30Biotech2007. ppt - Explore Biology

rapidparentΒιοτεχνολογία

12 Δεκ 2012 (πριν από 4 χρόνια και 9 μήνες)

188 εμφανίσεις

Regents Biology

2006
-
2007

Genetic Engineering

Biotechnology

Regents Biology

We have been manipulating DNA
for generations!


Artificial breeding


creating new breeds of animals & new
crop plants to improve our food

Regents Biology

Animal breeding

Regents Biology

Breeding food plants


“Descendants” of the wild mustard


the “Cabbage family”

Regents Biology

Breeding food plants

Evolution of
modern corn

(right) from
ancestral
teosinte

(left).

Regents Biology

A Brave New World

Regents Biology

The code is universal


Since all living
organisms…


use the same DNA


use the same code
book


read their genes
the same way

Regents Biology

TACGCACATTTACGTACGCGGATGCCGCGACT
ATGATCACATAGACATGCTGTCAGCTCTAGTAG
ACTAGCTGACTCGACTAGCATGATCGATCAGC
TACATGCTAGCACACYCGTACATCGATCCTGA
CATCGACCTGCTCGTACATGCTACTAGCTACTG
ACTCATGATCCAGATCACTGAAACCCTAGATC
GGGTACCTATTACAGTACGATCATCCGATCAGA
TCATGCTAGTACATCGATCGATACTGCTACTGA
TCTAGCTCAATCAAACTCTTTTTGCATCATGAT
ACTAGACTAGCTGACTGATCATGACTCTGATCC
CGTAGATCGGGTACCTATTACAGTACGATCATC
CGATCAGATCATGCTAGTACATCGATCGATACT
GCTACTGATCTAGCTCAATCAAACTCTTTTTGC
ATCATGATACTAGACTAGCTGACTGATCATGAC
TCTGATCCCGTAGATCGGGTACCTATTACAGTA
CGATCATCCGATCAGATCATGCTAGTACATCGA
TCGATACT

human genome

3.2 billion bases

Regents Biology

Can we mix genes from one creature
to another?

YES
!

Regents Biology

Mixing genes for medicine…


Allowing organisms to produce new
proteins


bacteria producing
human insulin


bacteria producing
human growth hormone

Regents Biology

How do we do mix genes?


Genetic engineering


find gene


cut

DNA in both organisms


paste

gene from one creature into other
creature’s DNA


insert

new chromosome into organism


organism
copies

new gene as if it were its
own


organism
reads

gene as if it were its own


organism produces NEW protein
:

Remember: we all use the same genetic code!

Regents Biology

Cutting DNA


DNA “scissors”


enzymes that cut DNA


restriction enzymes


used by bacteria to cut up DNA of

attacking viruses


EcoRI, HindIII, BamHI


cut DNA at specific sites


enzymes look for specific base sequences

GTAAC
GAATTC
ACGC
TT

CATTG
CTTAAG
TGCG
AA

GTAAC
G
|
AATTC
ACGC
TT

CATTG
CTTAA
|
G
TGCG
AA

Regents Biology

Restriction enzymes


Cut DNA at specific sites


leave “sticky ends”

GTAAC
G AATTC
ACGCTT

CATTG
CTTAA G
TGCGAA

GTAAC
GAATTC
ACGC
TT

CATTG
CTTAAG
TGCG
AA

restriction enzyme cut site

restriction enzyme cut site

Regents Biology

Sticky ends


Cut other DNA with same enzymes


leave “sticky ends” on both


can glue DNA together at “sticky ends”


GTAAC
G AATTC
ACGCTT

CATTG
CTTAA G
TGCGAA

gene

you want

GGACCT
G AATTC
CGGATA

CCTGGA
CTTAA G
GCCTAT

chromosome

want to add

gene to

GGACCT
G AATTC
ACGCTT

CCTGGA
CTTAA G
TGCGAA

combined

DNA

Regents Biology

Sticky ends help glue genes together

TTGTAAC
GAATTC
TACGAATGGTTACATCGCC
GAATTC
A
CGCTT

AACATTG
CTTAAG
ATGCTTACCAATGTAGCGG
CTTAAG
T
GCGAA

gene you want

cut sites

cut sites

AATGGTTACTTGTAAC
G
AATTC
TACGATCGCCGATTCAACGCTT

TTACCAATGAACATTG
CTTAA
G
ATGCTAGCGGCTAAGTTGCGAA

chromosome want to add gene to

cut sites

AATTC
TACGAATGGTTACATCGCC
G


G
ATGCTTACCAATGTAGCGG
CTTAA

isolated gene

sticky ends

chromosome with new gene added

TAAC
GAATTC
TACGAATGGTTACATCGCC
GAATTC
TACG
ATC

CATTG
CTTAAG
ATGCTTACCAATGTAGCGG
CTTAAG
ATG
CTAGC

sticky ends stick together

DNA
ligase

joins the strands

Recombinant

DNA molecule

Regents Biology

Why mix genes together?

TAAC
GAATTC
TACGAATGGTTACATCGCC
GAATTC
TACG
ATC

CATTG
CTTAAG
ATGCTTACCAATGTAGCGG
CTTAAG
ATG
CTAGC


Gene produces protein in different
organism or different individual

aa

aa

aa

aa

aa

aa

aa

aa

aa

aa

“new” protein from organism

ex:

human insulin from bacteria

human insulin gene in bacteria

bacteria

human insulin

How can

bacteria read

human DNA?

Regents Biology

Uses of genetic engineering


Genetically modified organisms (GMO)


enabling plants to produce new proteins


Protect crops from insects
:
BT corn



corn produces a bacterial toxin that kills corn
borer (caterpillar pest of corn)


Extend growing season
:
fishberries



strawberries with an anti
-
freezing gene from
flounder


Improve quality of food
:
golden rice



rice producing vitamin A

improves nutritional value

Regents Biology

Bacteria


Bacteria are great!


one
-
celled organisms


reproduce by mitosis


easy to grow, fast to grow


generation every ~20 minutes

Regents Biology

Bacterial DNA


Single circular chromosome


only one copy = haploid


no nucleus


Other DNA = plasmids
!

bacteria

chromosome

plasmids

Regents Biology

There’s more…


Plasmids


small extra circles of DNA


carry extra genes that bacteria can use


can be swapped between bacteria


bacterial sex!!


rapid evolution =
antibiotic resistance


can be picked up

from environment

Regents Biology

How can plasmids help us?


A way to get genes into bacteria easily


insert new gene into plasmid


insert plasmid into bacteria =
vector


bacteria now expresses new gene


bacteria make new protein

+

transformed

bacteria

gene from

other organism

plasmid

cut DNA

recombinant

plasmid

vector

glue DNA

Regents Biology

Grow bacteria…make more

grow

bacteria

harvest (purify)

protein

transformed

bacteria

plasmid

gene from

other organism

+

recombinant

plasmid

vector

Regents Biology

Applications of biotechnology

Regents Biology

2006
-
2007

I’m a very special pig
!

Got any Questions?