EBItoolboxPelligrini - Bioinformatics

underlingbuddhaΒιοτεχνολογία

2 Οκτ 2013 (πριν από 3 χρόνια και 10 μήνες)

84 εμφανίσεις

The European Bioinformatics
Institute (EBI) Toolbox

http://www.ebi.ac.uk/Tools/


Julie Pellegrini

Introduction to Bioinformatics

What does the Toolbox include?


Homology and Similarity Programs


Protein Functional Analysis


Structural Analysis


Sequence Analysis


Miscellaneous Tools (clustering,
visualization tools for gene expression)

Homology and Similarity Programs


Fasta


Nucleotide, protein, ion
channels


BLAST


Nucleotide, protein,
‘Alternative Splicing’,
vectors


Smith & Waterman


Protein sequence
comparison


Databases


Proteomes, Genomes,
Parasites, SNP

Protein Functional Analysis


InterPro


Protein Motif Database


InterProScan


Search InterPro by
accession number or
sequence


Search features


Protein repeats,
motifs, biochemical
function, family

Structural Analysis


Protein structure
analysis and
secondary structure
prediction


DALI, MaxSprout


Active Site Search


NMR elucidation


Protein Quaternary
Structure


PQS, PQS
-
Quick


Sequence Analysis


Unknown structure and
function can be elucidated
through comparison with
database of known
structures/sequences/functions


ClustalW


Global Multiple Alignment


EMBOSSALIGN


Like BLAST2 but Global


Gene finding tools


Translation tools


Promoter Analysis tools

Miscellaneous Tools


BioLayout


CAST
-
protein
compositional filtering


Expression Profiler
-
gene
expression tools


NEWT


Swiss
-
Prot Database


Readseq


Converts format


Webservices


Access various biological
databases



Protein Colourer


Colors amino acids


QuickGo


Ontology Database search


Protein Annotation
Assistant


XEMBL


EMBL nucleotide sequence
data in variety of formats


I’ve just discovered a gene! Or
have I…?

Yeast

Genome isolation and sequencing revealed
possible protein
-
coding sequence:

ATGTTTACTGGTCAGGAGTATCATTCCGTAGACTCTAATTCCAACAAGCAAAAAGACAACAATAAACGTGGTATTGATGACACATCAAAGAT
CTTGAATAATAAGATACCGCACTCTGTTAGTGATACTTCTGCCGCCGCCACCACCACTTCTACTATGAACAATTCTGCTTTAAGTAGATCCT
TAGATCCTACTGACATAAACTATAGCACAAATATGGCTGGTGTGGTTGACCAAATACATGATTATACTACTTCCAATAGAAATTCTTTAACCC
CACAATATTCTATTGCAGCTGGAAACGTCAATTCGCATGATCGGGTTGTTAAACCCAGCGCCAATTCAAACTATCAGCAGGCTGCATACCTT
CGACAACAGCAACAGCAGGATCAGCGACAACAGTCACCCTCTATGAAAACTGAAGAGGAATCCCAACTCTACGGTGATATTCTGATGAAT
TCTGGTGTCGTACAGGATATGCATCAGAATCTGGCCACTCATACAAATCTGAGCCAACTGTCGTCTACCCGTAAGTCCGCTCCGAATGATT
CTACTACAGCCCCGACTAATGCGTCCAACATCGCCAATACGGCTTCTGTGAACAAGCAGATGTATTTCATGAACATGAATATGAATAACAAC
CCACATGCCTTGAACGATCCATCCATCCTGGAAACATTGTCGCCATTTTTTCAACCTTTTGGTGTTGATGTAGCACATTTACCTATGACGAA
TCCACCAATTTTCCAAAGTTCTTTGCCTGGATGCGATGAGCCAATTAGAAGAAGAAGAATATCAATCTCTAACGGTCAAATAAGCCAGCTA
GGCGAAGATATTGAAACTTTGGAAAACCTGCACAACACACAGCCGCCCCCGATGCCCAATTTTCACAATTATAATGGTCTGAGCCAAACTA
GGAATGTATCAAACAAGCCGGTCTTCAACCAAGCAGTGCCGGTTAGTAGTATTCCACAATACAATGCAAAAAAAGTTATTAATCCCACGAA
GGACTCCGCATTGGGTGATCAGAGCGTTATTTACTCGAAAAGTCAGCAGCGAAATTTTGTAAACGCGCCATCAAAGAATACTCCAGCGGA
GAGTATAAGTGATTTGGAAGGCATGACGACGTTTGCGCCAACTACTGGAGGTGAAAATAGGGGCAAATCTGCACTTAGGGAATCTCACTC
TAATCCTAGCTTCACTCCAAAATCTCAAGGATCTCATTTAAATTTAGCGGCGAACACACAGGGAAATCCAATCCCTGGTACTACGGCATGG
AAGAGAGCAAGATTGTTAGAAAGAAATCGAATTGCAGCTTCGAAATGTAGACAAAGGAAAAAGGTTGCGCAGCTGCAGCTCCAAAAGGAA
TTTAACGAAATTAAAGACGAGAATAGAATTTTACTGAAAAAGTTAAATTACTATGAAAAACTAATCTCTAAATTCAAGAAATTCTCCAAAATT
CATTTACGTGAACATGAAAAACTAAATAAAGACTCAGATAATAATGTTAATGGCACTAATAGTAGCAACAAAAATGAAAGCATGACTGTGGA
TTCATTAAAGATCATTGAAGAACTTTTAATGATCGATTCAGACGTTACAGAAGTGGATAAAGATACTGGTAAGATCATAGCCATCAAGCACG
AGCCATACTCTCAACGTTTCGGAAGCGATACTGACGATGACGATATAGATCTCAAGCCCGTAGAAGGTGGTAAGGATCCAGACAACCAAT
CATTACCCAATTCTGAAAAGATAAAATAA

What sorts of protein does my
newly discovered gene code for??


Paste discovered gene into Transeq to find
protein sequence

Use PPSearch on the TranSeq
Output

How does our protein sequence
compare with known cross
-
references?


Here is a Case for Sequence Alignments!


Use Align, ClustalW…

Method

Gap Open

Gap Extend

Molecule

Matrix

Align Output Findings

We have in fact found what our gene codes for (YCA2)
and it has already been added to the protein database.