specific

roachavocadoΒιοτεχνολογία

14 Δεκ 2012 (πριν από 4 χρόνια και 9 μήνες)

204 εμφανίσεις

Biotechnology

Using Biology to Solve Society’s Problems

What Is Biotechnology?


Genetic engineering


modify DNA to produce
______ (?)


Recombinant DNA


genetically modified
organisms; recombinant


Agriculture


Medicines


Forensics


Natural Recombination


Recombination of genes happens naturally in
sexually reproducing organisms


Meiosis and fertilization


Recombination of genes


Law of Segregation


Law of Independent Assortment


Random chance


Crossing over

Bacterial Recombination


Bacteria


binary fission (asexual, ‘cloning’)


No genetic variation


Genetic recombination by 3 means:


Mutation


‘goof’ in the code


Transformation


pick up DNA from environment


Transduction


viruses transfer DNA


Conjugation


bacteria ‘swap’ DNA

Transformation


Bacteria can absorb DNA from the
environment


Enables some bacteria to
become resistant to antibiotics (MRSA)


Griffith’s experiment

plasmid

bacterial

chromosome

DNA

fragments

bacterial

chromosome

Transformation with DNA fragment

Bacterium

bacterial

chromosome

Transformation with plasmid

plasmid

Transformation



Conjugation



Transfer of genes by bacteria that are temporarily ‘joined’


Pili



Bacterium must have the gene for making a pilus

Plasmids


Circular DNA in bacteria that carries ‘superpower’
genes


F = ‘fertility’; the ability to grow sex pili


R = resistance factor(s)

Transduction


Transfer of genes from one bacterium to another
by viruses (phages)


Hershey
-
Chase; used T4 phage
to determine that DNA was the
hereditary material


Restriction Enzymes


Bacteria have enzymes that cut DNA in
specific

locations


‘Cut out’ phages


Enzymes have recognition sites


Specific sequence of nucleotides


Palindromes


Race car; anna; madam; flee to me remote elf;
gnu dung; lager sir is regal; tuna nut


Forensics


DNA Fingerprinting


Restriction enzymes cut pieces
of DNA in very
specific

locations


Create pieces of DNA of differing
lengths


Restriction Fragment Length
Polymorphisms, RFLPs



Other restriction enzymes

Forensics




RFLPs

Forensics


Large and small pieces can be separated


Gel electrophoresis


process used to
separate RFLPs

1.
Cut DNA with restriction enzymes

2.
DNA ‘loaded’ into a gel bed with wells

3.
Electricity ‘pulls’ the negative DNA towards the
positive pole through the gel bed

4.
Large pieces move slower creating separation

DNA samples are pipetted into wells (shallow slots) in the gel. Electrical current is sent
through the gel (negative at end with wells, positive at opposite end.)

gel

power supply

wells

pipetter

Electrical current moves DNA segments through the gel. Smaller pieces of DNA move
farther toward the positive electrode.

DNA “bands”

(not yet visible)

Gel electrophoresis

Southern Blotting Technique


Too many bands are created during
electrophoresis


Have to make specific ‘bands’ visible


Nitrocellulose paper is placed on the gel


Alkaline solution unwinds the DNA helix


Separated strands of DNA are absorbed by the
nitrocellulose paper (blotting)


Gel is placed on special nylon “paper.” Electrical current drives separated

DNA out of gel onto nylon.

gel

nylon

paper

Southern Blotting


Radioactive or colored probes are mixed with
the ‘blot’


Probes pair with their complimentary STR


Probes can be seen

Nylon paper with DNA is bathed in a solution of labeled DNA probes (red) that
are complementary to specific DNA segments in the original DNA sample.

nylon paper

solution of DNA

probes (red)

STR #1: probe base
-
pairs and binds

probe

label

(colored

molecule)

STR #2: probe cannot base
-
pair; does not bind


Complementary DNA segments are labeled by probes (red bands).

DNA Forensics


STR


short, tandem repeats of
nucleotides (4 or 5)


AGATAGATAGATAGATAGAT


Common in non
-
coding regions of DNA
(introns)


