaatgtcattaaaaatggtgattttaataatggcttatcctgctgg
aacgtgaaagggcatgt
agatgtagaagaacaaaacaaccaccgttcggtccttgttgttccggaatgggaagcagaagtgtcacaagaagt
tcgtgtctgtccgggtcgtggctatatccttcgtgtcacagcgtacaaggagggatatggagaaggttgcgtaac
cattcatgagatcgagaacaatacagacgaactgaagtctagcaactgtgtagaagaggaagtatatccaaacaa
cacggtaacgtgta
atgattatactgcgactcaagaagaatatgagggtacgtacacttctcgtaatcgaggata
tgacggagcctatgaaagcaattcttctgtaccagctgattatgcatcagcctatgaagaaaaagcatatacaga
tggacgaagagacaatccttgtgaatctaacagaggatatggggattacacaccactaccagctggctatgtgac
aaaagaattagagtacttcccagaaaccgataaggtatggattga
gatcggagaaacggaaggaacattcatcgt
ggacagcgtggaattacttcttatggaggaataagatcgttcaaa
catttggcaataaagtttcttaagattgaa
tcctgttgccggtcttgcgatgattatcatata
agcccagcgcgccggtggcccacgcccccgcgtgtggcctgc
ctagctcccctccccctttcccctcggcagcccactcccgcgcgtggcctagttcacgtccgcggcccacgctcc
c
tccccctttctgcgccaacgtctatgtggcccaccctgtcgccccccgcgtttcctcgccctagcccagctttc
agtccgacagcatgagggctatctccagcaacgtcccttaaatttcatcccctaaaagaatattctatgtccttt
acagtactctctaaaagattctgtactctatatcttcttcatctccagcaatatcccctaaatttcatcctctat
atcaacagtgttaccagatttgacattctata
ttattttttaccactagttagcacgtgcacagaaatcagcaca
gtgtatagagcaccaccgtacatcctctcagggacggagccagaaaaaagtttaggagggactgaactaaattgc
tgcagtataaaatctcattctacattatattgtatatattttagattaggggaggctgtagtgaggctctatagg
atccgaagcggtaggggggctcgagccccgcccgccccaccgctggatccgtccctgcatcct
ctatacataacg
catgcatggcatcatctaaattttagaggaccttttaaagtctcttgttggagggataaaggatctaacaaacct
ctatatttagaggacaagaacttttacaggatcctgctggagccatcctgaatccacgcaccgtgttatgaccca
gtcgtgcctggcccacgccgtgcgctgcctctgcactaacgcctaggcatgtgtagtggtcgttggtcccgtgtg
tcagtcttcccttcccaag
taacgtatcttcctcctggctctctatgtcgttcgcgcccacaacgccaaaaatac
ggaaaccgcacgcccaactccgctctcctctccctcatgctccctataaccacgacatccgcatgctcgccttgc
agccgcctcaccggatgcctcatctaggctcgagcatgtcaccctatcgcaccttcacagccaccacgttgaaga
agcagtctagtgcacatcgaaccggtctagtgaattttaatttttataat
ttaaattcatgactagatcggtccg
atgtgaatcggactgcttcttcaatggctacttcggacttcgcccggtgctcaatggctagctgacgtcgtcgga
cggtccggtgccatccagccaaggaaaggtgtcaatcagatcccgaactaggttcacacagactcggtgcggtgg
tgtatcagacctgtccagtgcgcccgcagacagaaaatttttgctgctttctatggaaggaggcaacggctaggg
gttctc
ttggggctataaaaggaccccctagacgcctccattctacccaagtactccaagagctatacaacactc
caacacgctgcaacaatgtattctaactattttagtgagatctgagcaacagttacaagttgttcctatttattt
