Microbial community of tea rhizosphere and isolation of

blanchedworrisomeBiotechnology

Oct 23, 2013 (3 years and 5 months ago)

394 views



M
icrobial community

of tea rhizosphere and isolation of
imidacloprid

degrading bacteria
1

Guiping Hu
a

#
, Yan Zhao

a

#
, Bo Liu
b
,

Fengqing Song
a
,

Yujing Zhu
b
,
Minsheng You
a
*


a
Institute of Applied Ecology, Fujian Agriculture and Forestry University, Fuzhou, Fujian
350002,China

b
Agricultural Bio
-
Resources Institute, Fujian Academy of Agricultural Sciences,
Fuzhou
350003, China


Abstract
:

Microbial community of tea rhizosphere

was analysised by DGGE and
the
imidacloprid
-
degrading
strain

was isolated by
e
nrichment culturing. The results showed that
the
uncultured soil bacteria and bacillus sp were the dominant species

in the tea rhizosphere by
PCR
-
amplified 16S rRNA gene fragmen
ts based on DGGE.

The remaining belonged to the
species of
Sinorhizobium sp
,

Ochrobactrum sp

and
Alcaligenes sp

in the soils. A strain BCL
-
1
with the capacity of imidacloprid
-
degradation was isolated and identified as Ochrobactrum sp
. The
degradation test revealed approximately 33.83% of imidacloprid (100 mg L
-
1
) was degraded
within 48 h of incubaction. Single factor experiment
s

displayed
that
the

maximum degradation
rate was gained in the pH of 8 and at 35
o
C. The effective degradatio
n rate was significant when
the imidacloprid concentration was below 50 mg L
-
1

and it exhibited that the strain BCL
-
1 could
potentially be used to eliminate the contamination of imidacloprid.

Key words
:

DGGE, imidacloprid
-
degrading, microorganism communit
y,

Ochrobactrum sp

tea
rhizosphere


1 Introduction

Tea is a popular beverage consumed worldwide and valued for

its specific aroma and flavour
as well as potential health
-
promoting

properties
.
H
owever,

the events that
exceeding

pesticide
residues were detected in the tea due to
improper
and
excessive

pesticides
usage
,

were
frequently

reported
.
Tea safety problem gets more and more attentions, and

how to deal with

it is a big
concern
.

Imidacloprid is a neonicotinoid insecticide
and common in the
excessive

list, althought
have banned
to apply
in tea production.
D
ue to its long half
-
life, often greater than 100 days
,

t
he
accumulation of
imidacloprid
residues in the
environments

easily
lead to high risk for ecological
and human
health and safety
[1 ]
[3]
[4]
.

Imidacloprid was found to induce DNA damage in a
dose
-
related manner in earthworms as well as to increase the frequency of adducts in
pesticide
-
treated calf thymus DNA, indicating agent
-
induced genotoxicity [
24
] [
25
].




Corresponding author: Min Sheng You, Phone: 086
-
591
-
8379
-
3035; Fax: 086)
-
591
-
8376
-
8251; E
-
mail:
msyou@iae.fjau.edu.cn



However,
Imidacloprid can be biodegraded by the microorganism.
Jennifer et al (2007)
isolated a bacteria of
Leifsonia

sp capable of degrading
imidacloprid
from

agricultural soils
[5]
.
It
was reported that
50 μg/ml of imidacloprid

can be degraded to
69%

within 20 days

by
Burkholderia cepacia

came from
agriculture field soil

[6]
.

But t
he biodegradation e
ffects
depended on not only the microbe degradation capacity but also the compatibility with the
environment

[7]
.

S
o it is very common that the degrading
-
microbes showed the significant effects
in the
laboratory

but poor in the field

[8]
.
T
he degrading
-
microbes

might be

restrained

by the

aboriginal inhabitants

before
developing

into the dominant microbe when inoculated in to the
environments

[9]
,
because of the differen
ces environment between
the origin and applying places
.
Few have considered the environmental compatibility of the degrading
-
microbe, and few studies
about it.

