Improvement of silymarin production in hairy root ... - Rombio.eu

portertoaststicksΒιοτεχνολογία

23 Οκτ 2013 (πριν από 3 χρόνια και 5 μήνες)

201 εμφανίσεις













Improvement of silymarin production in hairy root cultures of
Silybum
1

marianum
(L.) Gaertn

using fungal elicitors

2


3

Received for publication,
December 1
, 201
2


4

Accepted,
January 3
, 201
3

5


6

TAHEREH HASANLOO
1*
, MASUMEH AHMADI
1AND 2
, SEYYED MOJTABA
7

KHAYYAM NEKOEI
3

AND GHOLAMREZA SALEHI JOUZANI
3

8

1
Department of Molecular Physiology, Agricultural Biotechnology Research Institute of Iran
9

(ABRII), Karaj, Iran

10

2
Department

of Horticulture, Faculty of Agriculture, Islamic Azad University, Karaj, Iran

11

3
Department of Microbial Biotechnology and Biosafety, Agricultural Biotechnology Research
12

Institute of Iran (ABRII), Karaj, Iran

13

*Address correspondence to: Agricultural Biotechnology Research Institute of Iran, Mahdasht
14

Road, P. O. Box 31535
-
1897, Karaj, Iran.

15

Tel.: +98 26 32702893; Fax: +98 26 32704539; Email:
thasanloo@abrii.ac.ir

16


17

Ab
stract

18

The objective of the present study was to enhance
silymarin production in hairy root cultures
19

of
Silybum marianum
(L.) Gaertn using fungal elicitors
. T
he effects of
different concentrations of the
20

fungal elicitors (0, 10 and 20 mg
/50 m
l

culture
),

including
Fusarium

proliferatum,

Aspergillus niger
,
21

and
Rhizoctonia solani
, were studied on silymarin production in
the
S.
marianum

hairy root cultures.
22

The hairy roots were harvested 0, 24, 48 and 72 h

after inoculations
. Detection and identification of
23

f
lavonolignans was carried out by high performance liquid chromatography method.
The maximum
24

s
ilymarin production

for each of the fungi treatments

were
as follow:
10 mg
A. niger
/ 50 ml culture

25

(0.18 mg/g DW)

after 48 h,
20 mg/ 50 ml culture

F. proliferatum

(0.34 mg/g
DW)

and
20 mg
R. solani

26

(0.22

mg/
g DW)

after 72 h
.
T
he
flavonolignans of hairy roots treated with
F. proliferatum

included
27

taxifoline (0.068
mg/g DW
), silydianin (0.11
mg/g DW
), silybin (0.021
mg/g DW
) and isosilybin (0.015
28

mg/g DW
)
which were
respectively

1.94, 1.19, 2.62 and 1.25 fold greater than that
the
untreated
29

cultures.
The
results indicated that the
type of fungi, their concentration
s

and exposure time have
30

significant effect on the stimulation of
silymarin production.

31


32

Keywords
:

Aspergillus niger
,
Fusarium proliferatum
;
Hairy root culture,

Rhizoctonia solani;
Silybum
33

marianum,
Silymarin
.

34


35


36

1.

Introduction

37

The dried fruits of
Silybum marianum

L. (milk thistle) have

been used for the
38

treatment of hepatic and biliary diseases since anci
ent times (
1
).
I
ts active compounds
39

(
silymarin
)
have been identified from 1952 (
1, 2
).

S
ilymarin

is composed of an mixture of the
40

flavonolignans, silychristin (S
C
), isosilychristin

(ISC)
, silydianin (S
D
), silybin (S
B
) A and B,
41

and isosilybin (IS
B
) A and B with the precursor flavonoid taxifolin (T
XF
) (
3, 4
).

42

Plant cells have been considered to be producers of secondary metabolites. Recently,
43

the transformed root cultures have been offer
ed

additional advantages such as rapid growth,
44

uniformity, gen
etic stability and high biosynthetic capacity.
Commonly, h
airy roots are
45

formed by genetic transformation of plant cell using
Agrobacterium rhizogenes

(
5, 6
).

46

Usually the production of secondary metabolites remained low in tissue cultures
, so,

47

elicitation techniques have been employed to improve the production of bioactive molecules.
48

Elicitors are compounds of mainly biotic or abiotic origin, which upon contact with higher
49

plant cells

and

trigger the increased production of bioactive molecules
and other defense
50

related compounds (
7
).

