Foundations of Biology - Circle

roachavocadoΒιοτεχνολογία

14 Δεκ 2012 (πριν από 4 χρόνια και 10 μήνες)

161 εμφανίσεις

©2000 Timothy G. Standish

Genetic
Engineering

Timothy G. Standish, Ph. D.

©2000 Timothy G. Standish

Genetic Engineering

Genetic engineering involves taking fragments of
DNA and manipulating them using enzymes and in
other ways to make new genetic constructs

The “recombinant” DNA made during genetic
engineering can be inserted into organisms to
change their genetic make up

In the transformation experiment you have been
doing, you have inserted a recombinant piece of
DNA called the pBLU plasmid into bacteria. On
that pBLU plasmid is the
lacZ

gene and a gene for
antibiotic resistance both of which the bacteria
lacked before you put them into it

©2000 Timothy G. Standish

Vectors

If a fragment of DNA is ligated into an appropriate
vector, it can be inserted into cells which will then
make many copies of it

Vectors are typically plasmids or viruses that have
been engineered to both accept DNA insertions and
reproduce inside cells

Cloning is the process of inserting DNA encoding
a gene of interest into a vector, then establishing it
as a stable part of a cell line.

©2000 Timothy G. Standish

2,686 bp

pUC 18

A Typical Plasmid

Lac Z

Gene

Multiple Cloning

Site

aagcttgcatgcctgcaggtcgactctagaggatccccgggtaccgagctcgaattc

HindIII SphI PstI SalI XbaI BamHI XmaI KpnI SstI EcoRI


AccI SmaI BanII


HincII


BspMI

Origin

of Replication

Amp
r

Gene

©2000 Timothy G. Standish

pUC 18 Sequence


tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcaggg
cgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgt
aaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaaggg
ggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgcc
aagcttgcatgcctgcaggtcgactctaga
ggatccccgggtaccgagctcgaattc
gtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtg
taaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggcca
acgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaa
ggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctgg
cgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctg
gaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcaaagctcacgctgtaggtatct
cagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaa
gacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctaca
ctagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttt
tgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggatttt
ggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaa
tcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgc
tgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcct
ccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgttt
ggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagt
aagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattct
gagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcg
gggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagc
aaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgt
ctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatga
cattaacctataaaaataggcgtatcacgaggccctttcgtc

©
2000
Timothy G. Standish

G

CTTAA

AATTC

G

1 Digestion

2 Annealing of sticky ends

3 Ligation

Ligase

G

CTTAA

AATTC

G

EcoRI

EcoRI

R. E.s and DNA Ligase

Can be used to make recombinant DNA

GAATTC

CTTAAG

GAATTC

CTTAAG

G

CTTAA

AATTC

G

4
Recombinant DNA

©
2000
Timothy G. Standish

Host Cell

Cloning Into pUC18

pUC18

LacZ

Amp
r

R. E.

Digestion

Addition of ligase
joins nicks and
makes a single
recombinant
plasmind

R. E.

Digestion

Matching sticky


ends anneal

Transf
ormation

of cell
s with the
rec
ombinant
plasmid

©2000 Timothy G. Standish

So How Do You Know If

You Cloned Something?

IPTG

-

Induces
expression of
lacZ

X
-
Gal

-

A lactose analog
which turns blue when
split by
b
-
galactosidase

Ampicillin

-

Kills all
bacteria that lack the
plasmid

©
2000
Timothy G. Standish

X
-
Gal

5
-
Bromo
-
4
-
chloro
-
3
-
indolyl
b
-
D
-
galactopyranoside

OH

O

OH

HOCH
2

HO

Glucose

O

O

OH

HOCH
2

HO

HO

Galactose

Lactose

O
-
b
-
D
-
galactopyranosyl
-
(1
-
>4)
-
b
-
D
-
glucopyranose

©
2000
Timothy G. Standish

b
-
Galactosidease

Lac Z

gene product

X
-
Gal

5
-
Bromo
-
4
-
chloro
-
3
-
indolyl
b
-
D
-
galactopyranoside

N

H

Br

Cl

O

O

OH

HOCH
2

HO

HO

Galactose

X
-
Gal

(Colorless)

H
2
O

©
2000
Timothy G. Standish

b
-
Galactosidease

X
-
Gal

5
-
Bromo
-
4
-
chloro
-
3
-
indolyl
b
-
D
-
galactopyranoside

OH

O

OH

HOCH
2

HO

HO

Galactose

Blue

N

H

Br

Cl

HO

©2000 Timothy G. Standish

So How Do You Know If

You Cloned Something?

Blue colonies

-

Express
b
-
galatosidase
which metabolizes colorles X
-
gal to blue
and turn blue thus lacZ is not disrupted
and there is no foreign DNA cloned

Cloned fragments

disrupt lacZ thus make
no b
-
galactosidase and
colonies remain white

IPTG

-

Induces
expression of
lacZ

X
-
Gal

-

A lactose analog
which turns blue when
split by
b
-
galactosidase

Ampicillin

-

Kills all
bacteria that lack the
plasmid

©2000 Timothy G. Standish

Libraries

If all the DNA from an organism is digested with a
restriction enzyme and cloned into a plasmid, many
different recombinant plasmids will be made, each with a
different fragment of DNA cloned into it

Once inserted into host cells or viruses, this collection of
many different recombinant plasmids is called a “library”

When the whole genome of an organism is used as the
starting point for cloning, it is called a “shotgun clone”

A library constructed using shotgun cloning may contain
hundreds of thousands of different recombinant plasmids

Screening is the process of sifting through the library to
find the clone of interest

©2000 Timothy G. Standish

A Library

The clone of interest

©2000 Timothy G. Standish

Library Screening

Libraries tend to have a lot of clones only one of which
has the sequence of interest

Screening a library is the process of eliminating those
clones that do not contain the sequence of interest and
locating the clone that does

There two major techniques are used for screening:

Hybridization screening
-

In which DNA from a library
is bound to a membrane, then the membrane is exposed
to a probe that should base pair (hybridize) to the
sequence of interest

Expression vectors may be used so that if the gene for a
protein is cloned, the protein is made. To do this, you
must be able to detect the protein

©2000 Timothy G. Standish

cDNA Libraries

Because of the large size of libraries and the tedium of
screening, anything that can be done to limit library size
is a good thing

Protein coding regions of most eukaryotic genomes
make up only a small percentage of the total DNA (
3
%
in humans)

Most cells only express a small subset of an organism’s
genes

By using reverse transcriptase, a cDNA copies of the
mRNA being produced in a group of cells can be made

Cloning cDNA to make a library produces a much
smaller library enriched with the part of an organism’s
genome that is of most interest

©
2000
Timothy G. Standish

Rev.

Trans.

TTTTTTTTTTTT
5


5’

cDNA Library Construction

TTTTTTTTTTTT5’

TTTTTTTTTTTT
5


5’

cDNA after RNase treatment

AAAAAAAAAAA
3


5


mRNA

AAAAAAAAAAA3’

5’

mRNA

cDNA

hy
bri
d

Insert into vector

AAAAAAAAAAA
3


5


Reverse transcription

TTTTTTTTTTTT5’

5’

Double stranded cDNA after DNA polymerase

RN

ase

AAAAAAAAAAA
3


5’

DNA

Pol

©
2000
Timothy G. Standish



©2000 Timothy G. Standish

An Expression Vector

II

II

I

AatII

pPROTet.E

SacI

t
0

Myc tag

EK site

MCS

ColE
1

Cm
r

XbaI

T1


pPROTet.E is a
commercially
available plasmid sold
by Clontech


It is specifically
designed to allow
efficient control of
expression