gtgttcttgcgctcttgtctttgttattcttgcgtgtgttgctatccattgctcttgtgtgtgtaatttttctca
ctcccttactctaagttgacactataatcttgcaaaa
gactccaagttgtggagattccttgcaacgagaatctt
gaggtataaggaagaactgtggcactcaagtttgatctaggtgatcacttgcgaggggttgattgcaactcttgt
ccaaaggaggacaccacaacatggatgtaagctttgcaaaataacgagataaaaattgtgtgtctcacttgttgt
cggtgttttgggtccgaccgcgcacccggggttacccctcaaggtgcttttaggagtaggacggtgtt
accgact
gtagctcgatggttcgtgctgggcgcacgagaaatagtggacaatgatgtacaggttcgggccgcttcgagatgc
gtaacaccctaagtcctagcgagagtgctttatgtgatgggttacaagggagttctccagtgctggaaaacgtag
agagcggggtggatggctaagtaatgagtgatcgttctgaaggggtgccctctaggccttatatactcgaccgtg
gggcgctacatgcagatatgataa
caacgcgtgcctaagaaatagtgaaccatctgagtctattctcctataatt
cagccaacccatcctcgcttggttccgttgtacggggctcctgcgcgggaaggtcgggtcactgttgtgattgct
actcgaatttgttgggtcgtctgggcttgcgccgatccggccttgcgttaatccgttccactggtcgttcctccc
aggcccacgaggggatgaccttacgaattatggggcccgtgggcctttcgtgagg
tcttttatccttctagtgga
cccgggggatatctgtcccccacaagcccccgatctttgggttgattttgaaataaacggcccaaagatcctagg
tccagcttgcagtctttgattttaacagggaatgttttggaaataagtctgtcgggccactgcttctgaattctg
agtgatctggttaaaatttggtgtcttcttctgccattattcctcaaagtttggtgttctgtctcaggttcatgc
ttcggaggtca
gcattttttactgtaggacttcaaacttcattgggtgcaccgggtgtagcccccgagcttcgag
tggatttttgcatacaatccactcgaaggtcttcacttcgagtattatcagaaatcacttttatcttccacttgt
gctttttcagaggtcagccttgtcttaattttgccttatgctttagaggtcagcattttgcttcttcggggatga
tgattcattgggtgcaccgagggtgcacccaatgggtgtagc
ccccgagcttcgagtggatttttgaaaataatc
cactcgaaggacttcatttcatgtctttttctgggaatcatcctttccttttgtcgaatgcctttagagatcaac
attatattgttaacactatgctttagaggtcagcacacatttttgtctttgaggctgagtacgcgatctgcccat
atcttgctaggtcctgcaatttacttgatctgcaactgattggacgttcgatagatggcccttgactagtctt
ca
tgtcacttcgtgctttgatgcttttgttgattagacttgtaccttatcagctatatttggctttcctttaatcct
tgctgatatctctcttctgtcttggagtattcattgcatatactgtacggatgtgacggttttggaaaatatact
gataattcctgggcgtcccccccaatgggtgtaggcaagggacagcttggtacgctgagcgattagcaaactgct
tctgagtagtaacttgatgtgaccgtgag
tgtagtcatatcgcccgcacagttgactggagtcccaatgggtgtc
gtgttacgtgaaacggcgtcagccgcctaacgtgtctttagatggtttgaattgcatattgaatttttgcgactg
ttcggtggccatggtaggaggtgagcggttgcctccttcttctataaatagtgttcttgcttctccggcattttc
acatttcttactgttgcttgttgtttactctcctcttcttccttccactccaccatgggc
aagagcaagaaaggt
ggtggttcttcgcatcattccgacgacaagcgcaagcgcgagccgactcctccctcggaggacttcggtgactca
