Genetics-FS11x

groupmoujeanteaBiotechnology

Oct 23, 2013 (3 years and 9 months ago)

86 views

Genetics

The Conversion of Information from
Genetics to Protein

THE DISCOVERY OF DNA AND ITS
ROLE

The Turn of the Century


Optical Investigation


Chemical Analysis of the Nucleus


The
Problem of Information


Griffith


Avery,
MacCarty

and McCloud


Chargaff

Watson and Crick

5’


3’ Notation

5’


ACTG


3’

3’


TGAC


5’

THE FLOW OF INFORMATION

The Flow of Information

DNA

tRNA

rRNA

mRNA

Peptide

Ribosome

rProteins

Amino Acids

Proteins

Replication

Transcription

Translation

Post Translational

Processing

Degradation

Transcription

REPLICATION

Chromosomal Level

ORI

Termination Point

Molecular Level

Practical Level


If given a replication problem you simply have to
rely on Chargaff’s Rule to fill in the missing data.


5’


ATGGTAGCTATGTAGTAGGAATT


3’

3’


TACCATCGATACATCATCCTTAA


5’


Remember that the second strand runs antiparallel
to the original strand.

TRANSCRIPTION

Operon Structure

Promoter

Gene Sequences

Terminator


Most Gene Sequences in Bacteria are arranged
in this type of
Promoter/Terminator

system


Operons

(grouped gene sequences under a
single control) serve as a regulatory device.


Most Gene Regulation occurs at the
level of
Transcription
.

Practical Level


Transcription occurs in a similar fashion to
Replication, with the
RNA Polymerase
doing
most of the duties.


The Hardest Part is telling the difference
between
coding

and
template

strands.


Coding

= the information


Template

= the compliment of coding that is
used to make the RNA
strand

Practical Level 2






Note: The RNA is produced from the Template,
but replicates the information on the Coding.
Also note the use of “U” in place of “T.”

Coding

5’

CGCATGCCCGTGTGAGCGATAGT


3’

Template

3’

GCGTACGGGCACACTCGCTATCA


5’


RNA

5’

CGCAUGCCCGUGUGAGCGAUAGU


3’

TRANSLATION

Translation Mechanism

Translation Mechanism 2

The Genetic Code

Practical





1.
Always look for the first “Start” Codon from the
5’ end.

2.
Separate the Codons

3.
Translate the Codons till you reach a “Stop”
Codon

5’

CGCAUGCCCGUGUGAGCGAUAGU


3’

5’

CGC
AUG CCC GUG UGA GCG AUA GU


3’

MET|PRO|VAL|STOP

MUTATION

Mutations


Mutations are
changes to the DNA
of a cell.


Mutations occur either during Replication
or between Replication cycles.


Mutations can be mistakes or changes
caused by external sources.


A mutation that makes it through
one
replication cycle

becomes permanent.

DNA Repair and Proofing


DNA Polymerase has a built in
proofreading

function.


The worst proofreading occurs in the viruses
while the best is in the
Eukarya
.


Mistakes that make it through proofreading
are often caught by the
DNA repair systems

Types of Mutations


Structural


Indel



Bases are inserted or deleted from the
sequence


Substitution



Bases are changed within the sequence


Functional


Missense



Changes the amino acid coded


Nonsense



Changes to a STOP
codon


Frame
-
Shift



Changes the Reading Frame


Silent



No change to amino acid coded

Practical Level

RNA 5’


GCAUGCCAUGCAGAUGA


3’

RNA 5’


GC AUG CCA UGC AGA UGA


3’

Protein Met
-
Pro
-
Cys
-
Arg
-
STOP

RNA 5’


GCAUGCC
C
UGCAGAUGA


3’

RNA 5’


GC AUG CC
C

UGC AGA UGA


3’

Protein Met
-
Pro
-
Cys
-
Arg
-
STOP
SUBSTITUTION / SILENT

RNA 5’


GCAUG
U
CAUGCAGAUGA


3’

RNA 5’


GC AUG
U
CA UGC AGA UGA


3’

Protein Met
-
Ser
-
Cy
-
s
-
Arg
-
STOP
SUBSTITUTION / MISSENSE

Practical Level 2

RNA 5’


GCAUGCCAUGCAGAUGA


3’

RNA 5’


GC AUG CCA UGC AGA UGA


3’

Protein Met
-
Pro
-
Cys
-
Arg
-
STOP

RNA 5’


GCAUGCCAUG
A
AGAUGA


3’

RNA 5’


GC AUG CCA UG
A

AGA UGA


3’

Protein Met
-
Pro
-
STOP SUBSTITUTION / NONSENSE

RNA 5’


GC
_
UGCCAUGCAGAUGA


3’

RNA 5’


GC
UGCC AUG CAG AUG A


3’

Protein Met


Gln



Met INDEL / FRAME
-
SHIFT

RECOMBINATION

Horizontal Gene Transfer


Bacteria do not have sex, so they have evolved
a different set of mechanisms to reshuffle
genetic potential.


