Biotechnology.pptx - kmittereder

twoeggfinnishΒιοτεχνολογία

14 Δεκ 2012 (πριν από 4 χρόνια και 10 μήνες)

242 εμφανίσεις

B
IOTECHNOLOGY

W
HAT

IS

B
IOTECHNOLOGY
?


Use of technology to control biological processes
to meet needs of society



Examples:


Transgenic Biotechnology


Reproductive Cloning


Stem Cells


Forensic Biotechnology



All of these topics are applications of genetics

T
ODAY
:


Focus on genetic modification


What is it?


Why is it needed by society?


How is it accomplished?


Discussion of Genetically Modified Food


Pro


Con


Regulation

W
HAT

ARE

T
RANSGENIC

O
RGANISMS
?


Organisms whose genome has stably
incorporated one or more genes from another
species


Also called GMOs


or genetically


modified organisms




H
OW

DO

WE

MAKE

TRANSGENIC

O
RGANISMS
?

1.
Restriction Enzymes
cut out gene of
interest


2.
Restriction Enzymes
cut out section of
plasmid


3.
Make recombinant
DNA


4.
Transformation

put in bacteria


**Note viruses can also
be used!

U
SES

OF

T
RANSGENIC

O
RGANISMS
:


Genetically Modified Foods


Animals


Pigs with more Omega
-
3 fatty acids


Plants


80% of soybeans, 79% of cotton, 52% of corn


Insect Resistant


Herbicide Resistant


Golden Rice (more Vitamin A)


Medication


Goats making hormones


(growth, insulin, clotting factors)


Research


GFP tags (glow in the dark)


W
HY

WERE

T
RANSGENIC

PLANTS

CREATED

IN

THE

FIRST

PLACE
?


Future of food to gene revolution

C
OME

IN

AND

T
AKE

A

S
EAT

P
LEASE

PULL

OUT

YOUR

WS

AND

RESEARCH

PACKETS

FROM

YESTERDAY

W
HAT

DO

YOU

THINK
?


In Class Essay


1.
What is genetic engineering or genetic
modification?


2.
What do you think about genetically modified
food and genetically modified organisms?
Helpful to society? Concerns?


3.
Please use pieces of evidence from the research
to support your opinion!

G
ENETIC

M
ODIFICATION

AND

S
OCIETY


Read Monsanto Article



What is their position?


Evidence


What do you think about it?



Monsanto video


Growing our economy


Driving Yield


G
ENETIC

M
ODIFICATION

AND

S
OCIETY


What do you think about Monsanto’s
impact on the gene revolution?



Share with your partner



Share with class


2
TH

P
ERIOD

GMO
VS
. N
ON

GMO


Increase in money


Increase in yield


Less resources


Fuel, water


Less loss of crops


More stable economy


Increase biotechnology


More nutritious


No information that there
is a problem with safety


Stop expression of
bacterial genes


FDA approved


Not tested…negative effects


No coexisting


Not strictly labeled


No information that there is a
problem with safety


More allergies


Variable crop yields


Less nutritious


Disrupt the ecosystem


Not natural


Short amount of
time

long

term?


Can’t research patents


Too expensive; not
enough access






Pro: GMO


Con: Non GMO

R
EGULATION

OF

GMO


FDA


The Future of Food video


Skim over the Genetic Modification
Article



What is the FDA’s opinion?


Evidence



How do you feel about regulation?



Share with Partner


Class Share

SAY NO TO GMO
S
!


What do you think now?



Did your opinion change about
anything?

GM C
ROPS

J
UST

THE

S
CIENCE


What is their opinion?


Evidence



Share with partner


Share with class

W
HAT

DO

YOU

THINK
?


In Class Essay


1.
What is genetic engineering or genetic
modification?


2.
What do you think about genetically modified
food and genetically modified organisms?
Helpful to society? Concerns?


3.
Please use pieces of evidence from the research
to support your opinion!

6
TH

P
ERIOD

GMO
VS
. N
ON

GMO


Feed more people


Avoid disease/pests


Reduce emissions


Jobs


Favorable traits
discovered


Increase science
knowledge about genes


Improve soil health


Monsanto


corperation

focuses on
making money


Have patents on seeds


Not like traditionally breeding (genes)


Not properly tested…increase in food
illnesses (not sure)


None have proven to increase
nutritional value


(50%) drop due to transformations;
drop in yield


Traditional breeding more effective


Require fertilizer


creates
greenhouse gases


Lack of variation


Addicted to herbicides and pesticides


Can easily mix together/contaminated


MAS or IPM / Sustainable



Pro: GMO


Con: Non GMO

8
TH

P
ERIOD

GMO
VS
. N
ON

GMO


Reduce strain on water
and resources


Increase yield /
maximize food


Feed the world


Good Marketing


Advanced Seeds


Increase in scientific
knowledge about seeds
and genes


Seed library


Safety? No long term studies


Deaths or allergic reactions or toxic
effects


Gene transfer (how can we control?)


Less nutritious


Technology/genes owned by
corporations


No increase in livelihood


Increase greenhouse gas emissions


Creating “super weeds” (resistance)


Contamination of non GM crops


Organic methods work just as well
and safer


Not tested on humans



Pro: GMO


Con: Non GMO

I
N

C
LASS

E
SSAY


What is genetic modification and what are transgenic
organisms?


Why are transgenic organism created?