gagtactcggaggaggagttctcctccgagtccgagggctctccggctcctgcctctcccccagcgtcgtctgat
gattcagacgactcccaggggatcgtcgtagaggtatggacttacatccgggccgtcgagcgcgccgggctcgag
ggctcggatgagtcag
agtactcttcggacgaggaggactcctctgactcgtccgaggagggcagcggcggcgac
ggaggtgacggcgacgacgacggaggcgacggtgacggcggcgacgacagcggcaagggcggtgacagcagcggc
aagggtgccagcggcgacggcggcgacggcagcaagggcagcagcaagggcagcaacaaggccagtggctagacg
ccactggttttagatgttaatgtagattagtagtagaaatagtacta
gcgaaataatgtagtagtagctagtagt
atagttagtgaaatataatgtagtagtagggaaggcatcagctcataatgagttgatttgtaagttcagtaatgc
ttcccttatgaagaatgatttcgcgcctcttctgtgtgcattattttgccttctggtcagtcatcgatcgtttta
atatttaccgccaatgatgttttctatctgcaacgcttgagtagcaacttggagtcattgggtcacgcttcagac
tgc
tttatttgcgatgtcagtgctttggtggtagcggccgagttattattagcgatgttggcactttttgaggta
atggctgagtgatagcgggccacgtcggtgttttagaagtaacgaccgagtggttactggtgatgtcggcgtttt
agaggtaacagctgaatccttcggagccacatcaccactttaggaataacaatcgagtgactgatggcgacgtcg
acgtcgacgttttagaggtaacagccgagtgatc
gatggcgacgttggcgttttagaggtaacagccgagtgatc
gatggcgacgtcggcgttttagaggtaacagccgagtgataacgggccacgccggccgctttggaaacaatggcc
gggtgaagtctggtaacgtcagcgttttagaaataaccgctgagttaaaatgggccgcgtcggccgttttggaaa
taacggccgagtgatgatgtggcacgcccgcattttggaagtggtgtctggcccggggaaacccc
atatgtactg
cactgtcgcacgcctccacgttatgtgccctagtttttgcttttctgcatccaagccttctctattcttctgcaa
tattgcttccgctccgctcgctagcaaggttgagatggcgcccaagcggaaagctttgagtttgtccgtcgcaat
cattccccccatcgatcccaacagtcagttgcccttcgcaggtaaccatatgtccattatctctgaatccgacct
tcttcatcttgtatccatcgg
agttcttcctccgaaggagctctgttcctggcggatctgccgtggggttactgt
tccgacagaagacacccacgaatctgtcatttatgttccttttcttatctgcggccttgctcttcccatttctcc
tttcttccgcggtctccttgatttccatcgcttgaatctgacccacctgaatcccaattccattctgcaagtttc
tgtttttgtccatttatgcgaagccttccttggtgttttgccttacttcggc
ctttggaagcatttgtaccactg
tcgacctgggatggccggagggcagcaccagcttatggggggcgcgagtttggagatgcgctgtgggaggaagac
tgactatctcgacatcccactcaaggacaacatcaagggatggcgcctggaatggttcgtcgtggagaatcatgg
gaattctctccccctacggtcggggagacagccagatgttcacactccgagttggaccgaatcccccacggacca
ggaggtgg
ctgaggcaggggctctgcttgctgaggttgggctgatgaaagagaggggtttgactgcagaggctgt
ggttgccgacttcattttcaagaacattcagccactgaaagacagagcataccccgcatatttgtatcggggcct
ggctgattcaacccgggtaactaacagaagaattcctgctgtggacttggtgagccggctcgagatgatactcag
aggcaaggtgtcgaacatcggcgctcctgttgcatactc
ggcctggaatctgccttcttccaaggcctttaccag