51

Previously, we showed that
cell and hairy root cultures of
S
.

marianum

synthesize
52

flovonolignanes, but the amount of these
produced
compounds is less than that obtained from
53

the intact plant. Therefore elicitation s
trategies have been investigated to try and enhance the
54

production of flovonolignanes in
S
.

marianum

cell and hairy root cultures (
8,

9,

10,

and 11
).

55

Previous studies have reported
i
mprovement of metabolite production by
different
56

fungal elicitors
Phytoph
tora megasperma
(12) and

Aspergillus niger

(13)
in hairy root
57

cultures
.

58

The production of phytoalexin was
enhanced

in suspension cultures of carrot by
A
.

59

niger
and
F
.

moniliforme
(
14
). The suspension cultures of periwinkle treated with either
A.
60

niger
and
Rhizopus
or
Trichoderma viride
increased the intracellular accumulation of
61

tryptamine (
15
). Chitosan stimulation of anthraquinone synthesis in
Rubia tinctorum
reported
62

by Vasconsuelo et al., (1996)

(16)
. Liu et al., (1997) showed that artemisinin produ
ction was
63

increased to 550
/
L

when the cultures of
Artemisia annua

L
.

hairy root were elicited with a
64

homogenate of
A
.

oryzae

(17)
.
An increase of 150% in tabersonine specific yield was
65

observed upon addition of 72 units of pectinase in
Catharanthus roseu
s
hairy root cultures by
66

Rijhwani and Shanks
(1998)

(18)
. Liu et al. (1999) reported that elicitors derived from
67

mycelia extracts of
Penicillium chysogenum

enhanced artemisinin production in hairy roots
68

of
Artemisia annua

1.2
-
fold higher than that of the c
ontrol experiment

(19)
. Wang et al.,
69

(200
2
) demonstrated that
a
rtemisinin content in hairy roots of
Artemisia annua
increased
70

from 0.8 mg
/
g
DW
to 1 mg
/
g

DW

by using elicitor treatment of mycelial extracts from the
71

endophytic fungus
Colletotrichum
sp

(20)
. Zhao et al (2001) studied
p
roduction of a novel
72

antimicrobial tropolone, beta
-
thujaplicin, in
Cupressus lusitanica

suspension cultures.
73

Significantly improved beta
-
thujaplicin production (187 mg
/
L
) was obtained using fungal
74

elicitor treatment in a produc
tion medium

(21)
. Upon elicitation with fungal cell wall elicitors
75

from
Phytophthora cinnamoni
, the production of
r
osmarinic acid (
RA
)

was enhanced 2.67
-
76

fold compared with the untreated control (
22
). The elicitation of the
opium poppy

cell
77

cultures by fung
al preparation lead to a nine
-
fold increase in the content of sanguinarine (
23
).
78

A crude extract from
F
.

oxysprum

caused significant cell apoptosis in suspension cultures of
79

Taxus chinensis

var. mairei. The maximum concentration of taxol was three times hi
gher than
80

that of the control. Cell apoptosis and taxol production are closely relevant in elicitor
-
treated
81

culture of
T. chinensis

var. mairei (
24
). Hairy root cultures of
Cichorium intybus
L. produced
82

volatile aromatic compounds under the influence of fu
ngal elicitors. It was observed that the
83

intensity of the production of volatile aromatic compounds in the hairy root cultures of
C.
84

intybus
with 10 ml
L
-
1
media filtrate (MF) of
Phytopthora parasitica
var
nicotiana
reached a
85

maximum on the 21st day (
25
).
Lu et al (2003) showed when, on the 15th day of growth, an
86

elicitor from
F
.

solani

was added at 40 mg
/
L
to
Cistanche deserticola

cell suspension
87

cultures, the contents of echinacoside, acteoside and total phenylethanoid glycosides (PeGs
)
88

in cultured cells all increased over the next 27
days

by over 100% to 15 mg
/
g DW, 9 mg
/
g

89

DW and 57 mg
/
g

DW, respectively. The final biomass (1.3 mg DW
/
ml) was not affected

90

(26)
.

