'Green' Biotechnology

greasedenmarkBiotechnology

Oct 22, 2013 (3 years and 11 months ago)

321 views

‘Green’ Biotechnology
Andreas Houben
Lecture outline
•Introduction
•DNA, Chromosomes, Genomes
•Plant Transformation
•Modern Plant Breeding
•Plant tissue culture
•Molecular Marker
Words We Hear …
GMO’sCloning
FrankenfoodsAllergens
Biodiversity
DNA Testing
Recombinant DNATransgenics
Herbicide-Resistant Weeds
GreenPeaceAntibiotic Genes
Toxic to Insects Genomics
BioinformaticsStem Cells
ProteomicsNanotechnology
Words We Hear …
GMO’sCloning
FrankenfoodsAllergens
Biodiversity
DNA Testing
Recombinant DNATransgenics
Herbicide-Resistant Weeds
GreenPeaceAntibiotic Genes
Toxic to Insects Genomics
BioinformaticsStem Cells
ProteomicsNanotechnology
Why Public Anxiety with Biotech
Crops?
–Unfamiliar with the Technology
–Lack of Reliable Information
–Unaware of Safeguards
–Negative Media Opinion
–Opposition by Activist Groups
–Mistrust of the Industry
Societal Concern About
Biotech is Understandable!
BECAUSE
Scientific community has
neither addressed public
concerns nor communicated
the value of this technology
effectively!
What Is Biotechnology?
What Is Biotechnology?
Harnessing the natural
biological processes of
living systems for the
benefit of mankind
Biotechnology Industrial Areas
Agriculture
Pharmaceuticals
Health Care
Energy
Environment
Biotechnology Industrial Areas
Agriculture
Pharmaceuticals
Health Care
Energy
Environment
In the World in 2003…
Global biotech crop acreage grew to more than 167 million
acres in 2003 according to the International Service for the
Acquisition of Agri-biotech Applications.
Since 1996, when the first biotech crops were commercially
grown, the global biotech crop area has increased 40-fold to a
total of 7 million farmers in 18 countries.
In the World in 2003…
Global biotech crop acreage grew to more than 167 million
acres in 2003 according to the International Service for the
Acquisition of Agri-biotech Applications.
Since 1996, when the first biotech crops were commercially
grown, the global biotech crop area has increased 40-fold to a
total of 7 million farmers in 18 countries.
In the USA in 2003…
•90% of Soybeans are GMO’s
•80% of Cotton crop are GMO’s
•50% of Corn crop are GMO’s
Chrysanthemum
Grape
Kiwi
Rose
Canola
Alfalfa
Sugar Beet
Tobacco
Mustard
Cotton
Soybean
Tomato
Potato
Maize
Cabbage
Barley
Cucumber
Rice
Strawberry
Petunia
Chicory
Cranberry
Eggplant
Mellon
Flax
Plum Tree
Wheat
Sweet Potato
Carrot
Sugarcane
Sunflower
Asparagus
Pepper
Walnut
Birch
Watermelon
Fescue
Raspberry
Lettuce
Papaya
Serviceberry
Sweetgum
Rapeseed
Fodder Rape
Eucalyptus
Cauliflower
Squash
Oilseed Rape
Peanut
Apple
Poplar
Modified Plants in Field Trials
Modified Plants in Field Trials
•More than 325 million people worldwide have been helped by the more than
155 biotechnology drugs and vaccines approved by the U.S. Food and
Drug Administration (FDA)
. Of the biotech medicines on the market, 70
percent were approved in the last six years.
•There are more than 370 biotech drug products and vaccines currently
in clinical trials targeting more than 200 diseases, including various
cancers, Alzheimer's disease, heart disease, diabetes, multiple
sclerosis, AIDS and arthritis.
Biotechnology Healthcare/Pharmaceuticals Statistics
•More than 325 million people worldwide have been helped by the
more than 155 biotechnology drugsand vaccines approved by the
U.S. Food and Drug Administration (FDA).
•There are more than 370 biotech drug products and vaccines
currently in clinical trialstargeting more than 200 diseases,
including various cancers, Alzheimer's disease, heart disease,
diabetes, multiple sclerosis, AIDS and arthritis.
www.bio.org/er/statistics.asp
Bring a miracle of science to your aquarium, and
own the hottest, most talked about, most beautiful
new fish to come to North America in our lifetime!
GloFish™fluorescent fish bring color and
excitement to any aquarium –in your home, office,
or classroom.
GloFish™fluorescent fish are now available at retail
locations near you with a suggested retail price of
approximately $5.00, however, actual prices may
vary. For more information about these
extraordinary fish, please click on a link at left.
Also, please remember that GloFish™fluorescent
fish are intended for use as aquarium fish only, and
should not be used for any other purpose! For more
information about GloFish™fluorescent fish, please
visit our About GloFish™
page
Welcome to GloFish™Fluorescent Fish Home Page
http://www.glofish.com/
A less seroius appication of Biotechnology
How Old is Biotechnology?
How Old is Biotechnology?
Hand pollination of date,
3000 years ago.
Thousands of years…
-beer 8000 years ago
-bread 5000 years ago
-cheese, soja souce,
sauerkraut, 3000 years ago
-natto?
First production of:
How Old is
