Lecture 5

roachavocadoΒιοτεχνολογία

14 Δεκ 2012 (πριν από 4 χρόνια και 8 μήνες)

194 εμφανίσεις

Plastids

Plastids (derived from proplastids)


1.
Chromoplast

2.
Chloroplast

3.
Amyloplast

4.
Leucoplast

5.
Elaioplast

6.
Etioplast

In plants, meristamatic cells contain
10
-
14 proplastids, each carrying 1
-
2 nucleoids per proplastid, whereas
leaf cells may contain 100
chloroplasts, with 10
-
14 nucleoids
each. There are several ptDNA per
nucleoid. Thus proplastids contain
lower copies of ptDNA than
chloroplasts.

Plastid

nucleoid

ptDNA copies

The Structure of of O. sativa Chloroplast Genome

~120 genes

~50 transcription units


Two inverted repeats

One large single copy region

One small single copy region

These are salient
features of any higher
plant plastids

Conserved Features of Chloroplast Genomes in Higher Plants

LSC

IR
B

SSC

IR
A

86,686

25,341

18,571

25,341

82,355

22,748

22,748

12,536

80,592

20,799

20,799

12,334

81,095


10,058


10,058


19,813

65,696

495

495

53,021

19,799

22,735

22,735

4759

Tobacco (155,939 bp)

Maize (140,387 bp)


Rice (134,525 bp)

Marchantia (121,024 bp)

Black pine (119,707 bp)

Epifagus (70,028)

LSC= Large single copy region

SSC= small single copy region

Genes Encoded in the Chloroplast Genomes in Higher Plants


Gene Designation





Gene Product



I. Genetic System


Chloroplast RNA genes


rDNA





Ribosomal RNAs (16S, 23S, 4.5S, 5S)


trn




Transfer RNAs (30 species)


Gene transcription


rpoA, B, C



RNA polymerase
a
,
b
,
b
’ subunits


ssb




ssDNA
-
binding protein


Protein synthesis


rps2,3,4,7,8,11



30S ribosomal proteins (CS) 2, 3, 4, 7, 8, 11


rps12, 14, 15, 16, 18, 19


CS12, 14, 16, 18, 19


rpl2, 14, 16, 20, 22



50S ribosomal proteins (CL) 2, 14, 16, 20, 22


infA




Initiation factor I


II. Photosynthesis


Photosynthetic proteins


rbcL




RUBISCO large subunit


atpA, B, E



ATP synthetase CF1
a
,
b
,
e

subunits


atpF, H, I



ATP synthetase CF
0
I, III, IV subunits


psaA, B, C



Photosystem I A1, A2, 9
-
kDa protein



psbA, B, C, D, E



Photosystem II D1, 51 kDa, 44 kDa, D2, Cytb559
-
9kDa


psbF, G, H, I



Photosystem II Cytb559
-
4kDa, G, 10Pi, I proteins


petA, B, D



Electron transport Cytf, Cytb6, IV subunits


Respiratory proteins


ndhA, B, C, D



NADH dehydrogenase (ND) subunits 1, 2, 3, 4


ndhE, F




NDL4L, 5


III. Others



Maturase




matK


Protease




clpP


Envelope membrane protein


cemA


Organization of chloroplast genes into operons

psbB

psbT

psbH

petB

Intron

Intron

petD

psbN

Polycistronic mRNA

Monocistronic
mRNA

The Endosymbiont Theory

Common ancestor of plastid

and modern cyanobacteria

Common ancestor of mitochondira

and
a
-
group of modern

proteobacteria

Protoeukaryotic cell

Photosynthetic eukaryotic cell

Flowering plant

Photosynthetic

C
-
reduction

Respiration

The Endosymbiont Theory

Supporting Evidences


1. Molecular architecture and genome replication


a) Plastid genomes are naked covalently closed circular DNA molecules (devoid of

histones).



b) Replication of plastid DNA is independent of the nuclear genome replication



c) Promoters of most chloroplast genes contain DNA sequences similar to the E. coli ‘
-

10’ and ‘
-
35’ promoter motifs.



d) Chloroplast open reading frames are polycistronic.



e) Plastid genomes contain few moderately or highly repetitive sequences



f) Chloroplast genomes of Euglena, Chlamydomonas and most angiosperms carry 2 or 3

rRNA genes which are similar in size to their prokaryotic homologs (23S, 16S, 5S)