Number of times it repeats is variable


DNA fingerprint
-

use multiple STR’s (10
-
13) to
determine identity

A

T

G

C

A

T

T

A

A

T

G

C

A

T

T

A

A

T

G

C

A

T

T

A

T

A

A

T

A

T

T

A

T

A

T

A

T

A

G

C

A

T

A

T

G

C

A

T

T

A

8 side
-
by
-
side (tandem) repeats

of the same 4
-
nucleotide sequence,

A

T

G

C

A

T

T

A

A

T

G

C

A

T

T

A

A

T

G

C

A

T

T

A

A

T

G

C

A

T

T

A

A

T

G

C

A

T

T

A

A

T

G

C

G

C

T

A

A

T

STR name

Penta D

CSF

D16

D16: an STR on chromosome 16

DNA samples from

13 different people

D7

D13

D5

15

14

13

12

11

10

9

8

Number of repeats

Variety of STR’s used to
isolate one individual

DNA fingerprint

Forensics


Polymerase Chain Reaction
-

amplifies DNA


PCR copies a specific DNA sequence


Need to make more copies of the DNA


DNA is degraded (old)


Not a large enough sample


Each PCR cycle doubles the number of copies of the DNA

1

2

3

PCR

cycles

4 etc.

1

2

4

8

DNA

copies

16 etc.

DNA

fragment

to be

amplified

One PCR cycle

original

DNA

90
°
C

50
°
C

72
°
C

1 Heating

separates

DNA strands.

2 Cooling allows

primers and

DNA polymerase

to bind.

3 New DNA

strands are

synthesized.

primers

DNA

polymerase

new DNA

strands

Primers

Nucleotides

DNA polymerase

Heat

Forensics, cloning, genetic
engineering

Transgenic Organisms


Using biotechnology to rearrange genomes


Medical


Agricultural


Bioethics


Cut both with the same restriction enzyme.

Mix Bt gene and plasmid; add DNA ligase to seal DNA.

Transform
Agrobacterium tumifaciens

with recombinant

plasmid

Infect plant cell with transgenic bacterium.

Insert Bt gene into plant chromosome.

DNA including Bt gene

Ti Plasmid

Bt gene

plant cell

plant

chromosomes

A. tumifaciens

A. tumifaciens

plasmids

bacterial

chromosome

Why is this important?

Agricultural Use


Knowing genome of an organism enables us to
‘interfere’ with normal protein production


Insert, remove genes


Sterile Insects


Irradiate then release


Insert lethal gene


then release


Silk worm


industrial strength, glow
-
in
-
the
-
dark silk

Transgenic Organisms


Transgenic mosquitoes


Anopheles

carry malaria parasite


Insert genes so that they cannot
carry
Plasmodium

Dolly and her ewe

Transgenic Organisms


Restriction enzymes cut bacterial plasmid DNA
(pDNA)


Same restriction enzymes
cut ‘genes of interest’ from
another organism


‘Genes of interest’ added to
a solution with pDNA


DNA ligase (‘glue’) is
added to ‘glue’ pieces together

Biotechnology In Agriculture


Many

Crops Are Genetically Modified


Tomatoes


slow ripening process


Tomatoes


insect resistance


Bacillus thuringiensis


produces a natural
insecticide


Desired genes are cloned (insecticide gene)


Biotechnology in Agriculture


Transgenic plants are
cloned
in vitro


Plants are bred together
creating 2
nd

generation
plant with insect
-
resistance gene


Plants produce antibodies
to fight disease (?)

Resistant to
fungus

How Is Biotechnology Used for Medical
Diagnosis and Treatment?


Diagnose Inherited Disorders


Restriction enzymes may cut different alleles of a gene at
different locations


Diagnosing sickle
-
cell anemia with restriction
enzymes


Normal
allele

Sickle cell

normal

globin allele

Mst II cuts a normal globin allele in 2 places, but cuts the

sickle
-
cell allele in 1 place.

sickle
-
cell

globin allele

Mst II

Mst II

Mst II

DNA probe

Mst II

Mst II

DNA probe

large

small

AA

AS

SS

Medical Diagnosis and Treatment


Treat Cystic Fibrosis


Cure Severe Combined Immune Deficiency

parents with genetic disease

fertilized egg with

defective gene

embryo with

genetic defect

therapeutic

gene

genetically corrected

cell from culture

egg cell

without

nucleus

genetically corrected

clone of original embryo

healthy baby

baby with

genetic disorder

genetically corrected

egg cell

treated culture

viral

vector

amniocentesis

vagina

placenta

uterus

fetus

amniotic

fluid

chorionic villi

chorionic

villus sampling


(by suction)

cells:

sex

determination,

biochemical and

enzymatic studies

cell culture: biochemical

studies, chromosomal

analysis, analysis using

recombinant DNA

methods

centrifuge

fluid:

composition

analysis

Ethical Issues of Biotechnology



Should Genetically Modified Organisms Be Permitted in
Agriculture?


Are Foods from GMOs Dangerous to Eat?


Are GMOs Hazardous to the Environment?


Should a Human Genome Be Changed by
Biotechnology?