'glow gene' luciferase added.

whooshdisguisingΒιοτεχνολογία

14 Δεκ 2012 (πριν από 5 χρόνια και 23 μέρες)

226 εμφανίσεις

Syllabus Notes 3.4


3.4.1 State that PCR (polymerase chain reaction) copies
and amplifies minute quantities of nucleic acid.


3.4.2 State that gel electrophoresis involves the
separation of fragmented pieces of DNA according to
their charge and size.


3.4.3 State that gel electrophoresis of DNA is used in DNA
profiling.


Samurai Pizza Cats


Hour 2’s Random Show of the Day

Gel Electrophoresis, DNA Technology:

More than police justice

DNA Technology


Forensics

Gene Therapy

Genetic Engineering


Rabbit, mice and fish with the firefly
‘glow gene’ luciferase added.

Old fashioned methods of genetic engineering yielded things
like the liger, male lion + female tiger:

Before Electrophoresis: Mate Crosses

1978
-
Invitro
-
Fertilization led to a
baby

Genetically engineered insulin
used/approved
-
1982

Genetically engineered
organisms began to be
patented in 1981

Before Electrophoresis: Landmarks

Before Electrophoresis: More Landmarks

1992: FlavrSavr tomato,
engineered to ripen/rot
slower. Company is now
with Monsanto.

1997: First mammal cloned
(Dolly the sheep)

1998: Cloning of stem
cells (cells that are not
differentiated yet) led
to tissue regeneration,
and organ culture

1986: DNA fingerprinting developed
by Alec Jeffreys

1989: Bacteria with plasmids
that can digest oil are used to
clean up the Exxon Valdez oil
spill.

1990: Human Genome Project
launched. Goal: code the entire
human genome by 2005 (done
way ahead of schedule


2000.)

Before Electrophoresis: More Landmarks

Electrophoresis: The Basics

Procedure used to separate
molecules


most
commonly proteins and
nucleic acids.


Uses a gel and an electric
current to separate
molecules by size or
charge.

http://learn.genetics.utah.edu/units/biotech/gel/

Electrophoresis: How & why it works

Phosphate groups make
nucleic acids
negative
ly
charged.


In an electric field, the
negative anode

repels
them and the
positive
cathode

attracts them.


Smaller

fragments move
farther and faster than
slower,
larger

fragments.

(


)

Electrophoresis: Good to know

kb

= kilobase
-
pairs, or
1,000 base pairs


It is used to describe the
number of base
-
pairs in
the DNA fragments.


Example
:

4.36 kb = 4,360 base
-
pairs


Smaller

fragments are
further down than
large

fragments.

Electrophoresis: Restriction Enzymes

If someone’s DNA is cut with a
restriction enzyme
, it
will make
fragments

specific to that individual.


EcorI, a commonly used restriction enzyme, cuts
where ever
GAATTC

is found.


We may find this region:


5 times in an earthworm; or


15 times in a bacteria.


We get different
lengths

between individuals as well
as different
numbers

of fragments.

Ecor I Restriction Enzyme cuts between the ‘G’ and the ‘A’
Whenever the sequence is ‘GAATTC’


Makes ‘sticky ends’

Electrophoresis: Restriction Enzymes

This is the concept behind adding a gene from one organism
into another one.

If you cut out a gene using a restriction enzyme, you can
make an opening in the DNA of the new organism with the
same restriction enzyme.

Electrophoresis: Restriction Enzymes

SmaI cuts between the ‘C’ and the ‘G’ whenever ‘CCC
|
GGG’
are in a sequence. How does this make a ‘blunt’ end?

AATTGGAACCCGGGTTCCAAG


TTAACCTTGGGCCCAAGGTTC

Electrophoresis: Restriction Enzymes

There are a bunch of different
enzymes we can use, each
cutting in their own unique
way.


If we cut with the same DNA
with different enzymes, we’ll
get a picture like this one.

Electrophoresis: Restriction Enzymes

Electrophoresis: RFLPs


Restriction Fragment Length
Polymorphism




Definition
: a technique in which
organisms may be differentiated by
analysis of patterns by the cleavage
of their DNA.



Two organisms differing in distances
between cleavage sites will produce
different length fragments!



Similarities in patterns generated can be
used to differentiate the two.

Electrophoresis: CSI SW

We can match identities by
putting multiple people on the
same gel.

Electrophoresis: CSI SW


Ain’t yo daddy…

In each of these cases, is the alleged father really the
father? (These gel have been simplified.)


Remember: each parent donates ½ the genes!

Electrophoresis: Activity

Carefully follow

the instructions to the restriction enzyme
activity. Only do Part One!


Turn in:




Answers to the lab questions



Your labeled and cut DNA slips (staple them to your
answer sheet)



Reminder:




Make
-
up point work is due tomorrow (Friday)