GeneticTech.pptx - ScienceWithMrShrout

calendargrumpyBiotechnology

Dec 14, 2012 (4 years and 8 months ago)

245 views

Environmental Influence and
Genetic Technology

Differentiation


All cells (in an organism) have the same
genetic information


Except sex cells


When cells differentiate during development,
some genes are turned off while others are
turned on


This is determined with “master control genes”


Act like conductors, directing the cell to become
specific

Differentiation


This is the process
followed by stem cells


Undifferentiated cells that
can differentiate into any
other cell


This is how stem cell
therapies could heal
disease


Stem cells would treat
damaged tissues by
replacing the damaged cells


Genes & Environment


While some genes
are controlled by
master genes, other
genes are turned off
an on based on the
cells environment


Norm of Reaction


Varied environments
create:


Range
of phenotypes


Within genetic potential


Reaction
with environment

Norm of Reaction

Vestigial wings in
Drosophila

Curve illustrating different wing sizes in fruit flies based in temperature during development.

Environmental Effects on Gene Expression


Himalayan markings: temperature sensitive allele


Fur is usually white


When grown in cold temperatures, fur exhibits black phenotype

Environmental Effects on gene
expression


Some flowers


Sensitive to changes in pH

Ch. 13

Genetic Technology


What You’ll Learn


You will evaluate the importance of plant and
animal breeding to humans

You will summarize the steps used to engineer
transgenic organisms.

You will analyze how mapping the human
genome is benefitting human life.



Section Objectives


Evaluate the importance of plant and animal
breeding to humans.


Explain a testcross.

We have been manipulating DNA for
generations!


Artificial breeding


creating new breeds of animals & new crop
plants to improve our food

Selective Breeding


From ancient times, breeders have chosen plants and animals
with the most desired traits to serve as parents of the next
generation.


Breeders of plants and animals want to be sure that their
populations breed consistently so that each member shows the
desired trait.


selective breeding requires time, patience, and several
generations of offspring before the desired trait becomes
common in a population.


Increasing the frequency of desired alleles in a population is the
essence of genetic technology.



Inbreeding develops pure lines


Inbreeding

is mating between
closely related individuals. It
results in offspring that are
homozygous for most traits.


To make sure that breeds
consistently exhibit a trait and to
eliminate any undesired traits


can bring out harmful, recessive
traits because there is a greater
chance that two closely related
individuals both may carry a
harmful recessive allele for the
trait.



Horses and dogs are two
examples of animals that
breeders have developed as
pure breeds
.

Hybrids are usually bigger and better



hybrid is the offspring
of parents that have
different forms of a
trait.


produced by crossing
two purebred plants
are often larger and
stronger than their
parents
.


Test crosses can determine genotypes



organisms that are either homozygous dominant
or heterozygous for a trait controlled by
Mendelian

inheritance have the same phenotype.


One way to determine the genotype of an
organism is to perform a test cross.


A
test cross

is a cross of an individual of unknown
genotype with an individual of known genotype
.


The pattern of observed phenotypes in the
offspring can help determine the unknown
genotype of the parent.



Section Objectives:


Summarize the steps used to engineer transgenic
organisms.


Give examples of applications and benefits of genetic
engineering.


Genetic Engineering



Genetic engineering

is a faster and more reliable method
for increasing the frequency of a specific allele in a
population


This method involves cutting

or cleaving

DNA from
one organism into small fragments and inserting the
fragments into a host organism of the same or a
different species.


You also may hear genetic engineering referred to as
recombinant
DNA technology


Recombinant DNA

is made by connecting or
recombining, fragments of DNA from different sources.


Can we mix genes from one creature to
another?

YES
!

How is this possible??


Remember: The code is
universal!!


Since
all living organisms…


use the same DNA


use the same code book


read their genes the same
way


Genes can be moved
from one organism to
another.

Mixing genes for medicine…


Allowing organisms to produce new proteins


bacteria producing
human insulin


bacteria producing
human growth hormone

How do we do mix genes?


Genetic engineering


Locate the desired
gene


cut

the DNA
in both organisms


paste

gene from one creature into other creature’s
DNA


insert

new chromosome into organism


organism
copies

new gene as if it were its own


organism
reads

gene as if it were its own


organism produces NEW protein
:

Remember: we all use the same genetic code!