T
he tea
rhizosphere

is

colonized by
a lot of
functional microbes, such as
arbuscular

mycorrhizal fungi (AMF)

[10]
,

plant growth

promoting rhizobacteria (PGPR)
[11]
,
but few

degrading
-
microbe were
reported except
Pseu
domonas sp
.
S
o in the present study, an
attempt

was
made to analysis the microbial
community

of tea rhizosphere by DGGE
, at same time
,

isolate

a
i
midacloprid
-
degrading bacteria

by
enriched culture
, that is helpfully for i
midacloprid

bioremediation in the tea production.

2.

M
aterials and methods

C
hemicals

Imidacloprid

(

N
-
[1
-
[(6
-
Chloro
-
3
-
pyridyl)methyl]
-
4,5
-
dihydroimidazol
-
2
-
yl]nitramide

) (99.9%
purity) was obtained from the Fujian Inspection and Testing Center for Agricultural
Product
Quality and Safety (TCAPQS), Fuzhou, Fujian, China.

A
ll the other chemicals and solvents used
were analytical and HPLC grade.

Soils

Tea rhizosphere
soils were sampled at
oolongs plantation in Anxi County and Gande town,
Fujian province, China.
E
igh
t

samples were collected randomly
and transported to the laboratory
by plastic bag.

DGGE analysis

of microbial community

Nucleic acid extraction

Nucleic acid of soils was extracted parallel to the degradation experiment. Whole
-
community
DNA was extracted from the 0.5 g soil of each treatment with the FastDNA® SPIN Kit for Soil
(Qbiogene, Inc. Carlsbad, CA), the protocol recommended by the manufactu
rer was followed

[12]
.
DNA was finally eluted in 100ul DNase/RNase
-
free water (
Qbiogene, Carlsbad, CA) and stored at
-
80
o
C.

Primer test



DNA was amplified using eubacteria
-
primers for the 16S rRNA gene (
F338GC: 5

-
CGC
CCG CCG CGC GCG GCG GGC GGG GCG GGG GCA CGG GGG GAC TCC TAC GGG AGG
CAG ACG
-
3

;R518: 5

-
ATT ACC GCG GCT GCT GG
-
3

) in
an iCycler iQ(Bio
-
Rad, Hercules,
CA). All reactions were carried out in a final volume of 25ul containing 2.5 ul of buffer (160 mM
(NH
4
)
2
SO
4
, 670 mM Tris
-
HCl pH 8.8, 0.1% Tween
-
20, 25 mM MgCl
2
) (BIORON, Germany), 400
m
M of each primer, 200 uM dNTPs, 0.5 U
of DFS
-
Taq polymerase (BIORON, Germany), and 1
uL of template DNA. For the second PCR, 1 ul of the first PCR product was used as the template,
with the following amplification conditions: 94
o
C for 3 min, 30 cycles of denaturation at 94
o
C
for 1 min, annea
ling for 1 min at 55
o
C for the first PCR and at 48

o
C for the second PCR, primer
extension at 72
o
C for 2 min, with a final extension at 72
o
C for 5 min

[13]

.

DGGE analysis

The DGGE analysis was performed with a DGGE
-
2001system from CBS Scientific (CA,
USA)
[14]
. The PCR products (20
-
30ul) were used in analysis and loaded onto 8% (w/v)
polyacrylamide
-
bisacrylamide (37.5:1) (Amresco
, USA) gels with denaturation gradients from 45%
to 70% where 100% is 7 mol l
-
1

urea and 40% (v/v) deionized formamide in 1×TAE
electrophoresis buffer. Gels (22 cm × 17 cm) were run at 20 V for 15 min, followed by 16 h at 70
V and maintained at a constant
temperature of 60
o
C. Gels were stained for 20 min in

1.0

×

GelStar® and destained for 30 min in distilled water prior to visualization.

E
nrichment
,isolation and screening of imidaclopid
-
degrading strain

5 g of mixed soils were
transferred into 250 ml
Erlenmeyer

flask containing 50 ml sterilized
minimal salts medium (MSM)

to create enrichment cultures for isolation of imidacloprid

-

degrading microorganism.