The accumulation of baicalin in transformed hairy roots was enhanced through

exposure
91

to various elicitors. Elicitation was attained by the addition of methyl jasmonate, salicylic
92

acid and various concentrations of fungal cell wall elicitors to the medium. The accumulation
93

of baicalin in the elicited cultures ranged from 10.5 to 1
8.3 mg
/
g
DW

of the roots, which was
94

1.5
-

to 3
-
fold the amount attained in controls (
27
). Artemisinin production by hairy roots of
95

Artemisia annua

was increased 6
-
fold to 1.8

μg
/
mg

DW
over 6

days by adding 150

/
96

L
chitosan

(
28
).
Hasanloo et al., (2009) sugge
sted that reactive oxygen species may mediate
97

yeast extract elicitor signals to jasmonate pathway that lead to the production of silymarin

in
98

S. mar
ianum

hairy root cultures

(10)
.
Ajungla et al., (2009) established root cultures of
99

Datura metel

and studied the influence of biotic (
A
.

niger, Alternaria
sp.,
F
.

monoliforme

and
100

yeast extract) and abiotic (salicylic acid, AlCl
3
, CaCl
2
, NaCl and Na
2
SO
4
) elicitors on the
101

growth and production of hyoscyamine and scopolamine. The highest hyoscyamine (4.
35
102

mg
/
g DW
) and scopolamine (0.28
mg
/
g DW
) accumulation was obtained in cultures treated
103

with 500 μ
M

salicylic acid, followed by treatment with 0.75 g
/ L

yeast extract (3.17
mg
/
g
104

DW

hyoscyamine & 0.16
mg
/
g DW

scopolamine)

(29)
.
Zheng

et al., (2009)

report
ed multiple
105

responses of

Inonotus obliquus

cells in media supplemented by fungal elicitor prepared from
106

the cell debris of the plant
-
pathogenic ascomycete
Alternaria alternate
.
Nitric oxide (
NO
)

107

mediates an elicitor
-
induced increase in production of antioxidant polyphenols in
I. obliquus

108

via a signalling pathway independent of oxylipins or
jasmonic acid

(JA)
, a mechanism which
109

differs from those in some higher plants

(30)
. Lu et al (2011) demonst
rated that nitrate
110

reductase (NR) is involved in the fungal elicitor
-
triggered NO generation and the fungal
111

elicitor induces camptothecin production of
Camptotheca

acuminata

cells dependently on
112

NR
-
mediated NO generation

(31)
.

113

To the best of our knowledge
, no previous study has investigated the effects of
114

different fungal elicitors on
enhancement of silymarin productivity. Therefore,
the objective
115

of the present study was to evaluate effects of different types and concentrations of fungal
116

extracts on

sily
marin accumulation in
S. marianum
hairy root cultures.

117


118

2.

Material and methods

119


120

2.1.


Hairy root cultures

121

Hairy root culture of
S. marianum

was transformed by
Agrobacterium rhizogenes
122

(AR15834), and the genetic transformation of these hairy roots was confirmed by polymerase
123

chain reaction (PCR) according to the method described by Rahnama et al. (2008)

(8)
.
PCR
124

was performed for 35 thermal cycles (denaturation at 94

°
C for 1 min, primer

annealing at 53
125

°C for 1 min, and primer extension at 72 °C for 1 min) for
rol
B (forward primer 5´
-

126

ATGGATCCCAAATTGCTATTCCCCACGA
-
3' and reverse primer 5'
-

127

TTAGGCTTCTTTCATTCGGTTTACTGCAGC
-
3').
Hairy roots cultures were induced by
128

transferring six 1cm roots
to 50

ml of Murashige and Skoog liquid medium (MS)
129

supplemented with 30 g
/
L

sucrose in 150

ml flaks (
32
). All
the
experiment were carried out
130

on orbi
t
al shaker set at 150 rpm and incubated at 25

o
C in the dark.

131

2.2.

Preparation of elicitors

and elicitation

132

Three fungi, including
A.
niger
,

F. proliferatum

and

R
. solani were received from
133

Microbial Gene Bank of
Microbial Biotechnology and Biosafety Department of Agricultural
134

Biotechnology Research Institute of Iran.
The fungus elicitors were prepared according
to
135

the method previously described by
Chong et al., (2005)

(33)
.
The fung
i

w
ere

grown in liquid
136

potato/dextrose medium incubated on a rotary shaker (150 rpm) at 28
º
C and sub
-

cultured
137

every 2 weeks.

After 15 da
ys the mycelia were collected by filtration and homogenized. The
138

homogenate
s

w
ere

autoclaved and used as elicitor
at
different con
centrations

(0, 10 and 20
139

mg/ 50 ml culture media). The elicitors were added to 30
-
day
-
old hairy root cultures. For a
140

time cou
rse study, untreated and elicited hairy roots were harvested at different time intervals
141

(0, 24, 48 and 72 h) and then frozen immediately at
-
80 ºC for
the next
biochemical assay
s
.
142

Biomass was quantified by dry weight.

143

2.3.