tttcgtgtcaaatcttcctactggtgatagcggtttgggccttagactgtgaccctctcccgaagaagttagtgc
tttggttgcctcactcgaagaaattcctgacgacgagaggcaggttcattttgaggtgcctttgaatccaagtga
cacggacataagtgccatgctggatatgttggctgaggattcttctgatgctgctcctgccgaaacattg
gtggt
ggcacccatccctgaggccggcaaagctttggatattcagaggtctaacagtgttcgcccgaagcgttctcgccg
aaccaatcagcccacttctcctgctgaggggaagaaaaagaagaagagatgtcttcatcgagtgtctagcttgga
tcaggatgccggtccttctgttcctgctgctgaggaagtgccagtgcctgcatttgctagagctaaccccaatgg
atgtgacccgactgctgtggaaccca
atgggtgtgacctggatgacattgaacccaatgggtgtgatctggccaa
agctgaccccaatgggtgtactgtctgcgttgttgatgaagatgaggaagaggaggatgaaatccctctaattcg
gaagaacagtcggcgttccctagccagcggggaaagcagtggtgttccttctccagctttatctggcctcattgg
tctgcaagaattatctctggtgaattttgatcagactcttgaagacatggtcccaaa
agatctgttgtcagagcc
agcagatggtggcatgatggatgtttgcactgatgtgcctgatgctgagctggagttatcccgggtggcgtcccg
cgcctcatcgaccttggagcgtggtcttaagggtcaggatgctggtctggattgttctgctcccatggaagtgga
tgaaggtccttcagccttagaggtggctgttacagagagcttgcccctcaaggatggcgctagcgcttacccaac
caccgagggtgtt
gccggggatgacccggctcggatgggtagcgcgagctatgacccagcccccaagggtgttcg
agtcggttctccctctcacacttccatggacgttcacgtaggatcttctcctccgcattctggttgcatggcagc
agcccaagcttcgggtcaggaagtcaccttagaggccagcgctcttgatgacagagttttgacctctgctgatga
tactgatctggtccccactgatgcattgcgggttgtttcggttg
gtgatccttcatcgagccatcagctaacttc
ccacgacttgggagttccttcatttttattgatctagttgtaccccaggcgtgatattgctctgatattcatttg
tttttaatgtcaggcgttggttgatgaaatggttggtcagctgaggtcacagggtgcttctgtcccggaaagggc
tctatctctggcacattggaatccagtgctgcttcagcggcgggtgtctgatttggagatggcaaatgctggtta
gtgccctttgtttcttctttgattacttgattaattatgtttttaactgaacacctttgcttgactatttcttaa
cagatatggctcggcagtattctgttcttgaagaaaaatattcttaaggtcagactgaactggcccggtttctgc
ttctctgaatgatgctagcacgctgagctccaccctccgtgctcagctcgactctgaaaaggtgaccagtgaatc
ttggttttgtttgctgtgttcttattgcttg
ctttgacatttggagaaactaattcttgtctgcaggaggaaaag
cgcgcccttgccacttctcgtgacaaccttgacaagctataccgcgacaccagcaactcgttgaccatcttggag
aggagtcatcgcttcaccagggaagagttggataatcatcgttataagctgcaagagtccttggacgatgtgatt
cgcctcaggcagttggtgtcgaccaaagatactgtcatcaaggatctgcgtgcttccaagaa
atcagtcatccag
gagctagaaactgctcggttggctgtcaaagctgctgaagagacttctgctactcgcgcgacaaagctatggata
aagctattcgcgcggggcggatcctgatgaggagacccggcgtggttgttcctgacgacgtagtggccgacgtga
atgccgctcctgattcctcgagtcgtccttcctcgtcagttgctcctgagaagaacatcactaaataga