I
midacloprid dissolved in acetone solution was added to a final
concentration of 100 mg L
-
1
.
T
he
enrichment culture was incubated at 30
o
C on a rotary shaker at
170 rpm for 7 days.
F
ive ml from the enrichment culture was
transferred

into 50 ml of fresh enrich
ment medium containing 100 mg L
-
1 of imidaclopid and incubated for 7 days, and
three
addition
al successive transfers were made.
T
he final cultures were serially diluted and plated on
MSM plates.
T
he plates were incubated at 30
o
C for 2 days, the colonies were picked and
purified
[15]
T
he ability of isolates to degrade imidaclopid was determined by high performance
liquid chromatography (HPLC) of extracts as described by
Blasco et al (2002)

[16]

C
haracterization and identification of isolated imidaclopid degrad
ers

Isolate
was characterized and identified by morphological methods, FAME analysis and 16S
rRNA gene analysis.
T
he 16S
rRNA gene was amplified by PCR with
intF(AGAGTTTGATCCTGGCTCAG) and intR (
GGCTACCTTGTTACGACT) as universal
primers. PCR products were cl
oned into a
pMD 18
-
T vector(TaKaRa)
,
T
hen transformed the
plasmid to E.coli DH5a, screened positive clone and sent to
Invitrogen

Biotechnology Co.,Ltd.,


for sequencing.
The resulting sequence was compared with gene sequences in the GenBank using
BLAST (htt
p://www.ncbi.nlm.nih.gov/BLAST). The sequences with the highest 16S rDNA partial
sequence similarity were selected and compared by cluster analysis. Phylogenetic and molecular
evolutionary analyses were conducted by MEGA 4.0 software with the Kimura 2
-
pare
meter model
and the neighbor joining algorithm

[17]

.

D
egradation characterization of
imidacloprid
-
degrading bacteria

T
he effects of
temperature

(20, 25, 30, 35 and 40
o
C), medium
pH (
5, 6, 7, 8 and 9
)

and the
initial imidacloprid concentration (50, 100, 150 and 200 mg L
-
1
)

on the imidacloprid degradation
were examined.
T
o each 250
mL

flask.

100 mL MSM medium was added and inoculated with 1.0%
(v/v) of strain BCL
-
1.
A
ll the flasks in triplicate were incubated at 30
o
C and 170 r min
-
1

on a
rotary shaker .all the experiment was determined at 24, 48, and 96 h, with the medium without the
strain BCL
-
1 inoculation used as the control.

3.

R
esults

3.1 The microorganism
comunity

of tea rhizosphere

T
he microorganism community
structure of tea rhizosphere were investigated by

using
PCR
-
DGGE, and t
he results
are
showed in Fig
.1
.

Total seventeen
dominant
bands were observed
from the DGGE gels using Quantity one V4 4.0.0 software
,
then
excised
and PCR
-
amplified
for
DNA sequencing.
T
he closest relatives matched in the GenBank database
are shown in Table
1
.

M
ost of the sequences exhibited levels of similarity greater than 90%.

A phylogenetic
tree was constructed to show the relationship of main the partial 16S rDNA
sequences represent
ing the respective excised DGGE bands.
T
he neighbor
-
joining analysis
showed that most of bacterial sequences
belonged to uncultured bacterium

(7 sequences, 41.2%)
,
three
sequence
s were identified as
Rhizobium

sp, one
was

clarified to
Ochrobactrum sp
,
the
remaining

were the members of bacillus sp
(6 sequences, 35.3%)

(Fig
.2.
)
.