Modern Biotechnology?
James D. Watson
Francis H.C. Crick
Herbert W. Boyer
Stanley N. Cohen
1960’s
Described
DNA double-helix
1970’s
Discovered
Gene Splicing and
Gene Cloning
Science Vol. 222, Nov. 1983
Time Magazine, March 1997
1983 SCIENCE Cover –Transgenic Mice
1997 TIME Cover -Dolly
Modern Biotechnology really refers to
Molecular Biology
Molecular Genetics
Bioinformatics
Genetic Engineering
Modern Biotechnology really refers to
Molecular Biology
Molecular Genetics
Bioinformatics
Genetic Engineering
KEY ELEMENT OF
BIOTECHNOLOGY/
GENETIC ENGINEERING
Can Use Recombinant DNA Methods
To Move A Gene From Any Organism
To Any Other Organism
Example...
Transgenenic tomato has an
engineered gene from the flounder
flounder
tomato
Antifreezing gene
Non-transgenic Applications of
Biotech
•Many products on the market have used
non-traditional (not transgenic) methods
–Embryo rescue, protoplast fusion, somaclonal
variation, chromosome doubling, etc.
•Molecular-assisted
breeding/genomics
–Extremely valuable tools
–Will enhance products
even without transgenics
How Big is Biotechnology?
How Big is Biotechnology?
Transgenic Crops in the Market
C. James (2001) Global review of commercialized transgenic crops. 2001. ISAAA Briefs No. 24.
www.isaaa.org
4.3
27.5
69.5
98.6
109.2
130
0
20
40
60
80
100
120
140
19951996199719981999200020012002
Year
Acres (millions)
USA 68%
Argentina 22%
Canada 6%
China 3%
•More than 325 million people worldwide have been helped by the more than
155 biotechnology drugs and vaccines approved by the U.S. Food and
Drug Administration (FDA)
. Of the biotech medicines on the market, 70
percent were approved in the last six years.
•There are more than 370 biotech drug products and vaccines currently
in clinical trials targeting more than 200 diseases, including various
cancers, Alzheimer's disease, heart disease, diabetes, multiple
sclerosis, AIDS and arthritis.
Biotechnology Industry Statistics
•There are 1,457 biotechnology companies
in the United States,of which 342 are
publicly held.
•The U.S. biotechnology industry currently
employs 191,000 people;that's more than all
the people employed by the toy and sporting
goods industries.
www.bio.org/er/statistics.asp
Development of GM foods
Flavr-Savrtomato -1st FDA approval for a food
1995
Monsanto's Roundup Ready soybeans approved for
sale in the United States.
1994
First successful field trial of GM cotton-CROP1990
GM plants resistant to insects, viruses, and bacteria are
field tested for the first time -USEFUL TRAITS
1985
1st transgenic plant: antibiotic resistant tobacco
1983
Researchers develop the ability to isolate genes1973
First regeneration of entire plants from an in vitroculture
1950
Desired gene
Traditional plant breeding
DNA is a strand of genes,
much like a strand of
pearls. Traditional plant
breeding combines many
genes at once.
Traditional donor
Commercial variety
New variety
Desired Gene
X
=
(crosses)
(many genes are transferred)
Plant biotechnology
Using plant biotechnology,
a single gene may be
added to the strand.
Desired gene
Commercial variety
New variety
(transfers)
=
Desired gene
(only desired gene is transferred)
Why is a GMO more dangerous than a
conventionally derived cultivar?
Conventional:
Wide Hybridization introduces 100,000 potentially
negative genes in order to obtain one desirable disease
resistance gene.
Induced mutagenesis has been used for decades to create
genetic variants.
Genetic Engineering:
Introduce one (or a few) foreign “good”genes into the
best accepted cultivar background.
Bt or Disease Resistance genes might enable reduction by
80% of insecticide or fungicide chemical applications.
Conventional:
Wide Hybridization introduces 100,000 potentially
negative genes in order to obtain one desirable disease
resistance gene.
Induced mutagenesis has been used for decades to create
genetic variants.
Genetic Engineering:
Introduce one (or a few) foreign “good”genes into the
best accepted cultivar background.
Bt or Disease Resistance genes might enable reduction by
80% of insecticide or fungicide chemical applications.
Why is a GMO more dangerous than a
conventionally derived cultivar?
Useful single gene traits that
have been introduced into plants
•Herbicide resistance
•Insect resistance
•Virus resistance
•Seed protection
•Fungal resistance
•Delayed ripening
•Cold / Frost resistance
•Drought resistance
•High starch potatoes
•Oil production
•Plastics
•Digestibility proteins
•Antibodies
Other useful traits
•Improved Agronomic
properties
•Improved plant
breeding
•Improved nutritional
properties
•High starch potatoes
•Golden rice (gene
from Chrysanthemum
giving -converted to
vitamin A.
Maize
•Major constraints:
–drought
–stalk borers,
–maize streak virus
–poor soil fertility
–low nitrogen
–storage pests
–Weeds
Biotech Opportunities
Biotech Opportunities