Chloroplast promoters

psbA TTGGTTGACATGGC
TATATAA
GTCATGTTATACTGTTCAAT


psbA TTGGTTGACACGGGCA
TATAA
GGCATGTTATACTGTTGAAT


rbcL TGGGTTGCGCCA
TATATA
TGAAAGAGTATACAATAATGATG


atpB TCTTGACAGTGG
TATAT
GTTGTATATGTATATCCTAGATGT


trnM TTATATTGCTTA
TATATAA
TATTTGATTTATAATCAATCTA


Mustard

Spinach


-
35”


-
10”

1) Chloroplast promoters
-

similar to bacterial minimal promoter.

psbA TTGGTTGACATGGC
TATATAA
GTCATGTTATACTGTTCAAT


psbA TTGGTTGACACGGGCA
TATAA
GGCATGTTATACTGTTGAAT


rbcL TGGGTTGCGCCA
TATATA
TGAAAGAGTATACAATAATGATG


atpB TCTTGACAGTGG
TATAT
GTTGTATATGTATATCCTAGATGT


trnM TTATATTGCTTA
TATATAA
TATTTGATTTATAATCAATCTA


Mustard

Spinach


-
35”


-
10”

Features of chloroplast transcription

2) Polycistronic.


3) Cis
-
elements located in the 5’
-
UTR.


4) Nuclear
-
encoded transcription factors.

Features of chloroplast translation (similar to prokaryotic
translation)


1) Makes use of 70S ribosomes.


2) Uses fMet
-
initiator tRNA for the translation initiation codon.


3) The mRNAs are not capped.


4) The mRNAs are not poly
-
adenylated.


5) Ribosome binding occur in Shine
-
Delgarno
-
like sequence motif in the


5’
-
UT of mRNA.


6) Not coupled to transcription and trnaslational units can occur as stable


ribonucleoprotein complexes.


The Endosymbiont Theory (cont.)

Supporting Evidences


2) Transcription


a) RNA polymerases from cyanobacteria (e.g. Chlamydomonas) and higher plants (e.g.
maize) are more similar to the eubacterial than to the nuclear homologs.



b) Genes encoding for proteins of related functions are organized into operons and
thus are co
-
transcribed.



c) The limiting regulatory step of gene expression is at post
-
transcriptional and
translational level.



d) Transcription terminators are more similar to bacterial sequences.



d) A minor fraction of chloroplast mRNAs are polyadenylated.





The Endosymbiont Theory (cont.)

Supporting Evidences


3) Translation



a) Plastid ribosomes are more similar to prokaryotic ribosomes than to their
cytoplasmic counterparts:



cytoplasmic ribosomes
-

80S (40S + 60S subunits)




Plastid and prokaryotic ribosomes
-

70S (30S + 50S subunits)







Antibodies raised against 70S and 30S






subunits of plastid ribosomes are active






against E. coli



b) Plastid ribosomal RNA gene sequences are more similar to modern cyanobacteria


(e.g. Synechococcus lividus) than to their nuclear counterparts.



The Endosymbiont Theory (cont.)

Supporting Evidences


4) Others (biflagellate protists)


The case of Cyanophora paradoxa (and other types of marine nudibrachs or sea slugs)



Endosymbiotic

Cyanobacterium

Photosynthetic

Cyanelle

Cyanophora paradoxa

Plastid transformation

Basic Requirements:

1)
Method of delivery (Biolistic method)












2)
Selectable marker (dominant marker)


Firing pin

Helium gas

Nylon macro
-
projectile

Micro
-
projectile

DNA
-
coated gold particles

Vents

Plate to stop

nylon projectile

Target cells

or tissues

3”
-
adenylyltransferase

(aadA)

Spectinomycin


inhibits protein biosynthesis (70S ribosomes)

Spectinomycin Adenylylspectinomycin (inactive protein synthesis inhibitor)

AMP

Construct:


-
35” “
-
10” 5’
-
UTR SD aadA
-
ORF 3’
-
UTR

First successful
plastid
transformation was
reported in 1988 for
chlamydomonas.
Then in 1990 for
tobacco. Since
then only tomato
has been added to
the list of
reproducible
systems, though
reports exist for
cotton, wheat etc.

A transformed plastid genome is formed by

two recombination events that are targeted by

homologous sequences. The plastid genome

segments that are included in the vector are

marked as the left (LTR) and right targeting

regions (RTR).

Chloroplast Genetic Engineering

Prokaryotic


No need for codon optimization

10, 000 copies per cell


high expression

Maternal inheritance

Not expressed in fruits ?