Table
1

Sequence alignment with blast

Band

Similarity

organism

Phylogenetic affiliation

Accession
number

A

100%

Uncultured bacterium clone G16 16S ribosomal RNA gene

uncultured
bacterium

HQ121331.1

B

100%

Uncultured soil bacterium clone em_emp208 16S ribosomal
RNA gene

uncultured soil
bacterium

JN172788.1

C

100%

Uncultured soil bacterium clone em_emp210 16S ribosomal
RNA gene

uncultured soil
bacterium

JN172809.1

D

100%

Uncultured proteobacterium clone Hmd02B56 16S ribosomal

uncultured
proteobacterium

EF196941.1

E

100%

Uncultured bacterium clone LG70 16S ribosomal RNA gene

uncultured bacterium

JX133525.1

F

100%

Rhizobium sp. PA22 16S ribosomal RNA gene

Rhizobium

JN819573.1



G

100%

Sinorhizobium meliloti strain UT10 16S ribosomal RNA gene

Sinorhizobium
meliloti

JX133181.1

H

100%

Ensifer adhaerens strain MM1
-
6 16S ribosomal RNA gene

Sinorhizobium
morelense

JX298811.1

I

100%

Uncultured bacterium partial 16S rRNA

gene, clone SBD94

uncultured bacterium

HE819608.1

J

100%

Uncultured alpha proteobacterium clone YZ52 16S ribosomal
RNA gene, partial sequence

uncultured alpha
proteobacterium

JQ957842.1

K

100%

Ochrobactrum

sp. DZQ2a 16S ribosomal RNA gene, partial
sequence

Ochrobactrum sp

KC252620.1

L

99%

Bacillus megaterium strain RHQ17 16S ribosomal RNA gene,
partial sequence

Bacillus megaterium

HQ202555.1

M

99%

Bacillus aryabhattai strain L13 16S ribosomal RNA gene

Bacillus aryabhattai

JN700141.1

N

99%

Alcaligenes faecalis strain M14 16S ribosomal RNA gene

Alcaligenes faecalis

JX849036.1

O

99%

Bacillus sp. JU2(2010) 16S ribosomal RNA gene, partial
sequence

Bacillus sp

GU566326.1

P

100%

Geobacillus
stearothermophilus strain HWB2 16S ribosomal
RNA gene, partial sequence

Geobacillus
stearothermophilus

FJ581462.1

Q

99%

Bacillus flexus strain JMC
-
UBL 24 16S ribosomal RNA gene,
partial sequence

Bacillus flexus

HM451429.1







Fig .1 DGGE of tea
rhizosphere soils

Fig.2.
Phylogenetic analysis of the bacterial 16S rRNA gene sequences


3.2 Isolation and characteri
zation of the
imidacloprid
-
degrading bacteria

Strain BCL
-
1 could
grow on the MSM
in the presense of

imidacloprid
at the
concentration of
200

mg

L
-
1
, and the degradation test displayed that it could

degrade
33.83% of
100 mg l
-
1

of
imidacloprid within
48 h

(Fig.5)
.

T
he
strain

BCL
-
1 was
a

rod shaped

with 2.48 um in length and
1.34 um in width

(Fig.3.)
, aerobic.
T
he colony of strain BCL
-
1 was y
ellow and creamy white
color on the MSM plate

(Fig.4)
.

I
t was positive in tests such as starch hydrolysis, nitrate reduction,
hydrogen sulfide production and utilized simmons citrate, lactose, glucose, maltose, amylum,
D
-
galactose, D
-
fructose, D
-
xylose.
I
t was negative in gram staining, Voges
-
Proskauer (V
-
P),
indole reaction, gelatin liquefaction and mannose.





F
ig.3.
Colonial morphology

of strain BCL
-
1 grown on the MSM

Fig.4. The
scanning electron microscope

of strain BCL
-
1


3.3
Identification of imid
acloprid
-
degrading bacteria

A
nalysis of the partial 16S rRNA sequence of the strain BCL
-
1 showed that it was closely
related to
Ochrobactrum
anthropic

with
access
ion number

of
EU187487.1
.

PCR amplificat ion of 16
S rRNA obtained a single fragment of 1337 bp.
The strain’s genome has a G
+
C content of 59%.

In
combination with the morphology, physio
-
biochemical characteristics and 16S rDNA gene
analysis, BCL
-
1 was tentatively identified as
Oc
hrobactrum
anthropic
.

