Bioinformatics Exercises

fabulousgalaxyBiotechnology

Oct 1, 2013 (3 years and 9 months ago)

74 views

Bioinformatics Exercise


You are investigating the metabolism of bupropion (an anxiolytic drug and smoking
cessation aid) by cytochrome P450 isoforms. Interindividual differences in bupropion
metabolism may contribute to either a lack of efficacy or adver
se side effects of this drug
and so you are interested in identifying the pharmacogenetic determinants of bupropion
metabolism by CYP isoforms.


Although current dogma dictates that this drug is metabolized solely by CYP2B6, you
have identified at least on
e individual that is a relatively fast metabolizer of bupropion
and yet has splicing defects in the mRNA of CYP2B6 that would preclude any activity
being contributed by this isoform. Since no other CYP isoforms identified to date appear
to have bupropion
hydroxylation activity, you suspect that a novel CYP isoform, possibly
in the CYP2B subfamily, is contributing to the activity.


1. Find out what is known about
human

CYP2B genes by searching the NCBI databases.


http://www.ncbi.nlm.nih.gov/


http://www.ncbi.nlm.nih.gov/LocusLink/list.cgi?Q=cyp2b&ORG=&V=0


h
ttp://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=123930


http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=&db=OMIM&term=cyp2b


http://www.ncbi.nlm.nih.gov/htbin
-
post/Omim/getmap?l123930


http://www.ncbi.nlm.nih.gov:8
0/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_ui
ds=14550410&dopt=GenBank


http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Re
trieve&db=PubMed&list_uids
=2573390&dopt=Abstract


2. In addition to CYP2B6 (human CHR19q13.2; hIIB1), previous work has identified
CYP2B7P (hIIB3), which appears to be a transcribed pseudogene. There are also splice
variants of CYP2B6 (hIIB2) that resul
t in inactive protein. Southern blotting indicates
that there are at least 4 distinct CYP2B isoforms in humans.


The following is the DNA sequence for the exon 9 region of CYP2B6. Use this sequence
to identify possible novel CYP2B isoforms by performin
g a BLAST search of the
human

EST (expressed sequence tag) database.


CYP2B6 exon 9:

ggaagcggatttgtcttggtgaaggcatcgcccgtgcggaattgttcctcttcttcaccaccatcctccagaacttctccatggcca
gccccgtggccccagaagacatcgatctgacaccccaggagtgtggtgtgggcaaaatacccccaacataccagatccgcttc
c
tgccccgctga




http://www.ncbi.nlm.nih.gov/


http://www.ncbi.nlm.nih.gov/BLAST/



http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_u
ids=03180832&dopt=GenBank

3. You recover the following sequence from the EST database (EST
-
CYP2BX). Use this
sequence to d
etermine whether the full
-
length cDNA has been cloned previously by
BLAST searching the nonredundant (NR) Genbank database.


EST
-
2BX:

cagtttctgagttacaccatccccaagcacacggaagtatttctcatcctgagcactgctctccgtgacccacactactttgaaaaa
ccagacgccttcaatcctgaccactttctggatgc
caatgggccactgaaaaagaatgaagcttttatcccccttctccnttaggga
agcggatttgtcttgctgaagcattgcccgtgcggaattgttcctcttcttcaccaccatcctccagaacttctcccgtggccagccc
cgtggctcctgaagacatcgatctgacaccccaggagtgtggtctgggcaaaatacccccaacataccagatctgcttcctcccc
cgttgaagggcctgagggcagggggtcaaag
gattccaggctcattcagtgtccccacctctgtagataatggcttctgaccccc
cgaaacttcctgcctctgagagacctgctgcaagccagcttccttccctctccatggcaccagttgtctgaggtcgcagtgcaaat
gagtggaggagtgagattattgaaaattataatatacaaaattatatatatatattttgagactgtgtctcaaaaaaaaa



http://www.ncbi.nlm.nih.gov/BLAST/


http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&l
ist_u
ids=00181293&dopt=GenBank


http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_u
ids=14550410&dopt
=GenBank


4. You perform RT
-
PCR (reverse transcription
-
PCR) using primers specific at the 3’
-
end
for EST
-
CYP2BX and conserved at the 5’ end for CYP2B isoforms. An appropriate
sized cDNA is amplified and the following sequence data (CYP2BY) is obtained.

Initial
alignment of CYP2BY with the EST
-
CYP2BX indicates that there are some differences.
Confirm this by researching the EST database using the new sequence (CYP2BY) and
then determine whether it has been previously cloned, by searching the Genbank
da
tabase.


CYP2BY:

ccncaaggacncagaagtatttntcatcctgagcactgctctccatgacccacactactttgaaaaaccagangccttcaatcctg
accactttttggatgccaatggggcactgaaaaagaatgaagcttttatcccctttctccttagggaaacggatttgtcttggtgaag
gcatcgcccgtgcggaattgttcctc



http://www.ncbi.nlm.nih.gov/BLAST/




(BE826685 = BE826702 = BE826696 = CYP2B7P)

(AA994287 = EST


CYP2BX)
5. Using a desktop genetic analysis program you do a virtual translation of CYP2BY and
get the following protein sequence. Look for

conserved domains using the NCBI CD
-
Search utility to substantiate the likely function of the novel cDNA.



CYP2BY translated (frame3):

klkxpagnqxvxwapxwrxxrkxlepqgpqgtsxdtxlxxmxkeemxxxtxesxxrtstxntlxvffwxxvrppapls
grxflvmlkyphvaervyrei*qvxgphrppelhdrakmpy
teaviyeiqrfsdlxpmgvphivtqhtsfrgxiixkdxe
vfxilstalhdphyfekpxafnpdhfldangalkkneafipfllretdlsw*rhrpcgivplfhhhppexfhgqprgprsxxq
gxa*ktematv*aaqatrintal



http://www.ncbi.nlm.nih.gov:80
/entrez/query.fcgi?db=Structure



http://www.ncbi.nlm.nih.gov:80/Structure/cdd/cdd.shtml