R
ecombinant DNA


Enzymes are used to “cut and paste”


Steps involved:



Isolate a desired gene using


restriction
enzymes
:
are

bacterial proteins that have the
ability to cut both strands of the DNA molecule at a
specific
nucleotide sequence
. (
the scissors doing the
cut)

DNA
ligase


pastes


the DNA fragments
together
(
the glue)


The result is
recombinant DNA



Cutting DNA


DNA “scissors”


enzymes that cut DNA


restriction enzymes


used by bacteria to cut up DNA of

attacking viruses


EcoRI
,
HindIII
,
BamHI


cut DNA at specific sites


enzymes look for specific base sequences

GTAAC
GAATTC
ACGC
TT

CATTG
CTTAAG
TGCG
AA

GTAAC
G
|
AATTC
ACGC
TT

CATTG
CTTAA
|
G
TGCG
AA

Restriction enzymes


Cut DNA at specific sites


leave “sticky ends”

GTAAC
G AATTC
ACGCTT

CATTG
CTTAA G
TGCGAA

GTAAC
GAATTC
ACGC
TT

CATTG
CTTAAG
TGCG
AA

restriction enzyme cut site

restriction enzyme cut site

Sticky ends


Cut other DNA with same enzymes


leave “sticky ends” on both


can glue DNA together at “sticky ends”


GTAAC
G AATTC
ACGCTT

CATTG
CTTAA G
TGCGAA

gene

you want

GGACCT
G AATTC
CGGATA

CCTGGA
CTTAA G
GCCTAT

chromosome

want to add

gene to

GGACCT
G AATTC
ACGCTT

CCTGGA
CTTAA G
TGCGAA

combined

DNA

Sticky ends help glue genes together

TTGTAAC
GAATTC
TACGAATGGTTACATCGCC
GAATTC
A
CGCTT

AACATTG
CTTAAG
ATGCTTACCAATGTAGCGG
CTTAAG
T
GCGAA

gene you want

cut sites

cut sites

AATGGTTACTTGTAAC
G
AATTC
TACGATCGCCGATTCAACGCTT

TTACCAATGAACATTG
CTTAA
G
ATGCTAGCGGCTAAGTTGCGAA

chromosome want to add gene to

cut sites

AATTC
TACGAATGGTTACATCGCC
G


G
ATGCTTACCAATGTAGCGG
CTTAA

isolated gene

sticky ends

chromosome with new gene added

TAAC
GAATTC
TACGAATGGTTACATCGCC
GAATTC
TACG
ATC

CATTG
CTTAAG
ATGCTTACCAATGTAGCGG
CTTAAG
ATG
CTAGC

sticky ends stick together

DNA
ligase

joins the strands

Recombinant

DNA molecule

Why mix genes together?

TAAC
GAATTC
TACGAATGGTTACATCGCC
GAATTC
TACG
ATC

CATTG
CTTAAG
ATGCTTACCAATGTAGCGG
CTTAAG
ATG
CTAGC


Gene produces protein in different
organism or different individual

aa

aa

aa

aa

aa

aa

aa

aa

aa

aa

“new” protein from organism

ex:

human insulin from bacteria

human insulin gene in bacteria

bacteria

human insulin

Uses of genetic engineering


Genetically modified organisms (GMO)


enabling plants to produce new proteins


Protect crops from insects
:
BT corn



corn produces a bacterial toxin that kills corn borer
(caterpillar pest of corn)


Extend growing season
:
fishberries



strawberries with an anti
-
freezing gene from flounder


Improve quality of food
:
golden rice



rice producing vitamin A

improves nutritional value

Vectors transfer DNA



vector

is the means by
which DNA from another
species can be carried into
the host cell.


may be biological or
mechanical.


Biological vectors include
viruses and plasmids.



A
plasmid
, is a small ring of
DNA found in a bacterial cell.


Plasmids

Vectors transfer DNA



Two mechanical vectors carry foreign DNA into a
cell

s nucleus


One,
a micropipette
, is inserted into a cell; the other
is a microscopic metal bullet coated with DNA that is
shot into the cell from a
gene gun.


Bacteria


Bacteria are great!


one
-
celled organisms


reproduce by mitosis


easy to grow, fast to grow


generation every ~20 minutes

There’s more…


Plasmids


small extra circles of DNA


carry extra genes that bacteria can use


can be swapped between bacteria


rapid
evolution =
antibiotic resistance


can be picked up

from environment

How can plasmids help us?