3.4
Degradation

characteristics

of imidacloprid
-
degrading bacteria


The imidacloprid degradation
rate

of Ochrobactrum sp.
S
train BCL
-
1 increased to 29.3% at
pH 9.0 and reached the highest value at pH 8 (Fig.
6
). Under the pH of 80, the degradation
efficiency increased from 13.77% in 24 h to 33.7% in 72
h. imidacloprid hydrolyzed easily in
alkaline solution at pH 7.0
-
10.0.

I
ncubation
temperature

greatly influenced the degradation of imidacloprid by strain
BCL
-
1(Fig.
7
). Maximum degradation rate of 35.4% was observed at 35
o
C in 72 h, but it decreased
marke
dly as the
temperature

increased above or dropped below 35
o
C in 72 h. At 20
o
C,
degradation rate was only 9.8%, 35
o
C was chosen as the optimal
temperature

for degradation of
imidacloprid.



Fig
.5
. Degradation test of imidacloprid by strain BCL
-
1





Fig
.6.

Effect of pH on the imidacloprid degradation rate of strain
BCL
-
1

Fig
.7.

Effect of
temperature

on the imidacloprid degradation rate
of strain BCL
-
1



The effect of imidacloprid concentration on the
degradation

rate by BCL
-
1 was tested.
E
ffective degradation rates appeared hampered as the imidacloprid concentration increased. Fig
.8.

showed that the degradation rate of imidacloprid reached to 63.23% at the concentration of 50 mg
L
-
1

within 96 h.

The degradation rates of imidacloprid was obs
erved no significant with 96 h if the
initial
concentration

was up 50 mg L
-
1


Fig
.8.

The
degradation

of imidacloprid by BCL
-
1 at different initial imidacloprid concentration.




4.
D
iscussion

The tea rhizosphere

consists of a diverse community of microbes with the genotypic and
functional diversity

[26] . Bacteria isolated from various tea plantations were classified into 20
genera, such as
Bacillus, Pseudomonas, Azomonas, Klebsiella, Agrobacterium, Erwinia, Micr

ococcus, Azotobacter, Stophylococcus Rosenback, Beijerinckia, Derxia, Arthrobacter

[27]
.Pandey,
et al (2001) found that species of
Penicillium

and
Trichoderma

dominated the rhizosphere of
established tea bushes[2
8
] . It also reported arbuscular mycorrhiza
l fungi (AMF) associated with
the rhizosphere during the periods of active growth and dormancy of tea[2
9
] . Many tea plants
were raised by biological hardening of tissue culture through rhizosphere bacteria[
30
] . The
microorganism isolated from the tea rhi
zosphere mainly showed the Physiological and biological
function, such as Antifungal activity

[3
1
, 3
2
], phosphate
-
solubilizing [3
3
], Plant growth promotion
and induction of resistance[ 3
4
, 3
5
] and contaminate biodegradation[3
6
,3
7
].

However, the tea rhizos
phere bacterias with the biodegradation capacity were mainly
belonged to Pseudomonas sp that could able to degrade
d
icofol and propargite. No another
microorganisms were found to degrade contaminants. In the present studies, strain BCL
-
1
identified as
Ochr
obactrum sp
, isolated from tea rhizospherer, was showed that could degrade the


imidacloprid effectively. Degradation test it could degrade
33.83
% of imidacloprid in
48h
.
Ochrobactrum sp was testified to a potential bioaugmention. Zhang et al (2006) isolate
d strain
DDV
-
1 of Ochrobactrum sp from the active sluge with degrading
-
dichlorvos completely [3
8
]. He
et al (2009) found a strain of Ochrobactrum sp from chromium landfill could reduce a chromium

[
39
]. Strain B2,

Ochrobactrum sp
, nitrophenol and methy para
thion
-
degrading and strain DGVK1,
complete dimethylformamide mineralization were isolated from the coalmine leftovers [
40
,4
1
].
Besides, species of
Ochrobactrum sp

was reported to degrade pyrene, phenol, 2, 4,
6
-
tribromophenol [4
2
-
4
4
].Many relevance degrada
tion genes from the Ochrobactrum sp were
cloned, such as mpd gene

[4
5
], methyl parathion hydrolase gene[4
6
], Nitrite reductase genes[4
7
],
N
-
acylhomoserine lactonase [4
8
].