How does genetic modification help society?


How are transgenic organisms created?


Monsanto is one of the biggest companies involved in
producing genetically modified seeds? What do you think
of Monsanto as a corporation?


Many genetically modified crops (such as corn, squash, and
soybeans) have been engineered to contain a bacterial gene
(Bt) that acts as a natural pesticide. Is this safe?


The FDA currently does not currently require food labels to
list genetically modified ingredients? Do you think this
should be included on the food label?


Any final thoughts?


G
ENETIC

E
NGINEERING

AND

P
REIMPLANTATION

G
ENETIC

D
IAGNOSIS

(D
ESIGNER

B
ABIES
)

R
EVIEW
: M
EIOSIS


This 2
times!

F
ERTILIZATION


Male and female gametes combine to
create an embryo


This occurs in the fallopian tube


The embryo then travels to the uterus
where it implants

D
EVELOPMENT


Oocyte

+ sperm


zygote


blastula


gastrula

D
EVELOPMENT



F
ERTILIZATION

V
IDEO


A
FTER

F
ERTILIZATION
, W
HAT

DOES

THE

O
FFSPRING

LOOK

LIKE
?


Should be a
random

combination of
the mother and father


Father: genetically different sperm


Mother: genetically different egg


Genetically different due to crossing over
and independent assortment

D
OES

IT

HAVE

TO

BE

A

R
ANDOM

COMBINATION

OF

GENES
?

P
REIMPLANTATION

G
ENETIC

D
IAGNOSIS

(PGD)


Embryo Screening


Remove Eggs


Invitro

Fertilization


Test child for genetic
disorders before
implantation into the
mother

T
HIS

MAY

CHANGE

IN

THE

FUTURE



Scientists and Doctors are now screening for
more than genetic diseases. They are trying to
predict eye color, sex, and hair color.


Maybe tomorrow they will be looking for athletic
ability and intelligence



A Baby, Please. Blond, Freckles
--

Hold the Colic




Please Read this article and record your
opinions



Share your thoughts with your partner

V
IDEO
: D
ESIGNER

B
ABIES


What do you think about this?


Is this a new technology we should
explore?


Is it right to be able to select the traits
of your child?


What traits are better?


Do you think it is ok to produce
children that are identical matches to
their siblings if bone marrow
transplants are needed?


C
LOSE


This is not currently available on the
market but could be an issue you are
faced with in your lifetime…

S
TEM

C
ELLS

W
HAT

IS

A

S
TEM

C
ELL
?


Undifferentiated


Cell with ability to
differentiate into a
variety of cell types



Totipotent



develop into organism


Pluripotent



develop into tissue or
cell types





H
OW

ARE

STEM

CELLS

AN

IMPORTANT

ASPECT

OF

MEDICAL

RESEARCH
?


Have the ability to become all types of tissue


Can be used to treat disease /fix damaged
tissue

C
LONING

C
LONING

(S
OMATIC

N
UCLEAR

T
RANSFER
)

C
LONING


Applications:


Animal models


Clone stem
cells


Drug
production


Endangered
species


Deceased pet



Myths:


Instantaneous


Carbon Copies

I
S

A

C
LONE

A
RMY

ON

THE

H
ORIZON
?

I
S

IT

C
LONING

OR

N
OT
?


http://learn.genetics.utah.edu/content/tech/clonin
g/cloningornot/


G
ENETIC

T
HERAPY

G
ENE

T
HERAPY


In a person with disease, add correct
copy of the gene into nonfunctional
cells



Steps:

1.
Cut out correct gene from DNA

2.
Insert it into the vector

3.
Use vector to insert it into the tissue
and activate the gene

4.
Now have a functional gene in the
tissue cells




H
OW

DO

WE

GET

THE

G
ENES

INTO

THE

C
ELLS
?


Vectors


Viruses or Plasmids



Viruses are great at getting DNA into cells


Specific to cell type



Plasmids are easy ways to get DNA into a
bacterium

M
EDICAL

R
ESEARCH


Remember
RNAi



http://youtu.be/H0RvTOF1fEc


W
HAT

ARE

SOME

C
HALLENGES

OR

I
SSUES
?


Gene delivery and activation


Introducing changes into the
germline


Immune response


Disrupting important genes in target
cells


H
OW

DO

WE

MAKE

T
RANSGENIC

O
RGANISMS
?


Restriction Enzymes


Allow scientists to cut out desired DNA fragments
(genes)

P
RACTICE
: W
HERE

DOES

THIS

RESTRICTION

ENZYME

CUT
?


Hind
III



5'
-
A |A G C T T
-
3'


3'
-
T T C G A| A
-
5'




5


AAGCTTGCCGATTAAGCTTATCCGGATATGG

3


3
'

TTCGAACGGCTAATTCGAATAGGCCTATACC

5


H
OW

DO

WE

MAKE

T
RANSGENIC

O
RGANISMS
?


Plasmids


Small DNA bearing units outside bacterial
chromosome


P
RACTICE
: H
OW

MANY

PIECES

COULD

WE

MAKE

IF

WE

CUT

THIS

PLASMID

WITH



HindIII
?


BamHI
?


EcoRI
?


HindIII

and
BamHI
?


HindIII
,
BamHI
, and
EcoRI
?

Hind III

Hind III

BamHI

BamHI

BamHI

EcoRI

EcoRI