Insect resistance
Insect resistance
-
-
Stemborers
Stemborers


Drought Resistance
Drought Resistance


Virus resistance
Virus resistance


Molecular assisted
Molecular assisted
breeding
breeding
Sorghum
•Major constraints
–Striga
–Drought
–insects --stem borer, shoot
fly, midge
–diseases --charcoal rot,
kernel smut, rusts, ergot
–acid soils


Biotech
Biotech
Opportunities
Opportunities


Herbicide resistance
Herbicide resistance


Insect resistance
Insect resistance


Quality (Output)
Quality (Output)
traits
traits


Finger printing
Finger printing


Marker assisted
Marker assisted
breeding
breeding
Banana
•Major
constraints
–Fusarium wilt
–Viruses -BSV &
BBTV
–nematodes
Biotech Opportunities
Biotech Opportunities


Virus resistance
Virus resistance


Fungal resistance
Fungal resistance


Tissue culture
Tissue culture


Disease free planting
Disease free planting
materials
materials
Wheat
•Major
constraints
–Foliar diseases
–Weeds
–Drought
Biotech Opportunities
Biotech Opportunities


heat and cold tolerance
heat and cold tolerance


salinity / aluminum tolerance
salinity / aluminum tolerance


drought tolerance
drought tolerance


Insect resistance
Insect resistance


Fungal resistance
Fungal resistance
Sweet potato
Major constraints
Feathery mottle virus
Sweet potato weevils
Biotech Opportunities
Biotech Opportunities