So the species of
Ochrobacterum sp has a
imidacloprid
-
degrading potential
in the
future.

Soil
bioremediation is a complex process that relies upon the ability of microorganisms to
degrade pollutes, but it also depended on the microorganisms coming into contact with the native
microorganism community in the environment being conducive t
o the survival of the bacteria.

Microbes better adapted to a particular environment should be considered as a key strategy for
bioremediation.

Sarkar et al (2010) also isolated a strain Pseudomonas putida,

able to degrade
propargite, from tea rhizosphere.
So the attentions that a strain with the native ecological niche
could easily and effectively play a ro
le in the bioremediation, should be taken in the
bioaugmentation. It is a good strategy to deal with
compatibility

b
etween the degrading
-
bacteria
with the environment.



References:


[1] R. Saikia, R.K. Sarma, A. Yadav, and T.C. Bora, Genetic and functional diversity among the
antagonistic potential fluorescent pseudomonads isolated from tea rhizosphere.
Current microbiology
62 (2011) 434
-
444.


[2] U. Chakraborty, B. Chakraborty, and M. Basnet, Plant growth promotion and induction of
resistance in Camellia sinensis by Bacillus megaterium. Journal of basic microbiology 46 (2006)
186
-
195.


[3] R. Nauen, N. S
tumpf, and A. Elbert, Toxicological and mechanistic studies on neonicotinoid cross
resistance in Q

type Bemisia tabaci (Hemiptera: Aleyrodidae). Pest Management Science 58 (2002)
868
-
875.


[4] M.A. Beketov, and M. Liess, Acute and delayed effects of the ne
onicotinoid insecticide
thiacloprid on seven freshwater arthropods. Environmental Toxicology and Chemistry 27 (2008)
461
-
470.


[5] J.C. Anhalt, T.B. Moorman, and W.C. Koskinen, Biodegradation of imidacloprid by an isolated
soil microorganism. Journal of En
vironmental Science and Health Part B 42 (2007) 509
-
514.


[6] M. Gopal, D. Dutta, S.K. Jha, S. Kalra, S. Bandyopadhyay, and S.K. Das, Biodegradation of
Imidacloprid and Metribuzin by Burkholderia cepacia strain CH9. Pesticide Research Journal 23 (2011)


36
-
40.


[7]
许育新
,
李晓慧
,
滕齐辉
,
陈义
,
吴春艳
, and
李顺鹏
,
氯氰菊酯污染土壤的微生物修复及对
土著微生物的影响
.
土壤学报

45 (2008) 693
-
698.


[8] N. Boon, E.M. Top, W. Verstraete, and S.D. Siciliano, Bioaugmentation as a tool to protect the
structure and function of an activated
-
sludge microbial communit
y against a 3
-
chloroaniline shock load.
Applied and Environmental Microbiology 69 (2003) 1511
-
1520.


[9]
吴学玲
,
代沁芸
,
梁任星
, and
王洋洋
,
利用高效降解菌株强化修复土壤中

DBP
及其细菌
群落动态解析
.
中南大学学报

(
自然科学版
) 42 (2011).

[10] S. Singh, A. Pandey, B. Chaurasia, and L.M.S. Palni, Diversity o
f arbuscular mycorrhizal fungi
associated with the rhizosphere of tea growing in

natural

and

cultivated

ecosites. Biology and
Fertility of Soils 44 (2008) 491
-
500.

[11]
张建云
,
崔树军
,
武秀琴
, and
宋海军
, 1
株氟氯氰菊酯降解菌

GZ
-
3
的分离和鉴定
.
安徽农
业科学

(2010) 6635
-
6636.