Annexe
s







Annotation, ou prédiction de gènes


Plusieurs programmes d’a
nnotation
sont disponibles et
en libre accès sur le web

/ plus ou
moins performants selon l’espèce étudiée


à tester…

FGENESH
http://www.softb
erry.com/berry.phtml

GeneMark
TM

http://opal.biology.gatech.edu/GeneMark/

GenScan
http://genes.mit.edu/GENSCAN.html


Recherche de similarités de
séquences




Où chercher ?


da湳 l
es⁢ 湱nes⁤ ⁤潮滩 s

Les trois principales banques de données de séquences internationales sont :

1/
Banque
GenBank


diffusée par le NCBI (National Center for Biotechnology Information, USA)
http://www.ncbi.nlm.nih.gov/

2/
Banque de
EMBL

(European Molecular Biology Laboratory)

diffusée par EBI (European Bioinformatics Institute, UK)
http://www.ebi.ac.uk/

3/ Banque

DDBJ

(DNA Data Bank of Japan)

diffusée par le NIG (National Institute of Genetics, Japon) :
http://www
.ddbj.nig.ac
.jp/




Comment chercher ?


畴楬楳e
r

汥潧楣ie氠䉌BS吠T䉡Bic⁌潣a氠䅬楧湭An琠卥a牣h⁔潯


Différentes versions de l’algorithme BLAST existe, en
fo
nction

-

des

quences utilis
é
es pour lancer
la

requ
ête (= séquence query)

-

des séquences interrogées pour leur niveau de similarités avec la séquence requête (=
séquence subject)

Tableau 1.
Caractéristiques des séquences utilisées dans les 6 algorithmes
disponibles
de BLAST

blastn


ADN


A䑎 ⼠Coméa牡楳ên⁤Dune⁳éèuenceu捬cue 癳⸠banèueu捬cue

blastx


ADN traduit


é牯瓩楮e ⼠Coméa牡楳ên dDune⁳éèuence nu捬cue⁴牡du楴e
 an猠
汥l

S⁣ d牥猠de 捴u牥⤠癳⸠banèue⁤e⁰牯êé楮is

tblastx


ADN traduit


é牯瓩楮e ⼠Coméa牡楳ên dDune⁳éèuence nu捬cue⁴牡du楴e
 an猠
汥猠S⁣ d牥猠de 捴u牥⤠癳⸠banèueu捬èue⁴牡êu楴i
dan猠se猠s⁣ad牥猠de
汥捴u牥ê

blastp


protéine


é牯êéine⁃ méa
êa楳潮 dDune⁳éèuen捥⁰牯êéièue⁶ ⸠banèue de
é牯êé楮es

tblastn


protéine


A䑎⁴牡êu楴⁃iméa牡楳ên⁤Dune⁳ èuen捥 é牯êé楱ue⁶献 banèue
nu捬cue⁴牡du楴e
 an猠汥s‶⁣ d牥猠de 捴u牥⤠




Comparer deux séquences pour leur niveau de similarités

(c’est
-
à
-
dire rechercher les régions
identiques entre deux séquences données)



畴楬楳e爠扬bseq

摵⁎d䉉


Align t
wo (or more) sequences using BLAST (bl2seq)

http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&PROG_DEF=blastn&BLAST_PROG_
DEF=megaBlast&SHOW_DEFAULTS=on&BLAST_SPEC=blast2seq&LINK_LOC=align2seq



Sites web pour de
ssiner des amorces PCR


-

pour dessiner des amorces PCR

:

Primer3

:
http://primer3.wi.mit.edu/


et

Primer Blast

:
http://www.ncbi.nlm.nih.gov/tools/primer
-
blast/


-

pour vérifier les propriétés et stabilité des dimères :

OligoAnalizer

:
http://eu.idtdna.com/analyzer/Applications/OligoA
nalyzer/



Pour réaliser des alignements de
plusieurs
séquences
en même temps


ClustalW sous EBI

:
http://www.ebi.ac.uk/Tools/msa/clustalw2/

-

avec un logiciel intégré de phylogénie

ou

MultAlin

:
http://multalin.toulouse.inra.fr/multalin/



Autres sites web d’intérêt pour le TD




http://www.maisadour
-
semences.fr/index.php

avec des dossiers sur les maïs spéciaux


Avec les informations que vous pouvez trouver sur ce site


Maïsadour Semences


(oui,
il faut fouiller un peu), nous vous demandons de rédiger une petite discussion en
term
es d’applications par rapport aux résultats que vous aurez obtenus lors des
analyses de séquences réalisées sur les deux insertions à comparer.





http://www.maizegdb.org/


Pour information et curiosité, voici la
plateforme dédiée aux ressources génomiques disponibles sur le
maïs, dont la séquence complète du génome (du génotype appelé B73) a été publiée en 2009.