Genetic engineering powerpoint

exultantmynabirdBiotechnology

Dec 14, 2012 (5 years and 22 days ago)

207 views

The Good, the bad and the
ugly of Genetic Engineering


Genetic engineering



Scientists change the DNA code
of an organism in order to:


Make transgenic organisms


Clone an organism

Transgenic Organisms


Organisms
which have a
gene from
another
organism in
their DNA

Practical applications


Plants with “insecticide” genes

Practical applications


Cows with
extra copies
of growth
hormones


Practical applications


Bacteria that
make human
insulin
protein for
diabetics


Practical applications?


Cool Glow
-
in
-
the
-
dark Mice!!


How?


Jelly Fish have
a protein called
GFP (Green
fluorescent
protein)


Gives them that
“glow”


How?


So… They
must have a
gene (DNA)
that has the
info to make
GFP


GFP Protein = glowing jelly fish

mRNA transcribed from GFP Gene

GFP Gene (DNA)

Transcription

Translation

How?


What makes us different is
What
genes we have

not how we make
the proteins!!!




So all you need to do is give an
organism a new gene and it will be
able to make the protein!


How?

Jelly fish nucleus with GFP
gene

Remove GFP
gene

Mouse nucleus without
GFP gene

Add GFP
gene

Mouse nucleus
with GFP gene

GFP protein
made

Glowing Mice

Insulin made by bacteria


Diabetes
: dysfunctional Insulin
gene; no or low amounts of insulin
protein made


Means we can’t regulate blood
sugar levels



we can force bacteria to make
insulin for us

Insulin made by bacteria


Same process: Tell me how!

1.
Find healthy insulin gene in
human

2.
Cut it out and insert it in
bacteria

3.
Bacteria then MAKE human
insulin even though they have
no use for it!

4.
We extract the insulin from
bacteria and use it in injections

Cloning


Creating an
organism that
is
genetically

identical to its
only
parent.

Cloning


Mammals usually mix info from
two parents



In cloning all the chromosomes of
the baby come from 1 parent.

Sheep 1

Take 1 body
cell (udder)

Extract
Nucleus

Sheep 2

Take 1 egg
cell

Remove
nucleus

Inject
nucleus
into Egg

Zap to
stimulate
cell
division

Implant
egg into
surrogate
sheep
(sheep 3)

Wait for Dolly to be
born

Which sheep is Dolly identical to??

Why?

Which sheep have to be female?

Snuppy: cloned Afghan Hound

Genetic Testing

Checking a fetus to determine if
the baby has any disease.


-

Cystic fibrosis


-

Tay Sach’s Disease


-

Down Syndrome

Genetic Testing


Done BEFORE birth


Can detect two kinds of mutations


Chromosomal: easily visible, major
mutations


Gene mutations: checking for mutated
gene; must know what you are looking
for!


Amniocentesis

Amniocentesis

Extracting amniotic fluid from
womb


Contains cells from fetus


DNA or protein can be isolated
and examined

Can check for:

1.
Mutations in certain genes
(must be looking for
something specific)

2.
Chromosome abnormalities

3.
Abnormal protein levels

DNA finger printing


Used to compare two people’s
DNA


Used in paternity cases


Used for crime scene analysis

DNA finger printing

DNA finger printing


Based on the idea that
EVERYONE’s DNA is unique, like
a fingerprint



BUT related individuals will have
more similarities

How to do a DNA fingerprint


Get a sample of DNA and digest it
with
restriction enzymes



restriction enzymes cut DNA at
specific sequences.


For example: EcoRI cuts DNA
every time it sees the sequence
GAATTC

How to do a DNA fingerprint


If everyone’s DNA is unique, the
enzyme will cut each persons
DNA differently


Example:


TCAT
GAATTC
ATTGCC
GAATTC
CGTGAATCCA
GAATTC
GGACTA



TCATGAAGTCATTGCC
GAATTC
CGTGAATCCAGACTTCGGACTA


How to do a DNA fingerprint


Run cut up DNA on through
electrophoresis



Click
here
for animation


How to do a DNA fingerprint


Small pieces travel fast and move
further down the gel slab.



Large pieces move slower and
stay closer to the injection point.