Slide 1

abalonestrawBiotechnology

Oct 2, 2013 (3 years and 8 months ago)

76 views

Introduction to Bioinformatics

Fall 2009
-
2010

1: Introduction

Teachers:

Dr. Tal Pupko




talp@post.tau.ac.il

Dr. Eran Halperin


heran@post.tau.ac.il

Dr. Iftach Nachman


iftachn@tauex.tau.ac.il




Reception hours:

Please set a meeting by email.

1: Introduction

Administration

Course Website

1
: Introduction

http://bioinfo.tau.ac.il/~intro_bioinfo/

WHAT ARE THE QUESTIONS IN
THE EXAMS?

Requirements

1: Introduction

Final exam


100
%

Exercise course


Each student participates once in
2
weeks:


Sunday
16
:
00
-
18
:
00


Monday
12
:
00
-
14
:
00


Monday
14
:
00
-
16
:
00


Computer classroom Sherman
03

1
: Introduction

TAs:

Nimrod Rubinstein


rubi@post.tau.ac.il

Osnat Penn



penn@post.tau.ac.il

Daiana Alaluf



dalaluf
83
@gmail.com

"
הקיטמרופניאויבב םילכ
"

Goals


To familiarize the students with research
topics in bioinformatics, and with
bioinformatic tools

Prerequisites


Familiarity with topics in molecular biology
(cell biology and genetics)


Basic familiarity with computers & internet

1
: Introduction

Ask, Ask, Ask!!

"
דמל ןשייבה ןיא
"

1
: Introduction

What is Bioinformatics


“The analysis of biological information
using computers and statistical
techniques.


The science of developing and utilizing
computer databases and algorithms to
accelerate and enhance biological
research “

www.niehs.nih.gov/dert/trc/glossary.htm


1
: Introduction

Gregor Mendel

laws of inheritance,“gene”

1866

Watson and Crick



DNA Discovery


1953

Genome
Project


2003

1
: Introduction

Genome
Project


2003

1
: Introduction

1
: Introduction

(Slide from Prof. Ron Shamir)

Bioinformatics


Organize, store,
analyze
, visualize genomic data


Utilizes methods from Computer Science,
Mathematics, Statistics and Biology

The marriage of Computer Science and Biology

1
: Introduction

(Slide from Prof. Ron Shamir)


At the convergence of two revolutions: the ultra
-
fast growth of biological data, and the information
revolution

Biology is becoming an information science

22
Aug
2005
:

100
,
000
,
000
,
000
bases

1
: Introduction

Bioinformatics

(Slide from Prof. Ron Shamir)

Bioinformatics


a short CV


Born ~
1990


Grown rapidly.


Experience: essential part of modern life
science and medicine


Now a separate multidisciplinary scientific
area


Is one of the cornerstones of
21
st

Century
medical and biological research

1
: Introduction

(Slide from Prof. Ron Shamir)

1
: Introduction


Academic research: where it all started


Biotechnology companies


Big Pharmas and big AgBio


National and international centers

The Bioinformatics Actors

Find me gene (gin?)

Bioinformatics in Israel


World class player in
research


Ranked
2
-
3
in
absolute

number of papers in the
most prestigious and
competitive conferences


Maintaining our
competitive global
position is nontrivial

1
: Introduction

(Slide from Prof. Ron Shamir)

Bioinformatics in TAU


TAU is the Israeli leader in the field…

1
: Introduction

(Slide from Prof. Ron Shamir)

What do bioinformaticians study?



Bioinformatics today is part of almost
every molecular biological research.


Just a few examples…


1
: Introduction

Example
1


Compare proteins with similar sequences (for
instance

kinases) and understand what the
similarities and differences mean.


1
: Introduction

Example
2


Look at the genome and predict where
genes are (promoters; transcription
binding sites; introns; exons)

1
: Introduction


Predict the
3
-
dimensional structure of a
protein from its primary sequence

Example
3

Ab
-
initio
prediction


extremely
difficult!

1
: Introduction


Correlate between gene expression and
disease

Example
4

A gene chip


quantifying gene
expression in different tissues
under different conditions


May be used for personalized
medicine

1
: Introduction

1
: Introduction

Computational biology


revolutionizing science at the
turn of the century.

Three studies using bioinformatics
which impacted science

1.
Classifying life into domains

2.
Predicting drug resistance in HIV and
personalizing drug administration

3.
Solving the mystery of anthrax
molecular biology

1
: Introduction

Revolutionizing the Classification of Life

1
: Introduction


Life was classified as


plants and animals


When Bacteria were discovered

they were initially classified as plants.


Ernst Haeckel (
1866
) placed all unicellular
organisms in a kingdom called
Protista
,
separated from Plantae and Animalia.

In the very beginning

1
: Introduction

1
: Introduction

Thus, life were classified to
5
kingdoms
:

When electron microscopes were developed, it was
found that Protista in fact include both cells with and
without nucleus. Also, fungi were found to differ from
plants, since they are heterotrophs (they do not
synthesize their food).