A way to get genes into bacteria easily


insert new gene into plasmid


insert plasmid into bacteria =
vector


bacteria now expresses new gene


bacteria make new protein

+

transformed

bacteria

gene from

other organism

plasmid

cut DNA

recombinant

plasmid

vector

glue DNA

Grow bacteria…make more

grow

bacteria

harvest (purify)

protein

transformed

bacteria

plasmid

gene from

other organism

+

recombinant

plasmid

vector

Gene cloning


Bacteria take the recombinant
plasmids and reproduce


This clones the plasmids and
the genes they carry


Clones

are genetically
identical copies.


Products of the gene can
then be harvested


The process of cloning a
human gene in a bacterial
plasmid can be divided into
six steps.




1.
.
Isolate DNA

from two sources

2
.Cut both

DNAs

with

the same

restriction enzyme



3. Mix the
DNAs
;
they join

by base
-
pairing

4.Add DNA ligase

to bond the DNA
covalently

5.
Put plasmid
into bacterium

6.Clone the
bacterium

Recombinant
DNA

plasmid

Human
cell

Plasmid

Bacterial clones
carrying many

copies of the
human gene

Cloning of animals



You have learned
about
gene cloning


Scientists are
perfecting the
technique for cloning
animals

Applications of biotechnology

Applications of DNA Technology


Recombinant DNA in
industry


Many species of bacteria have been
engineered to produce chemical compounds
used by humans.


Scientists have modified the bacterium
E. coli

to produce the expensive indigo dye that is
used to color denim blue jeans.


The production of cheese, laundry detergents,
pulp and paper production, and sewage
treatment have all been enhanced by the use
of recombinant DNA techniques that increase
enzyme activity, stability, and specificity
.


Production of renewable fuel sources is aided
by bacterial digestion of cellulose materials



Applications of DNA Technology


Recombinant DNA
in medicine


Pharmaceutical companies
already are producing
molecules made by
recombinant DNA to treat
human diseases.


Recombinant bacteria are used
in the production of human
growth hormone and human
insulin



This lab equipment

is used to produce

a vaccine against

hepatitis B


Applications of DNA Technology


Recombinant DNA in
agriculture


Crops have been developed that
are better tasting, stay fresh
longer, and are protected from
disease and insect infestations.



Golden rice” has been genetically
modified to contain beta
-
carotene

Could GM organisms harm human health or the
environment?


Genetic engineering involves
some risks


Possible ecological damage
from pollen transfer between
GM and wild
crops


Weeds could also become more
drought tolerant, or herbicide
resistant


Pollen from a transgenic variety
of corn that contains a pesticide
may stunt or kill monarch
caterpillars


Polymerase chain reaction

(PCR)


method is used to amplify
DNA sequences


The
polymerase chain
reaction

(PCR)

can
quickly clone a small
sample of DNA in a
test tube



Number of DNA molecules

Initial

DNA

segment

The
PCR
method is used to amplify DNA
sequences


The
polymerase chain reaction (PCR)
can quickly clone a small
sample of DNA in a test tube


Advantages of PCR


Can amplify DNA from a small sample


Results are obtained rapidly


Reaction is highly sensitive, copying only the target sequence


Repeated cycle of steps for PCR


Sample is heated to separate DNA strands


Sample is cooled and primer binds to specific target sequence


Target sequence is copied with heat
-
stable DNA polymerase



2006
-
2007

Biotechnology

Gel Electrophoresis

Many uses of restriction enzymes…


Now that we can cut DNA with restriction
enzymes…


we can cut up DNA from different people… or
different organisms…

and
compare it


why?


forensics


medical diagnostics


paternity


evolutionary relationships


and more…

Comparing cut up DNA


How do we compare DNA fragments?


separate fragments by size


How do we separate DNA fragments?


run it through a gelatin


gel electrophoresis


How does a gel work?

Gel Electrophoresis

longer fragments

shorter fragments

power

source

completed gel

gel

DNA &

restriction enzyme

wells

-

+

Gel electrophoresis


A method of separating DNA
in a gelatin
-
like material using
an electrical field


DNA is negatively charged


when it’s in an electrical field it
moves toward the positive side

+



DNA














“swimming through Jello”

Running a gel

1

2

cut DNA with restriction enzymes

fragments of DNA

separate out based

on size

3

Stain DNA


ethidium bromide
binds to DNA


fluoresces under UV
light

Gel
Electrophoresis
-

sorts DNA molecules by size


Separation technique: separates DNA by size and charge


1.Restriction
enzymes


cut
DNA I into fragments


2.
The gel


“Wells”
made at one end
.
Small amounts of DNA are placed in the wells

3.
The electrical field



gel placed in solution and an electrical field set up with one neg. (
-
) & one
pos. (+) end

4.
The fragments move


negatively charged DNA fragments travel
toward
positive end
.
The smaller
fragments move
faster, larger particles move more slowly.



