Genetic Engineering Practice - MrFuscosClass

familiarspottyBiotechnology

Dec 10, 2012 (5 years and 27 days ago)

201 views

Name __________________________ Date ___________ Section ___


Genetic Engineering
Practice

M & A Biotechnology


Aliases!

Use your notes and fill in the proper vocabulary word that serves as an
alternate name for the italicized words.


1.

Genetic engineering
can also be known as ________________________.


2.

Restriction enz
ymes
are also called ________________________.


3.

DNA joining enzymes
are formally called ________________________.


4.

Transgenic organisms
can also be called ________________________.


Restriction Enzyme Practice

1.

The recognition site for EcoRI
(
Escherichia co
li
)
is
between the G and A in the
palindrome GAATTC.
Cut
the following
sequence using EcoRI. Use a
highlighter or colored pencil to distinguish the
fragments
.


CGAATTCATACGAATTCGGCTGTCAGAATTCCGGAC

GCTTAAGTATGCTTAAGCCGACAGTCTTAAGGCCTG


2.

The recognition site
for BAM HI (
Bacillus amyloliquefaciens
) is between the
G and G in the palindrome GGATCC.

Cut
the following sequence using BAM
H
I. Use a highlighter or colored pencil to distinguish the
fragments
.


CGAATGGATCCGAATTCGGCTGTCAGGATC
CCGGAC

GCTTACCTAGGCTTAAGCCGAC
AGTCCTAG
GGCCTG


3.

The recognition site for HIND III (
Haemophilus influenzae
) is between the A
and the A in the palindrome AAGCTT.

Cut
the following sequence using
HIND
I
II
. Use a highlighter or colored pencil to distinguish the
fragments
.


CAAGCTTATCCGAATTCG
GCTGTCAAGCTT
CCGGAC

GTTCGAATAGGCTTAAGCCGACAGTTCGAA
GGCCTG


4.

How are restriction enzymes commonly named?



5.

Use the answer from the above question to propose a name for the first restriction
enzyme isolated from
Serratia marcescens
.


6.

Differentiate between the u
se of restriction enzymes that create sticky ends versus
those that create blunt ends.

Name __________________________ Date ___________ Section ___


Vectors & More

Use your notes to answer the following questions as accurately as
possible.


1.

Define plasmid vector.



2.

Name 6 desirable features of a good plasmid DNA clon
ing vector.

a.


b.


c.


d.


e.


f.


3.

Which of the above features allows for the identification of cells expressing
exogenous DNA?



4.

____________________ is a technique used to allow exogenous DNA to enter a cell.



5.

In order to genetically alter a cell in t
his way, cells must be treated so that they are
receptive to taking up the exogenous DNA. These cells are called
____________________.



6.

Two ways to prepare these cells include:

a.


b.