Analytical procedures

144

Silymarin were

quantified by high performance liquid chromatography (HPLC)
145

analysis as described by Hasanloo et al. (2009)

(10)

on a
K
nauer liquid chromatography
146

equipped with a injector with a 20 μl loop, a Nucleosil

C18 5 μ (250 × 4.6 mm) column,
147

K2600A UV detector and Chromgate software for peak integration.
Hairy roots
were
148

harvested from the shake
-
flasks and dried by tissue paper. Lyophilized powdered hairy root
149

samples were measured in terms of DW. The samples we
re defatted with petroleum ether.
150

The flavonolignans were extracted from the dried residue with 10 ml of methanol at 40ºC for
151

8h. The methanolic solution was concentrated to a dry residue. The extract was dissolved in 2
152

ml of methanol and kept at 4º C in d
arkness
(
8
).

153

2.4.

Statistical analysis

154

The data were given as the mean of at least three replicates. Statistical analysis was
155

performed with SAS software (Version 6.2) using ANOVA method with Duncan test set at
156

ά≤ 0.05.

157


158

3.

Results

and

Discussion

159


160

3.1.

Growth and
silymarin production

161

Previously, we had optimized the process of b
iomass accumulation and silymarin
162

production

in
the
hairy root cultures of
S. marianum

in a 35 days period
(
11
)
.

The highest
163

biomass was
obtained at the end of the growth period (from 28 to 35 days after culture).
164

Silymarin content was
analyzed

over the culture period. The highest silymarin content was
165

observed after 28 days. Therefore,
treatments
were done 30 days after culture, when hairy

166

roots were in the maximum active growth phase.

167

3.2.

Influences of fungal elicitors on culture biomass and silymarin production

168

3.2.1.

F
.

proliferatum

169

Hairy root cultures (30 days old), were treated with three different concentrations

of

170

F. proliferatum
biomass
, inclu
ding
0, 10 and 20 mg/ 50 ml culture. A significant increase in
171

dry weight (DW) of
the
cultures was observed in media supplemented with 10 mg

F.
172

proliferatum
/ 50 ml culture and the highest biomass production (0.51 mg) was obtained 72 h
173

after elicitation wa
s

significantly

higher than the control (0.33 mg) (Fig. 1
A
). A
significant
174

reduction in DW was observed by the addition of 20 mg/ 50 ml culture
F. proliferatum
after
175

24, 48 and 72 h (0.29, 0.35 and 0.43 mg, respectively)

compared with media treated with 10

176

mg/ 50 ml culture
.The DW of non
-

treated hairy roots was not significantly changed after 24,
177

48 and 72 h (0.28, 0.30 and 0.33 mg, respectively). The time
course of the effect of
F.
178

proliferatum

on silymarin accumulation is

presented in (Fig.
1B
).
Silymarin accumulation in
179

non
-

treated hairy roots showed no significant changes after 24, 48 and 72 h (0.19, 0.17 and
180

0.21 mg, respectively). The timing of feeding had significant effect on the silymarin
181

accumulation in media treated with 20 mg/ 50 ml cul
ture
F. proliferatum.
The

silymarin
182

accumulation was increased and reached an extremely high level (0.34 mg
/
g DW) after 72 h
183

of treatment that was 1.61
-

fold higher than the control. The changes of
the
accumulated
184

silymarin after 48 h of treatment was simi
lar to those of silymarin accumulation in
the
period
185

of 72 h time
-

course study. The production of silymarin (0.27

mg
/
g DW) was also increased
186

after 48 h of treatment in media supplemented with 20 mg/ 50 ml culture
F. proliferatum,
187

being 1.58
-

fold higher
than the control (0.17

mg
/
g DW). The silymarin production of
the
188

treated hairy roots with 10 or 20 mg/ 50 ml culture (0.18 and 0.19 mg, respectively) was not
189

significantly changed after 24 h in compare with control (0.19 mg).

190

To determine which flavonolign
ans changes in
the
treated hairy root cultures, the extracted
191

silymarin quantified by HPLC analysis. The presence of silybin and isosilybin were detected.
192

The results showed that the hairy roots produced silybin, isosilybin, silychristin, silydianin
193

and ta
xifolin, which were similar to the compound reported by the dried fruits of
S.
194

marianum
.
A significantly

higher content of taxifolin (0.1 mg
/
g DW) was achieved after 72 h
195

in media treated with 10 mg/ 50 ml culture
F. proliferatum
that was 3.33
-

fold higher

than
196

control. Our results showed that silycristin and isosilybin content increased after 72 h. There
197

was a gradual decline in silydianin accumulation after 72 h.
S
ilybin production was slightly
198

enhanced over the culture period (Table 1). The flavonolignan
s analysis was also carried out
199

on hairy roots treated with 20 mg/ 50 ml culture
F. proliferatum.
Taxifolin and
s
ilydianin
200

content

r
i
se dramatically from 24 to 48 h (0.072 and 0.117 mg
/
g DW, respectively), but then
201

stabilized. Silycristin, silybin and isos
ilybin accumulation showed no significant changes

202

within the culture period.