Multigene engineering

Homologous recombination

Advantages of Chloroplast

Transformation

Gene

Containment

Maternal

Inheritance

No Gene

Silencing

No Position

Effect

Hyper
-

expression

Multigene

Engineering

No Vector

Sequences

No

Pleiotropic

Effects

Cry2Aa2 Single Gene Expression

0

0.05

0.1

0.15

0.2

0.25

0.3

0.35

0.4

Control


young


mature


old

Transgenic Leaf Age

% Total Soluble Protein

Cry2Aa2 Operon Expression

0

10

20

30

40

50

Control


young


mature


old

Transgenic Leaf Age

% Total Soluble Protein

A.

B.

100 fold higher expression obtained by plastid transformation (B)
compared to nuclear transformation (A)

Accelerated gold particle

coated with transforming DNA

~10,000 plastid

genomes/cell

Primary plastid

transformation

event (change
of

single plastid
DNA

molecule)

Cell and
organelle

divisions under

antibiotic
selection

(heteroplasmy)

Several cycles
of


antibiotic
selection

(homoplasmy)

Heteroplasmy vs homoplasmy

nucleus

chloroplast

proplastid

sorting

biogenesis


Selection of transplastomic clones by spectinomycin
resistance. (
A
) Spectinomycin inhibits callus formation,
greening, and shoot regeneration from tobacco leaf
segments on shoot regeneration medium.
Transplastomic clones are resistant to spectinomycin
and are identified as green shoots or calli. (
B
) The
shoots are chimeric, visualized by accumulation of
green fluorescent protein in transplastomic sectors.
Spectinomycin resistance is not cell autonomous as
sensitive sectors are also green. (
C
) Spontaneous
spectinomycin resistant mutants are sensitive (
top
),
transplastomic clones are resistant to streptomycin
(
bottom
) when cultured on a selective streptomycin
(500 mg/L) medium.


Comparison of the nuclear and plastid genomes of angiosperms





Nuclear genome


Plastid genome


Chromosomes


Two copies of each of


~60 copies of a single circular




many chromosomes;

chromosome per plastid




the number of


~50

60 chloroplasts per cell




chromosomes per




diploid cell is species




-
specific

Genes per chromosome

Could be thousands



~120

150


Arrangement and


Each gene is separate

Many genes are in operons
transcription of genes


(individually transcribed )

(transcribed together)

Currently known primary markers are resistance to spectinomycin, streptomycin, and
kanamycin, which inhibit protein synthesis on prokaryotic
-
type plastid ribosomes.
These antibiotics inhibit greening, cell division, and shoot formation in tobacco culture.
Therefore, greening, faster proliferation, and shoot formation were used to identify
transplastomic clones on a selective medium. The first transplastomic clones were
obtained by spectinomycin selection. Because spectinomycin allows slow proliferation
of nontransformed tobacco cells it was assumed that the choice of a drug that enables
such "nonlethal" selection is important to recover transplastomic clones. However,
transplastomic clones were soon identified by kanamycin selection using an antibiotic
concentration that is considered "lethal" (50 mg/L). Thus, slow proliferation of
nontransformed cells on a selective medium is not an essential feature of the selection
scheme. Initial transformation vectors carried a plastid 16S rRNA (
rrn16
) gene with
point mutations that prevent binding of spectinomycin or streptomycin to the 16S rRNA.
The
rrn16

target site mutations are recessive, and were 100
-
fold less efficient than the
currently used dominant
aadA

gene. Streptomycin resistance encoded in the
rps12

ribosomal protein gene was also included in an early vector. The
neo

(
aph(3')IIa
) gene
encodes neomycin phosphotransferase II [NPTII; APH(3')
-
II], and was used to select
transplastomic clones in tobacco. The
aphA
-
6 gene encodes aminoglycoside
phosphotransferase or APH(3')
-
VI, and was used to select transplastomic clones by
kanamycin and amikamycin resistance in
Chlamydomonas

and by kanamycin
resistance in tobacco. Direct selection for spectinomycin resistance and for highly
expressed kanamycin resistance genes, on average, yield one transplastomic line in a
bombarded leaf sample.

Selection markers

Most of the lecture material is derived from:


1.
Pal Maliga (2004) PLASTID TRANSFORMATION IN HIGHER PLANTS. Annual
Review of Plant Biology. 55: 289
-
313.


2.
Pal Maliga (2002) Engineering the plastid genome of higher plants. Current
Opinion in Plant Biology 2002, 5:164

172