DNA Technology

calendargrumpyBiotechnology

Dec 14, 2012 (4 years and 6 months ago)

245 views

Transgenic

Organisms

Difficulties with DNA

1.
There are often thousands of genes on a
DNA molecule


Electrophoresis

2.
One cell normally provides too little
material for study


Polymerase Chain Reaction (PCR)


Gene cloning

Restriction Enzymes


Bacterial defense against viral DNA


Excise DNA at specific sequences

CCTTTG AATTCCCAGAATC

GGAAACTTAA GGGTCTTAG


AATTCGGCCATATACG


GCCGGTATATGCTTAA

Desired Gene

Target Sites

for EcoRI

Electrophoresis


Separation of molecules based on size


Negatively charged DNA molecules are pulled
through a gel by an electrical field


Smaller molecules travel faster and farther

Restriction Fragment Length Polymorphisms
(RFLP’s)

AAGAATTCCCTGATCCATATATATATATCGGATCTAGAATTC

TTCTTAAGGGACTAGGTATATATATATAGCCTAGATCTTAAC


AAGAATTCCCTGATCCATATATCGGATCTAGAATTC

TTCTTAAGGGACTAGGTATATAGCCTAGATCTTAAC


Variations in DNA

Variations in
fragment sizes


Variations in
electrophoresis bands


Walter

Jordan

Poop

Restriction Mapping

10 8 6 4 2 (
kilobases
)

Uncut plasmid

Cut with
EcoRI

Cut with BamH3

Cut with Both

DNA Marker

Gene Cloning

Using Radioactive Probes

Each well contains a sample

An impression is made

Radioactive probes applied

Probe is complementary to desired gene

Adhered probe leaves dot on
radiosensitive film

Intron Elimination

Intron

Complementary
DNA (cDNA)


Eukaryotic
mRNA

Polymerase Chain Reaction


In vitro

amplification of a select length of DNA


Denaturation

Priming

Elongation

Desired Gene

Organismal
Cloning

Stem

Cells