Manipulation of organisms to make useful products

tanktherapistΒιοτεχνολογία

23 Οκτ 2013 (πριν από 3 χρόνια και 8 μήνες)

83 εμφανίσεις

Manipulation of organisms to make useful products


Medical research (Cloning)


Help people overcome genetic diseases (Gene therapy)


Help convict criminals (Gel electrophoresis)


Study a genome of an extinct organism such as the
wooly mammoth (PCR and sequencing)


Create bacteria more efficient at cleaning up oil spills
and food that is larger/better/more nutritious/pest
resistant (Genetic engineering)

During an ordinary but particular cold day at THS, the fire
alarm went off. The school was evacuated and the fire
department came to check on the situation. Since it was so
cold it seemed impossible that a student would pull the fire
alarm… except a student in Ms. Tank’s class. She was giving
an extremely hard test that day and it would seem
reasonable that a student might think that she would
postpone it after the fire alarm (however, they were
wrong). There were 2 students out in the hall from her
class during that time (there names were recorded on the
sign out sheet). Furthermore, the person who pulled the
alarm must have had a cut on their finger because a little
speck of blood was left on the fire pull. Can you help solve
the case?


Student 1:

Student 2:


Collection of DNA (from the blood on the fire alarm
and from the suspects)


Extraction of DNA (Basically destroying the nuclear
membrane so we can get at the DNA)


DNA cut by restriction enzymes


DNA fragments separated using a gel


Analysis


Cut DNA between specific bases


Restriction enzyme
Hae

III

5’ …GGCC… 3’

3’ …CCGG… 5’



Restriction enzyme Bam HI

5’ …GGATCC… 3’

3’ …CCTAGG… 5’


Ex. The following DNA samples are from different
people. How would the lengths of their DNA differ if
they were cut with Restriction enzyme
Hae

III?

5’ …GGCC… 3’

3’ …CCGG… 5’


Person 1


GGCC
ATTAC
ATTACATTACATTACATTACATTAC
GGCC


Person 2


GGCC
ATTAC
ATTACGGCCATCGATC
GGCC
AGTCATCC

*Notice the variable number of
tandum

repeats (VNTR)
between these people.


Load the DNA in the wells in the gel


The negatively charged DNA moves toward the positive
side of the current


Larger DNA fragments cannot go as far as fast as the
smaller DNA fragments.


Read gel electrophoresis in lab notebook

1.What do the bands in the drawing of
the
agarose

gel represent?

2. Which band(s) traveled slowest?

3. Which band(s) traveled fastest?

4. The bands of DNA traveled to the
bottom of the gel, is this side
positive or negative on the
electrode? Why?

5. What suspect(s) should be
questioned further about the crime?

DNA
marker

DNA found at
crime scene

Suspect 1

Suspect 2

Suspect 3

Suspect 4

Suspect 5

Suspect 6


What do the bands in the drawing of the agarose gel represent?

Many DNA fragments which are the same size


Which band(s) traveled slowest?

The bands nearest the wells (containing the longest DNA
fragments) traveled the slowest.


Which band(s) traveled fastest?

The bands farthest from the wells (containing the shortest DNA
fragments) traveled the fastest.


The bands of DNA traveled to the bottom of the gel, is this side positive
or negative on the electrode? Why?



The negative pole is located closest to the wells. The positive pole
is located furtherst from the wells. DNA is negatively charged.


What suspect should be questioned further about the crime?


Suspect 2 and 4




We are researchers who want to study what makes
hummingbirds able to metabolize so fast. We want to
sequence (find out the specific base pairs, and
therefore amino acids) of the DNA in the hemoglobin
gene and compare it to hemoglobin genes of other less
active species.


First, we need to isolate the gene and get many copies
of it


Gene cloning


PCR


Why Bacteria?


Quick to reproduce


Plasmids


small
circular DNA that
can be taken up by
bacteria and
replicated


Transformation

is
the uptake of the
DNA by
bacteris


Easy to grow



Gene
Cloning




Need


Primers (specific to the
gene you want)


Nucleotides


Polymerase


Genomic DNA



Like PCR, but with
fluorescently labeled
nucleotides


When a labeled
nucleotide is added, it
stops further elongation


Then run it through a
mini
-
gel


What if we wanted to look at how many
hemoglobin and metabolism related genes get
expressed in comparison to other organisms?


Write on a sheet of paper


3 things you understand


2 things you need to understand better


1 thing you do not understand at all



Now, you and your group need to pick one topic and
use the book to help you better understand that topic


We want to make insulin for people to use as medicine
for diabetes.


How do we make this?



DNA cloning


Expression in a cell downstream from an active
promoter


most likely in a yeast cell because of post
translational modification.


Gene Therapy


inserting
genes into an afflicted
individual for
therapeutic purposes


Transgenic plants and
animals


individuals
that have introduced
genes in their genome


Video on

transgenics

1.What do the bands in the drawing of
the agarose gel represent?

2. Which band(s) traveled slowest?

3. Which band(s) traveled fastest?

4. The bands of DNA traveled to the
bottom of the gel, is this side
positive or negative on the
electrode? Why?

5. What suspect should be questioned
further about the crime?

DNA
marker

DNA found at
crime scene

Suspect 1

Suspect 2

Suspect 3

Suspect 4

Suspect 5

Suspect 6


What do the bands in the drawing of the agarose gel represent?

Many DNA fragments which are the same size


Which band(s) traveled slowest?

The bands nearest the wells (containing the longest DNA
fragments) traveled the slowest.


Which band(s) traveled fastest?

The bands farthest from the wells (containing the shortest DNA
fragments) traveled the fastest.


The bands of DNA traveled to the bottom of the gel, is this side positive
or negative on the electrode? Why?



The negative pole is located closest to the wells. The positive pole
is located furtherst from the wells. DNA is negatively charged.


What suspect should be questioned further about the crime?


Suspect 2 and 4




Have one student from your group grab one strip of
paper from the front (under the document camera)
and decide what biotechnological techniques you will
use to answer the given question. BE SPECIFIC!

*Note: on the next slide I will list some of the techniques
you might want to use.


Cloning using
bacteria


Cloning using PCR


Nucleic acid
hybridization


Gel electrophoresis


DNA sequencing


Create a genomic
library


RFLP analysis


RNA extraction


Reverse transcriptase
PCR


Expression vector
-

using bacteria to
express a gene


Restriction enzymes to
chop up DNA at specific
points


Microarrays


In vitro mutagenesis


mutated forms of a gene
are reinserted into the
original species to look
for malfunctions in
gene expression


Began in 1990, originally thought it would take 15
years, but only took 13


Ended in 2003


Main goals of the HGP


Identify ~20,000
-
25,000 genes


Determine sequence of all (haploid) 3 billion base pairs
(*we have 6 billion if you take into account that we are
diploid)


Bioinformatics (Store large amounts of DNA
information)


Address ethical issues