Virus resistance
Virus resistance


Enhanced
Enhanced
protein content
protein content


Fungal
Fungal
resistance
resistance


Weevil
Weevil
resistance
resistance
Types of genetic modification
•>99% of all
transgenic crops
are either
herbicide or
insect resistant
•<1% have other
traits
0
5
10
15
20
25
Herbicide
Insect
resistance
Others
Millions of hectares
Herbicide resistant plants
Approved Traits
•Glufosinate
r
herbicide
•Sethoxydim
r
herbicide
•Bromoxynil
r
herbicide
•Glyphosate
r
herbicide
•Sulfonylurea
r
herbicide
•Male-sterility
•Modified fatty acid
•Flower colour
•Flower life
•Delayed fruit ripening
•Virus resistance
•Bt
Approved Transgenic plants
•Soybean
•Corn
•Cotton
•Oil Seed rape
•Sugarbeet
•Squash
•Tomato
•Tobacco
•Potato
•Flax
•Papaya
•Chicory
•Rice
•Melon
Problems and potential
‘Problems’ with GM foods
•Unethical to meddle
with nature
•‘Contamination’ of
non-GM crops
•Lack of public choice
•Allergic reactions
•Generation of ‘Super-
weeds’
•Transfer of antibiotic
resistance genes
•Re-activation of latent
viruses
•Toxins
•Loss of diversity
•Poisoning / reduction
of beneficial insects
Safety of GM Foods…
•Every Product Tested on Case-by-Case
•Over Billion Acres Grown Since 1996
•More than 10,000 Food Products Contain GM
•Not One Single Instance of Hazard
•Dozens of Scientific Societies and International
organizations attest to the safety
BIOLOGICAL BASICS
BIOLOGICAL BASICS
DNA is the genetic material
•Speculated about throughout human
history
•First clear insight came from Watson
and Crick in 1953
•With knowledge comes power
DNA IS
DNA IS
EVERYWHERE
EVERYWHERE


Genes
Genes=the coding system for instructions


A gene
A gene=is a segment of DNA
Guanine
(G)
Cytosine
(C)
Adenine
(A)
Thymine
(T)
bases
DNA
DNA and Genes
DNA and Genes
gene
Genes and Proteins
Genes and Proteins
Gene
(a piece of DNA)
trait
protein
translation
translation
mRNA
transcription
transcription
How many genes are there?
•Humans:
•Yeast:
•Drosophila:
•Arabidopsis:
•Rice:
Approximate number of genes
20,000-25,000
6,000
14,000
27,000
40,000
Genome size:
•Arabidopsis: 115 Mb (5 chromosomes)
•Rice: 430 Mb(12 chromosomes)
•Maize3 000 Mb
•Wheat: 17 000 Mb
(compared to 13 Mb in S. cerevisiae, 100 Mb in C. elegans,
3 000 Mb in humans)
Genomics = analysis of the genome (sequencing projects)
ACCGGTCGTACGTAGGTCAGTCCACTGTGTCATGCATGCTGACCGGTCGTACGTAGGTCAG
TCCACTGTGTCATGCATGCTGACCGGTCGTACGTAGGTCAGTCCACTGTGTCATGCATGCT
GACCGGTCGTACGTAGGTCAGTCCACTGTGTCATGCATGCTGGGGTTTTTACCGGTCGTAC
GTAGGTCAGTCCACTGTGTCATGCATGCTGACCGGTCGTACGTAGGTCAGTCCACTGTGTC
ATGCATGCTGACCGGTCGTACGTAGGTCAGTCCACTGTGTCATGCATGCTGACCGGTCGTA
CGTAGGTCAGTCCACTGTGTCATGCATGCTGACCGGTCGTACGTAGGTCAGTCCACTGTGT
CATGCATGCTGACCGGTCGTACGTAGGTCAGTCCACTGTGTCATGCATGCTGgcctTTGGGT
TTTTACCGGTCGTACGTAGGTCAGTCCACTGTGTCATGCATGCTGACCGGTCGTACGTAGG
TCAGTCCACTGTGTCATGCATGCTGACCGGTCGTACGTAGGTCAGTCCACTGTGTCATGCA
TGCTGACCGGTCGTACGTAGGTCAGTCCACTGTGTCATGCATGCTGACCGGTCGTACGTAG
GTCAGTCCACTGTGTCATGCATGCTGACCGGTCGTACGTAGGTCAGTCCACTGTGTCATGC
ATGCTGgCCGGTTTGGGTTTTTACCGGTCGTACGTAGGTCAGTCCACTGTGTCATGCATGCT
GACCGGTCGTACGTAGGTCAGTCCACTGTGTCATGCATGCTGACCGGTCGTACGTAGGTCA
GTCCACTGTGTCATGCATGCTGACCGGTCGTACGTAGGTCAGTCCACTGTGTCATGCATGC
TGACCGGTCGTACGTAGGTCAGTCCACTGTGTCATGCATGCTGACCGGTCGTACGTAGGTC
AGTCCACTGTGTCATGCATGCTGgcctTTGGGTTTTTACCGGTCGTACGTAGGTCAGTCCACT
GTGTCATGCATGCTGACCGGTCGTACGTAGGTCAGTCCACTGTGTCATGCATGCTGACCGG
TCGTACGTAGGTCAGTCCACTGTGTCATGCATGCTGACCGGTCGTACGTAGGTCAGTCCAC
TGTGTCATGCATGCTGACCGGTCGTACGTAGGTCAGTCCACTGTGTCATGCATGCTGACCG
GTCGTACGTAGGTCAGTCCACTGTGTCATGCATGCTGGGTTGGGTTTTTACCGGTCGTACG
TAGGTCAGTCCACTGTGTCATGCATGCTGACCGGTCGTACGTAGGTCAGTCCACTGTGTCA
TGCATGCTGACCGGTCGTACGTAGGTCAGTCCACTGTGTCATGCATGCTGACCGGTCGTAC
GTAGGTCAGTCCACTGTGTCATGCATGCTGACCGGTCGTACGTAGGTCAGTCCACTGTGTC
ATGCATGCTGACCGGTCGTACGTAGGTCAGTCCACTGTGTCATGCATGCTGgcctTTGGGTTT
TTACCGGTCGTACGTAGGTCAGTCCACTGTGTCATGCATGCTGACCGGTCGTACGTAGGTC
AGTCCACTGTGTCATGCATGCTGCCGGTTGTTGAAAATTGCAAACCGTGTAAAGTCGTAGCT
GATGGGGGGATTCCCCCCCCCCCGTTTATCTGTGTTACACACACACGGGTGTGTCACGATG
yeastTGQGASAVGLTASVRKDPITKEWTLEGGALVLADKGVCLI
wheatTGKGASAVGLTAAVHKDPVTREWTLEGGALVLADRGICLI
flyTGQGASAVGLTAYVRRNPVSREWTLEAGALVLADQGVCLI
frogTGQGASAVGLTAYVQRHPVTKEWTLEAGALVFADRGVCLI
mouseTGQGASAVGLTAYVQRHPVSREWTLEAGALVLADRGVCLI
manTGQGASAVGLTAYVQRHPVSREWTLEAGALVLADRGVCLI
fragment of the MCM2-protein sequence
Many genes are highly conserved
Arabidopsisthaliana
1C = 125 Mbp
Wheat
Triticum aestivum
Genome size: 120x larger
Why Arabidopsis thaliana?

