Objective: You will be able to list the positives and negatives of ...

whooshdisguisingΒιοτεχνολογία

14 Δεκ 2012 (πριν από 4 χρόνια και 9 μήνες)

153 εμφανίσεις

Objective:

You will be able to list the positives
and negatives of genetic engineering

Do Now:

Read “Increasing variation” which starts on
p. 320 and ends on page 321

Give one example of a new bacteria that
was reproduced

Give one example of a new plant that was
reproduced

Genetic Engineering


This is a new technology used to change
the genetic instructions in individuals

Why would you want to change the
genetic instructions in an organism?


To allow the organism to do something
new


Ex. Insert a gene into crops to allow them to
make a protein to fight of a fungus


For gene therapy


A defective gene is replaced with a “good”
gene

Objective:

You will be able to describe how
DNA is removed from one cell and added to
another cell.

Do Now:


Read all of p. 327


Define transformation


What is a plasmid?

1.

Copy the following series of DNA nucleotides onto a
sheet of paper.


GTACTAGGTTAACTGTACTATCGTTAACGTAAGCT
ACGTTAACCTA


2. Look carefully at the series, and find this sequence of
letters:
GTTAAC
. It may appear more than once.


3. When you find it, divide the sequence in half with a
mark of your pencil. You will divide it between the
T
and the
A
. This produces short segments of DNA.
How many occurrences of the sequence GTTAAC can
you find?

Section 13
-
2

Interest Grabber
continued

Recognition
sequences

Section 13
-
2

Restriction Enzymes

Recognition sequences are the
places on the DNA where an
enzyme will cut it

Recognition
sequences

Sticky end

Section 13
-
2

Restriction Enzymes

Human Cell

Gene for human
growth hormone

Recombinant
DNA

Gene for human
growth hormone

Sticky
ends

DNA
recombination

DNA
insertion

Bacterial Cell

Plasmid

Bacterial
chromosome

Bacterial cell for
containing gene for
human growth hormone

Section 13
-
3

Figure 13
-
9 Making Recombinant DNA

Mixed DNA


When you combine DNA from two
individuals, we call it recombinant DNA

Figure 17.5 A tobacco plant expressing a firefly gene

Objective:

You will be able to explain how gel
electrophoresis separates pieces of DNA.


Read the section named “The tools of
molecular Biology” on p. 322
-
323


How is DNA cut?


How is DNA separated?

Use of Restriction Enzymes


Restriction enzymes cut DNA whenever they
see a specific sequence of bases.



The pieces of cut DNA are called restriction
fragments



Each person has a different DNA sequence



So restriction enzymes will cut each person’s
DNA into different sized pieces.

We can use a process called gel
electrophoresis to separate the pieces

Figure 20.x1a Laboratory worker reviewing DNA band pattern

Gel Electrophoresis


Moves DNA because it is negative



Separates DNA fragments based on size



The smaller the fragment the farther it will
move



Can compare DNA from individuals


Figure 20.17 DNA fingerprints from a murder case

Figure 20.9 Using restriction fragment patterns to distinguish DNA from different
alleles

Objective:

You will be able to explain how selective
breeding can be used to improve offspring.


Do Now


Read all of page 310


Define selective breeding


Define hybridization

The tomatoes in your salad and the dog in
your backyard are a result of selective
breeding.

Interest Grabber

Labrador retriever

Poodle

Labradoodles?

Goldendoodle?

Can you think of some selective
breeding examples

Objective:

You will be able to describe the
process of cloning.


How can a sheep that is 12 years old have
a twin that is 4 years old?

Cloning

Section 13
-
4

Flowchart

A body cell is taken from a donor animal.

An egg cell is taken from a donor animal.

The fused cell begins dividing, becoming an embryo.

The nucleus is removed from the egg.

The body cell and egg are fused by electric shock.

The embryo is implanted into the uterus of a foster mother.

The embryo develops into a cloned animal.

A donor cell is taken from a
sheep’s udder.

Donor
Nucleus

These two cells are
fused using an
electric shock.

Fused Cell

The fused cell
begins dividing
normally.

Embryo

The embryo is
placed in the
uterus of a foster
mother.

Foster
Mother

The embryo
develops
normally into
a lamb

Dolly

Cloned Lamb

Egg Cell

An egg cell is taken
from an adult female
sheep.

The nucleus of
the egg cell is
removed.

Section 13
-
4