The ultimate source of genetic variation is
mutation.


Horizontal Genetic Transfer

is transfer of
genetic material within a generation.

Mechanisms


Conjugation



Exchange along a pilus


Transduction



Exchange through defective
bacteriophage


Transformation


The uptake of naked DNA


Transposons



Interruption through “jumping”
elements.

BIOTECHNOLOGY

Recombinant DNA (
rDNA
)


Recombinant DNA (
rDNA
) Technology is the
insertion of a
novel genetic sequence
into a
new host.


Basic
rDNA

Procedure


Isolation of gene of interest and suitable
vector


Gene of interest is
inserted
in vitro

into vector


Modified vector is introduced into a
host


Modified vector multiplies in host, making a
line of
clones
.


These clones can be used for many
purposes
.

Tools of Biotechnology


Selection



a procedure where strains with a
selective advantage of interest are favored in the
environment and therefore become more
numerous (contrast
natural

and
artificial
selection
).


Mutation



Changes are made to selected DNA
(either directed or random) to change the
properties of the sequence.


Often these two techniques are
used in concert
.

Selection Example

Select one colony and
then replica plate on two
different media

NA Plate

NA Plate

NA Plate

Plus Antibiotic

Restriction Enzymes


Useful tools in Molecular Biology to
manipulate
specific sequences of DNA


Evolutionarily are a type of
viral defense
mechanism


Serve as the
Cut

function in Molecular Biology


DNA Ligase
(Replication) serves the
Paste

function

Vectors


Properties of Vectors (typically
Plasmids
)


Self
-
replication


Size capable of
in vitro

manipulation


Protection mechanism


Marker gene



Cross organism manipulation can be
accomplished with
shuttle vectors


Viral Nucleic Acids

can also be used

Polymerase Chain Reaction

Inserting DNA


Various methods are used to insert foreign
DNA into host cells,
typically this is the step
with the lowest efficiency
.


Transformation


Electroporation


Protoplast Fusion


Ballistic Insertion


Microinjections

Choosing the Right Host


Which
Host
you use takes into consideration
many factors
, here are typical hosts.


Escherishia

coli


Bacillus spp.
(such as
B.
subtilis

or
B.
megaterium
)


Saccharomyces
cerevisiae


Mammalian Cells


Plant Cells

BIOETHICS

EVOLUTIONARY THEORY

Evolutionary Theory 101


Core Tenets of Theory


All Populations possess
Genetic Variation


Genetic Variation is passed
Generationally


The
Environment Selects
the most adapted
genetic variants.




Implication



Common descent means that
there must be a common ancestor.

LUCA


LUCA



Last Universal Common Ancestor



Evidence for LUCA


Genetic Code


Conserved Information Mechanisms


Conserved Biochemical Pathways


Conserved Structural
Details



What existed before LUCA?


Can we test the hypotheses experimentally?


Pathways Away from LUCA

G+ Bacteria

Spirochetes

Proteobacteria

Aquifex

ARCHAEA

Protists

Viridiplantae

Fungi

Animals

LUCA

Bacteria

Eukarya

Horizontal Gene Transfer and
Endosymbiosis

G+ Bacteria

Spirochetes

Proteobacteria

Aquifex

ARCHAEA

Protists

Viridiplantae

Fungi

Animals

LUCA

Bacteria

Eukarya

Mitochondria

Chloroplasts

TAXONOMY AND PHYLOGENY

Taxonomy vs. Phylogeny


Taxonomy



A practical division of a complex
group of items based on shared
characteristics.



Phylogeny



A division of biological groups
based on evolutionary understanding.

Classical Taxonomy


Organisms (not viruses) are classified by the
classical
Linnean

System


Domain


Kingdom


Phylum


Class



NOT ALL MAY BE DEFINED FOR


Order



A PARTICULAR ORGANISM


Family


Genus


Species

What is a Species?


Since Prokaryotes do not have sex, it is impossible
to apply the
Biological Species Concept
.


Microbiologists argue about how to define a
species.


Functional Definition


A group of organisms that
share a common evolutionary lineage, have
conserved genetic sequences, similar biochemical
markers and a shared environmental niche.

IDENTIFICATION OF ORGANISMS

Principles of Identification


KISS



Economically speaking identifications
should be made with the fewest number of
tests to ensure accuracy.


All identifications now are
polyphasic


Most Identifications rely on a mix of
Classical

and
Genetic

technologies

Classical Methodologies


Biochemical Analysis


Fatty Acid Profiles


Growth Substrates


Biochemical Byproducts


Physical Characteristics


Growth Characteristics


Physical Structures


Staining


Serotyping

Genetic Methodologies


RNA


Ribotyping


Reverse Transcriptase


DNA


RFLP Analysis


DNA Sequencing


rDNA

Sequencing


Plasmid Analysis


Dichotomous Keys

Gram Stain

+

-

Cell Morphology

Rod

Coccus

Catalase

+

-

Bacillus

A key is branching
decision pathway that
leads to a decision about
the ID of an organism