[12
] J. Bælum, T. Henriksen, H.C.B. Hansen, and C.S. Jacobsen, Degradation of
4
-
chloro
-
2
-
methylphenoxyacetic acid in top
-
and subsoil is quantitatively linked to the class III tfdA
gene. Applied and environmental microbiology 72 (2006) 1476
-
1486.

[13] P. Loren
zo, S. Rodríguez
-
Echeverría, L. González, and H. Freitas, Effect of invasive< i> Acacia
dealbata Link on soil microorganisms as determined by PCR
-
DGGE. Applied Soil Ecology 44 (2010)
245
-
251.

[14] J. Zhan, and Q. Sun, Diversity of free
-
living nitrogen
-
fixi
ng microorganisms in the rhizosphere
and non
-
rhizosphere of pioneer plants growing on wastelands of copper mine tailings. Microbiological
research 167 (2012) 157
-
165.

[15] S. Chen, Q. Hu, M. Hu, J. Luo, Q. Weng, and K. Lai, Isolation and characterization o
f a fungus
able to degrade pyrethroids and 3
-
phenoxybenzaldehyde. Bioresource technology 102 (2011)
8110
-
8116.

[16] C. Blasco, M. Fernández, Y. Picó, G. Font, and J. Mañes, Simultaneous determination of
imidacloprid, carbendazim, methiocarb and hexythiazox

in peaches and nectarines by liquid
chromatography

mass spectrometry. Analytica Chimica Acta 461 (2002) 109
-
116.

[17] C. Zhang, L. Jia, S. Wang, J. Qu, K. Li, L. Xu, Y. Shi, and Y. Yan, Biodegradation of
beta
-
cypermethrin by two< i> Serratia spp. with dif
ferent cell surface hydrophobicity

[24] Y. Zang, Y. Zhong, Y. Luo, Z.M. Kong Genotoxicity of two novel pesticides for the earthworm,
Eisenia fetida Environ. Pollut., 108 (2000), pp. 271

278

[25] R.G. Shah, J. Lagueux, S. Kapur, P. Levallois, P. Ayotte,

M. Tremblay, J. Zee, G.G. Poirier

Determination of genotoxicity of the metabolites of the pesticides guthion, sencor, lorox, eglone,
daconil and admire by 32P
-
postlabeling

Mol. Cell. Biochem., 169 (1997), pp. 177

184

[26] R. Saikia, R.K. Sarma, A. Yadav,
and T.C. Bora, Genetic and functional diversity among the
antagonistic potential fluorescent pseudomonads isolated from tea rhizosphere. Current microbiology
62 (2011) 434
-
444.

[27] H. Sun, and X. Liu, Microbes studies of tea rhizosphere. Acta Ecologica Si
nica 24 (2004) 1353.



[28] A. Pandey, L.M.S. Palni, and D. Bisht, Dominant fungi in the rhizosphere of established tea
bushes and their interaction with the dominant bacteria under< i> in situ conditions. Microbiological
research 156 (2001) 377
-
382.

[29] S.

Singh, A. Pandey, B. Chaurasia, and L.M.S. Palni, Diversity of arbuscular mycorrhizal fungi
associated with the rhizosphere of tea growing in ‘natural’and ‘cultivated’ecosites. Biology and
Fertility of Soils 44 (2008) 491
-
500.

[30] A. Pandey, L.M.S. Palni
, and N. Bag, Biological hardening of tissue culture raised tea plants
through rhizosphere bacteria. Biotechnology letters 22 (2000) 1087
-
1091.

[31] A. Pandey, L. Palni, and N. Coulomb, Antifungal activity of bacteria isolated from the rhizosphere
of estab
lished tea bushes. Microbiological research 152 (1997) 105
-
112.

[32] A. Sood, S. Sharma, V. Kumar, and R.L. Thakur, Established and abandoned tea (Camillia sinensis
L.) rhizosphere: dominant bacteria and their antagonism. Polish Journal of Microbiology 57
(2008) 71.

[33] U. Chakraborty, B. Chakraborty, and M. Basnet, Plant growth promotion and induction of
resistance in Camellia sinensis by Bacillus megaterium. Journal of basic microbiology 46 (2006)
186
-
195.

