The World of Microbes on the Internet - NYU Langone Medical Center


20 Φεβ 2013 (πριν από 5 χρόνια και 1 μήνα)

195 εμφανίσεις


to Undergraduates

Stuart M. Brown

Research Computing, NYU School of Medicine

What is Bioinformatics

II. Challenges of teaching

bioinformatics to undergraduates

Common bioinformatics tools

that you can use for teaching

IV. The limits of knowledge

V. Resources for the teacher

I. What is Bioinformatics?

The use of information technology to
collect, analyze,
and interpret
biological data.

The use of software tools that deal with biological
sequences, genome analysis, molecular structures,
gene expression, regulatory and metabolic modeling

Computational biology

the design of new algorithms
and software to support biology research

The routine use of computers in all phases of biology
and medicine

The Human Genome Project

A Genome Revolution in Biology
and Medicine

We are in the midst of a "Golden Era" of

The Human Genome Project has produced a
huge storehouse of data that will be used to
change every aspect of biological research
and medicine

The revolution is about treating biology as an
information science, not about specific
biochemical technologies.

The job of the biologist is changing

As more biological information becomes
available …and laboratory equipment becomes
more automated ...

The biologist will spend more time using computers

The biologist will spend more time on experimental
design and data analysis (and less time doing
tedious lab biochemistry)

Biology will become a more quantitative science
(think how the periodic table affected chemistry)

II. Why teach bioinformatics in
undergraduate education?

Demand for trained graduates from the biomedical

Bioinformatics is essential to

developments in all fields of biology

We need to educate an entire new generation of
scientists, health care workers, etc.

Use bioinformatics to enhance the teaching of other
subjects: genetics, evolution, biochemistry

Biochemistry & Protein Structures

on graphics is a powerful enhancement to
learning, particularly individualized learning. There
is powerful synergy in learning about proteins and
learning simultaneously about how to represent and
manipulate them with computer graphics. When
students learn to use graphics they see proteins and
other complex biomolecules in a new and vivid way,
and discover personal solutions to the problem of
"seeing" new structural concepts."

Molecular Graphics Manifesto

Gale Rhodes

Chemistry Department, Univ. of Southern Maine

Challenges of presenting
bioinformatics to undergraduates

Requires a deep understanding of molecular

lots of prerequisites

Training users or makers of these tools?

A good bioinformatics program will require
substantially more math and statistics than
most existing molecular biology and
computer science curricula.

Who will teach?

Different Programs,

Different Goals

Integrate into existing biology courses:

genetics, molecular biology, microbiology

Make one or a few cross
disciplinary courses

jointly taught by biology and computing faculty

open to both biology and computing students

Create a curriculum for a true bioinformatics major
(is this a double major?)

Are you training for employment or providing the
fundamentals for advanced training?

Shallow End

This workshop will focus on faculty skills
needed at the shallow end of the continuum

(a few lectures or a short course).

Use bioinformatics to teach biological



Protein structure and function

How much Computing skills?

Bioinformatics can be seen as a tool that the
biologist needs to use

like PCR

Or should biologists be able to write their own
programs and build databases?

it is a big advantage to be able to design exactly the
tool that you want

this may be the wave of the future

Is your school going to train "bioinformatics
professionals" or biologists with informatics

Designing a Curriculum

To really master bioinformatics, students need
to learn a lot of molecular biology and genetics
as well as become competent programmers.

Then they need to learn specific bioinformatics

dealing with sequence databases,
similarity algorithms, etc.

How can students learn this much material and
still manage a well rounded education?

Graduates of these programs will become scientists
and managers. Writing and presentation skills are
essential components of their education.

Different Schools have

Different Biases

There are still only a handful of
bioinformatics undergraduate programs

[Many more schools offer a single course or a
"specialized track" similar to a


You can generally predict the bias according
to what school/department hosts the program

Computer Science vs. biology

Biomedical engineering

Medical informatics (library science)

Teaching the Teachers

There are more graduate level bioinformatics
programs, but they are all very new.