Mixture of DNA

molecules of

different sizes

Gel

Longer

molecules

Shorter

molecules

Power

source

DNA fingerprint


Why is each person’s DNA pattern different?


sections of “junk” DNA


doesn’t code for proteins


made up of repeated patterns


CAT, GCC, and others


each person may have different number of repeats


many sites on our 23 chromosomes with

different repeat patterns

GCTTGTAACGGCCT
CATCATCAT
TCGCCGGCCTACGCTT

CGAACATTGCCGGA
GTAGTAGTA
AGCGGCCGGATGCGAA

GCTTGTAACGG
CATCATCATCATCATCAT
CCGGCCTACGC
TT

CGAACATTGCC
GTAGTAGTAGTAGTAGTA
GGCCGGATGC
GAA

Uses: Forensics


Comparing DNA sample from crime scene
with suspects & victim



+

S1

DNA



S2

S3

V

suspects

crime

scene

sample

Electrophoresis use in forensics


Evidence from murder trial


Do you think suspect is guilty?

“standard”

blood sample 3 from crime scene

“standard”

blood sample 1 from crime scene

blood sample 2 from crime scene

blood sample from victim 2

blood sample from victim 1

blood sample from suspect

OJ Simpson

N Brown

R Goldman

Uses: Paternity


Who’s the father?

+

DNA



child

Mom

F1

F2



Uses: Evolutionary relationships


Comparing DNA samples from different
organisms to measure evolutionary
relationships



+

DNA



1

3

2

4

5

1

2

3

4

5

turtle

snake

rat

squirrel

fruitfly

Uses: Medical diagnostic


Comparing normal allele to disease allele

chromosome with

disease
-
causing

allele 2

chromosome

with normal

allele 1



+

DNA



Example: test for Huntington’s disease

Diagnosis of genetic disorders


The DNA of people with and without a genetic
disorder is compared to find differences that are
associated with the disorder. Once it is clearly
understood where a gene is located and that a
mutation in the gene causes the disorder, a
diagnosis can be made for an individual, even
before birth.


Single nucleotide polymorphism (SNP)
is a
variation at one base pair within a coding or
noncoding sequence


Scientists hypothesize that SNP s may help
identify different types of genetic disorders



Diagnosing Genetic Disorders


Amniocentesis
-

physicians remove a small amount of
amniotic fluid from the placenta. A karyotype can be made
from this fluid to check for possible disorders.



Chorion

villi

sampling
-

physician analyzes a sample of the
chorion villi, which grows between the uterus and the
placenta. The villi will have the same DNA as the baby.


Mapping and Sequencing the Human
Genome
In February of 2001, the HGP published its working
draft of the 3 billion base pairs of DNA in most human cells.



The Human Genome
Project involves:


genetic and physical

mapping of
chromosomes


DNA sequencing


comparison of

human genes

with those of

other species



Sequencing the human genome


The difficult job of sequencing the human genome is
begun by cleaving samples of DNA into fragments
using restriction enzymes.


Then, each individual fragment is cloned and
sequenced. The cloned fragments are aligned in the
proper order by overlapping matching sequences,
thus determining the sequence of a longer fragment.


The Human Genome Project revealed that most of
the human genome does not consist of genes


Results of the Human
Genome Project


Humans have 21,000 genes
in 3.2 billion nucleotide pairs


Only 1.5% of the DNA codes
for proteins,
tRNAs
, or
rRNAs


The remaining 88.5% of the
DNA contains:


Control regions such as promoters
and enhancers


Unique
noncoding

DNA


Repetitive DNA

Applications of the Human Genome
Project


Improved techniques for




prenatal diagnosis of human disorders,



use of gene therapy,



development of new methods of crime detection
are areas currently being researched
.


diagnosis of genetic disorders.



Gene therapy


the insertion of normal
genes into human cells to
correct genetic disorders.


Progress is slow,
however


There are also ethical
questions related to
gene therapy



Proteomics is the scientific study of the full set of
proteins encoded by a genome


Proteomics



Studies the proteome, the complete set of proteins
specified by a genome


Investigates protein functions and interactions


The human proteome may contain 100,000 proteins


Genomics


The study of an organism’s complete set of genes and
their interactions


Copyright © 2009 Pearson Education, Inc.