Small diploid genome
•Small size
•Short generation time
•Production of high number of seeds
•Easy to transform
•Large range of mutants available
…but just a weed.
Nature 408, 796 -815 (2000):
Analysis of the genome sequence of the flowering plant
Arabidopsis thaliana
THE ARABIDOPSIS GENOME INITIATIVE
The flowering plant Arabidopsis thalianais an important model system for
identifying genes and determining their functions. Here we report the analysis
of the genomic sequence of Arabidopsis...
What can we learn from genome sequences about
gene function?
About 2/3 of Arabidopsisgenes show homology to genes of
known function.
Arabidopsis could be used to study human diseases
•diploid
•genome size: 430 Mb
•12 chromosomes
•Agrobacterium-mediated
transformation possible
Why rice?
Rice:
•basic food of more than 3 billion
people, accounting for 50-80% of
their calorie intake
•demand in Asia expected to
increase by 25%
•model for other important
cereals
1997/1998:International Rice Genome Sequencing Project
(IRGSP)formed; aim to sequence japonica rice
by 2008 using clone-by-clone shotgunapproach.
The rice sequencing story
Dec. 2002 IRGSPannounces the completion of a high quality
draft sequence of the rice genome; 62,435 genes
predicted.
Apr. 2000: Monsantoannounces draft sequence.
Jan. 2001: Syngentaannounces that it used whole-genome
shotgunapproach to sequence japonicarice.
Oct. 2001:The Beijing Genomics Institute(BGI)completes
sequencing of indicarice using whole-genome
shotgunapproach.
Apr. 2002: Sciencepublishes Syngentaand BGI drafts.
Lecture outline
•Introduction
•DNA, Chromosomes, Genomes
•Plant Transformation
•Modern Plant Breeding
•Plant tissue culture
•Molecular Marker