LIFE

Fungi

Plants

Animals

Protists

Procaryotes

1
: Introduction

Later, plants, animals, protists and fungi were
collectively called the Eucarya
domain,
and the
procaryotes were shifted from a kingdom to be a
Bacteria domain.

Domains

Eucarya

Bacteria

Fungi

Plants

Animals

Protists

Kingdoms

Even later, a new Domain was discovered


1
: Introduction


The translation apparatus is universal and
probably already existed in the

beginning

.

rRNA was sequenced from a great
number of organisms to study phylogeny

1
: Introduction

Carl R. Woese and rRNA phylogeny

1
: Introduction

A distance matrix was computed for each two
organisms. In a very influential paper, they showed
that methanogenic bacteria are as distant from
bacteria as they are from eucaryota (
1977
).

1
: Introduction

One sentence about methanogenic

bacteria



There exists a third kingdom which, to date, is
represented solely by the methanogenic bacteria,
a relatively unknown class of anaerobes that
possess a unique metabolism based on the
reduction of carbon dioxide to methane

.


These "bacteria" appear to be no more related to
typical bacteria than they are to eucaryotic
cytoplasms.


1
: Introduction

From sequence analysis only, it was thus
established that life is divided into
3
:

Bacteria

Archaea

Eucarya

1
: Introduction

1
: Introduction

The rRNA phylogenetic tree

Revolutionizing HIV treatment

1
: Introduction

There are very efficient drugs for HIV

1
: Introduction

A few viruses in blood

DRUG,

+a few more days

Many viruses in blood

DRUG,

+a few days

Many viruses in blood

Explanation: the virus mutates and some viruses
become resistant to the drug.


Solution
1
: combination of drugs (cocktail).


Solution
2
: not to give drugs for which the virus is
already resistant. For example, if one was infected
from a person who receives a specific drug.


The question: how do one knows to which drugs the
virus is already resistant?

1
: Introduction

Sequences of HIV
-
1
from patients who were treated
with drug A:


AAGACGCATCGATCGATCGATCGTACG

ACGACGCATCGATCGATCGATCGTACG

AAGACACATCGATCGTTCGATCGTACG


Sequences of HIV
-
1
from patients who were never
treated with drug A:

AAGACGCATCGATCGATCGATCTTACG

AAGACGCATCGATCGATCGATCTTACG
AAGACGCATCGATCGATCGATCTTACG

1
: Introduction

drug A+

AAGACGCATCGATCGATCGATCGTACG

ACGACGCATCGATCGATCGATCGTACG

AAGACACATCGATCGTTCGATCGTACG


drug A
-

AAGACGCATCGATCGATCGATCTTACG

AAGACGCATCGATCGATCGATCTTACG
AAGACGCATCGATCGATCGATCTTACG


This is an easy example.

1
: Introduction

drug A+

AAGACGCATCGATCGATCGATCGTACG

ACGACGCATCGATCGATCGATCGTACG

AAGACACATCGATCATTCGATCATACG


drug A
-

AAGACGCATCGATCTATCGATCTTACG

AAGACGCATCGATCTATCGATCTTACG
AAGACGCATCGATCAATCGATCGTACG


This is NOT an easy example. This is an example of
a classification problem
.

1
: Introduction

1
: Introduction

2006
: Five machine learning tools were compared:


Decision trees


Linear regression


Linear discriminant analysis


Neural networks


Support vector regression

~
80
% accuracy

1
: Introduction

Revolutionizing our understanding of the
anthrax molecular mechanism

1
: Introduction


Anthrax is a disease whose causative agent is the
gram positive
Bacillus anthracis
.



It infects mainly cattle, swine, and horses but it
can also infect humans.



Humans are infected from milk or meat from
infected animals.



In humans it causes skin problems, in cattle


fatal blood poisoning.

1
: Introduction


A vaccine was found by Pasteur.



Koch was the first to isolate the bacterium.



Airborne anthrax, such as that induced by
weaponized strains used for

bioterrosrism is almost

always fatal in humans

(respiratory distress,


hemorrhage).



1
: Introduction

How does the bacterium
Bacillus anthracis

work?

It secretes three proteins: protective antigen (PA),
edema factor (EF), and lethal factor (LF).


PA monomer first binds to a host
-
cell surface
receptor. This binding triggers proteolytic cleavage
(a part of the N terminus is cut out).


The (remaining) PA monomers oligomerize,
forming heptamers.

1
: Introduction

LF and EF bind the heptamer and the entire
complex is internalized into an endosome.


The acidity in the endosome causes a
conformational change in the complex, thus it
penetrates the endosome membrane and forms a
pore.


The story continues



1
: Introduction

Researchers from the group of David Baker
wanted to know how LF and EF


bind to the heptameric PA.

They used a method called

docking




1
: Introduction

This is where the two proteins interact!

1
: Introduction

Once they had a prediction, they performed
mutagenesis experiments. Changing residues in the
predicted interface cancelled the binding.

1
: Introduction

How does docking work? Each
3
D conformation is
given a score. The pair with the best score is chosen.

1
: Introduction

Challenges: what is the best score?

How to go over as many conformations as possible?

How to take into account that proteins are flexible?