Graduates of these programs will have many
opportunities as more schools gear up to offer
bioinformatics training

The reality is that most schools will draft
existing faculty

often jointly from Bio and
CompSci departments

We need to train an entire generation of
existing faculty in a new discipline

Teaching Tips

Strike a balance between theory and practical

early bioinformatics training should be about what
you can

with the tools

deeper training can focus on how they work

Balance the
"click here"

tutorials against letting
them figure it out for themselves

it will be different when they look at it next time

real bioinformatics work involves finding ways to
overcome frustrations with balky computer systems

Training "computer savvy"


Know the right tool for the job

Get the job done with tools available

Network connection is the lifeline of
the scientist

Jobs change, computers change,
projects change, scientists need to be

III. Bioinformatics Tools


Can Use


genes, proteins, genomes

Similarity Search tools: BLAST

Alignment: CLUSTAL

Protein families: Pfam, ProDom

Protein Structures: PDB, RasMol

Whole Genomes: UCSC, Entrez Genomes

Human Mutations: OMIM

Biochemical Pathways: KEGG

Integrated tools: Biology Workbench,

BCM SearchLauncher

Large Databases

Once upon a time,

sent out
sequence updates on CD
ROM disks a few
times per year.


is over 40 Gigabytes



Most biocomputing sites update their copy of

every day over the internet.

Scientists access

directly over the

Finding Genes in GenBank

These billions of G, A, T, and C letters
would be almost useless without
descriptions of what genes they contain,
the organisms they come from, etc.

All of this information is contained in the
"annotation" part of each sequence record.


is a Tool for Finding Sequences


is managed by the

(National Center
for Biotechnology Information) which is a part of
the US National Library of Medicine.

NCBI has created a Web
based tool called

for finding sequences in

Each sequence in

has a unique “


can also search for keywords such as gene
names, protein names, and the names of orgainisms
or biological functions

Entrez Databases contain more than
just DNA & protein sequences

Type in a Query term

Enter your search words in the

query box and hit the “
” button

Refine the Query

Often a search finds too many (or too few) sequences, so
you can go back and try again with more (or fewer)
keywords in your query

The “
” feature allows you to combine any of your
past queries.

The “
” feature allows you to limit a query to specific
organisms, sequences submitted during a specific period of
time, etc

[Many other features are designed to search for literature in

You can search for a text term in sequence annotations or in

abstracts, and find all articles, DNA, and protein
sequences that mention that term.

Then from any article or sequence, you can move to "related
articles" or "related sequences".

Relationships between sequences are computed with

Relationships between articles are computed with "MESH" terms
(shared keywords

Relationships between DNA and protein sequences rely on accession

Relationships between sequences and

articles rely on both
shared keywords and the mention of accession numbers in the articles.

Related Items

Database Search Strategies

General search principles

not limited to
sequence (or to biology)

Use accession numbers whenever possible

Start with broad keywords and narrow the
search using more specific terms

Try variants of spelling, numbers, etc.

Search all relevant databases

Be persistent!!

>gb|BE588357.1|BE588357 194087 BARC 5BOV Bos taurus cDNA 5'.

Length = 369

Score = 272 bits (137), Expect = 4e

Identities = 258/297 (86%), Gaps = 1/297 (0%)