[34] S. Singh, A. Pandey, and L.M.S. Palni, Scre
ening of arbuscular mycorrhizal fungal consortia
developed from the rhizospheres of natural and cultivated tea plants for growth promotion in tea [< i>
Camellia sinensis(L.) O. Kuntze]

[35] S. Sarkar, S. Seenivasan, and R.P.S. Asir, Biodegradation of propa
rgite by< i> Pseudomonas
putida, isolated from tea rhizosphere. Journal of hazardous materials 174 (2010) 295
-
298.

[36] S. Sarkar, A. Satheshkumar, and R. Premkumar, Biodegradation of Dicofol by Pseudomonas
strains isolated from tea rhizosphere microflora.

International Journal of Integrative Biology 5 (2009)
164.

[37] P. Vyas, P. Rahi, A. Chauhan, and A. Gulati, Phosphate solubilization potential and stress tolerance
of< i> Eupenicillium parvum from tea soil

[38] X.H. Zhang, G.S. Zhang, Z.H. Zhang, J.H. Xu
, and S.P. Li, Isolation and Characterization of a
Dichlorvos
-
Degrading Strain DDV
-
1 of< i> Ochrobactrum sp.

[39] Z. He, F. Gao, T. Sha, Y. Hu, and C. He, Isolation and characterization of a Cr (VI)
-
reduction< i>
Ochrobactrum sp. strain CSCr
-
3 from chromiu
m landfill. Journal of hazardous materials 163 (2009)
869
-
873

[40] Y. Veeranagouda, P.V. Emmanuel Paul, P. Gorla, D. Siddavattam, and T.B. Karegoudar, Complete
mineralisation of dimethylformamide by Ochrobactrum sp. DGVK1 isolated from the soil samples
col
lected from the coalmine leftovers. Applied microbiology and biotechnology 71 (2006) 369
-
375.

[41] X. Qiu, Q. Zhong, M. Li, W. Bai, and B. Li, Biodegradation of< i> p
-
nitrophenol by methyl
parathion
-
degrading< i> Ochrobactrum sp. B2



[42] Y. Wu, T. He, M.
Zhong, Y. Zhang, E. Li, T. Huang, and Z. Hu, Isolation of marine benzo [a]
pyrene
-
degrading< i> Ochrobactrum sp. BAP5 and proteins characterization. Journal of Environmental
Sciences 21 (2009) 1446
-
1451.

[43] W.S. El
-
Sayed, M.K. Ibrahim, M. Abu
-
Shady, F. E
l
-
Beih, N. Ohmura, H. Saiki, and A. Ando,
Isolation and identification of a novel strain of the genus< i> Ochrobactrum with phenol
-
degrading
activity

[44] T. Yamada, Y. Takahama, and Y. Yamada, Biodegradation of 2, 4, 6
-
tribromophenol by
Ochrobactrum sp. s
train TB01. Bioscience, biotechnology, and biochemistry 72 (2008) 1264
-
1271

[45] C. Yang, N. Liu, X. Guo, and C. Qiao, Cloning of mpd gene from a chlorpyrifos

degrading
bacterium and use of this strain in bioremediation of contaminated soil. FEMS microbiol
ogy letters 265
(2006) 118
-
125.

[46] W. Xiao, X. Chu, J. Tian, J. Guo, and N. Wu, Cloning of a methyl parathion hydrolase gene from
Ochrobactrum sp. J Agric Sci Technol 10 (2008) 99
-
102.

[47] B. Song, and B.B. Ward, Nitrite reductase genes in halobenzoate
degrading denitrifying bacteria.
FEMS microbiology ecology 43 (2006) 349
-
357.

[48] G.Y. Mei, X.X. Yan, A. Turak, Z.Q. Luo, and L.Q. Zhang, AidH, an alpha/beta
-
hydrolase fold
family member from an Ochrobactrum sp. strain, is a novel N
-
acylhomoserine lactona
se. Applied and
environmental microbiology 76 (2010) 4933
-
4942.