Strand = Plus / Plus

Query: 17 aggatccaacgtcgctccagctgctcttgacgactccacagataccccgaagccatggca 76

|||||||||||||||| | ||| | ||| || ||| | |||| ||||| |||||||||

Sbjct: 1 aggatccaacgtcgctgcggctacccttaaccact
cgcagaccccccgcagccatggcc 59

Query: 77 agcaagggcttgcaggacctgaagcaacaggtggaggggaccgcccaggaagccgtgtca 136

|||||||||||||||||||||||| | || ||||||||| | ||||||||||| ||| ||

Sbjct: 60 agcaagggcttgcaggacctgaagaagcaagtggagggggcggcccaggaagcggtgaca 119

Query: 137 gcggccggagcggcagctcagcaagtggtggaccaggccacagaggcggggcagaaagcc 196

|||||||| | || | ||||||||||||||| ||||||||||| || ||||||||||||

Sbjct: 120 tcggccggaacagcggttcagcaagtggtggatcaggccacagaagcagggcagaaagcc 179

Query: 197 atggaccagctggccaagaccacccaggaaaccatcgacaagactgctaaccaggcctct 256

||||||||| | |||||||| |||||||||||||||||| ||||||||||||||||||||

Sbjct: 180 atggaccaggttgccaagactacccaggaaaccatcgaccagactgctaaccaggcctct 239

Query: 257 gacaccttctctgggattgggaaaaaattcggcctcctgaaatgacagcagggagac 313

|| || ||||| || ||||||||||| | |||||||||||||||||| ||||||||

Sbjct: 240 gagactttctcgggttttgggaaaaaacttggcctcctgaaatgacagaagggagac 296

Sample Multiple Alignment

Protein domains

(from ProDom database)

Original studied protein from which

annotation was inherited.

New sequence

Closest database annotated entry

Limits on best Matched Annotation Inheritance

result from many things including multi domain proteins transitivity.

Protein Structure

It is not really possible to predict protein
structure from just amino acid sequence


is a database of know protein structures
(determined by X
ray crystallography and

There are also very handy structure viewers
such as

that are free for any

Genome Browsers

Scientists need to work with a lot of
layers of information about the genome

coding sequence of known genes and

predicted genes

genetic maps (known mutations and

gene expression

cross species homology


Ensembl at EBI/EMBL

Human Alleles


) database at the NCBI tracks all human
mutations with known phenotypes.

It contains a total of about
2,000 genetic

[and another ~11,000 genetic loci with
known phenotypes

but not necessarily known gene

It is designed for use by physicians:

can search by disease name

contains summaries from clinical studies

KEGG: Kyoto Encylopedia of

Genes and Genomes

Enzymatic and regulatory pathways

Mapped out by EC number and cross
referenced to genes in all known organisms

(wherever sequence information exits)

Parallel maps of regulatory pathways

Integrated Online Tools

National Database/Sequence Analsysis


Tools for specific types of data or problems


(Protein, Mass Spec, 2

D Protein Structures:

PDB, Predict Protein Server

Education oriented tools

Biology Workbench

Collections of links to other servers

BCM SearchLauncher

The Limits of our Knowledge

Bioinformatics is a very dynamic discipline

Teachers can't know everything in the field

The databases are clumsily built

Biology is vastly more complex than our

Lots of our current bioinformatics programs don't
work well

We don't have even theoretical solutions for Gene
prediction, alternative splicing, protein structure &
function prediction, regulatory networks

What is a

For every 2 biologists, you get 3 definitions

“A DNA sequence that encodes a

heritable trait.”

The unit of heredity

Is it an abstract concept, or something you
can isolate in a tube or print on your screen?

“Classic” vs.. “modern” understanding of
molecular biology

Genome Confusion

The sequence of a gene in the genome includes:

protein coding sequence

introns and exons

5' and 3' untranslated regions on the mRNA

promoter and 5' transcription factor binding sites


What about alternative splicing?

Multiple cDNAs with different sequences (that
produce different proteins) can be transcribed from
the same genomic locus

V. Teaching Resources

The Biology Student WorkBench

RasMol/Chime/Protein Explorer

Other courses

It ain't cheating to learn from
your peers

Terri Attwood's Web Biocomputing tutorials

Sequence Analysis on the Web

Christian Büschking and Chris Schleiermacher


Online Lectures on Bioinformatics

Hannes Luz
Max Planck Institute for Molecular Genetics

Using Computers in Molecular Biology

Stuart Brown, NYU School of Medicine

Teach Yourself Bioinformatics on the Web

Long Term Implications

A "periodic table for biology" will lead to
an explosion of research and discoveries

we will finally have the tools to start
making systematic analyses of biological
processes (quantitative biology).

Understanding the genome will lead to
the ability to change it

to modify the
characteristics of organisms and people in
a wide variety of ways

Genomics in Medical Education
















































Francis Collins

Stuart M. Brown, Ph.D.

A Biologist's
Guide to
and the