203


B


A

204



205

Figure 1
.

The effects of different concentrations
of F
. proliferatum
(0, 10 and 20 mg
/50
ml

culture
) and
206

exposure time (0, 24, 48 and 72h) on biomass (A) and
silymarin (B) production in hairy root cultures of

S.

207

marianum.
Data show means ± SD from triplicate experiments.

208


209

3.2.2.

A
.

niger

210

The time course of the effect of
A
.

niger

on
the
hairy root growth and silymarin
211

content

are presented in Fig.
2
A and B. The DW of
non
-
treated hairy roots was slightly
212

increased after 24 h that reached to 0.38 g after 72 h. An enhancement in DW was observed
213

in media treated with 10 mg

A. niger
/ 50 ml culture

after 48 h (0.39 g), hitting a peak after 72
214

h (0.41

g
).
No significant
diff
erence was

found between

DW in media supplemented with 20
215

mg

A. niger

/ 50 ml culture (0.37 g)

after 24 h
and in

the control (0.
2
2 g).

Fig
.

2
A shows
216

silymarin content in hairy root cultures treated with 0, 10 and 20 mg/ 50 ml culture
A. niger
.
217

There was a
slight increase in silymarin content of non
-
treated hairy roots but then stabilized.
218

As it can be clearly seen the highest content of silymarin (0.18 mg
/
g DW) was obtained in
219

media treated with 10 mg/ 50 ml culture

after 48 h

which
was 1.51
-

fold higher th
an the
220

control but the trend was not upward and a dramatic fall observed in silymarin accumulation
221

(0.14 mg
/
g DW) after 72 h.

222

Table 2 compare the results obtained from the HPLC analysis of
A. niger
treated hairy root
223

cultures.

It can be seen from the data

in Table 2 that 48 h feeding time in media treated with
224

10 mg

A. niger

/ 50 ml culture reported significantly more taxifolin (0.071 mg
/
g DW) than
225

the other two groups.
The most striking result to emerge from the data is that silybin and
226

isosilybin content

(0.019 and 0.016 mg
/
g DW, respectively) had higher significant
227

accumulation in media supplemented with 10 mg

A. niger
/ 50 ml culture after 48 h that were
228

1.9 and 1.6
-

times
more than
that of the control (0.01 mg
/
g DW).
No significant differences
229

were obs
erved
between
A. niger
treated
and non
-

treated
hairy root cultures

in silycristin and
230

silydianin content for different exposure times (24, 48 and 72 h).

231

3.2.3.

R
.

solani

232

Fig
.

3
A

presents the results obtained from the DW of
R. solani

treated and non
-

233

treated hai
ry roots. From this data we can see that the highest DW
(0.5 g)
was obtained fr
om

234

cultures treated with 10 mg/ 50 ml culture

R. solani

after 72 h that was 1.
42
-
fold higher than
235

the control (0.3
5

g).
No significant differences were found between DW of
cultures treated
236

with 10 and 20 mg/ 50 ml culture

R. solani
after 24 h. The mean score for DW was 0.45 g

237

that was
1.5
-

fold
higher than the control. A rapid increase in DW of cultures elicited with 10
238

mg/ 50 ml culture was seen after 48 h (0.42 g) that was

1.57
-
times that of the control (0.28 g).
239

The DW content in 20 mg/ 50 ml culture treated media after 48 h was 0.407 g that was 1.45
-
240

times that of the control
(0.28 g).

241

0
0.1
0.2
0.3
0.4
0.5
0.6
0
24
48
72
Dry Weight(g)

Time after elicitation(h)

control
0
0.05
0.1
0.15
0.2
0.25
0.3
0.35
0.4
0
24
48
72
Silymarin Content(mg / g DW)

Time after elicitation(h)

control
F. proliferatum (10mg)
F. proliferatum (20mg)
A



242

A

B

243


244

Figure 2
.
The effects of different concentrations of
A.
niger (
0, 10 and 20 mg
/

50
ml

culture
) and exposure time
245

(0, 24, 48 and 72h) on biomass (A) and silymarin (B) production in hairy root cultures of

S. marianum.
Data
246

show means ± SD from triplicate
experiments.

247


248

A

B

249


250

Figure 3
.
The effects of different concentrations of
R. solani

(0, 10 and 20 mg
/

50
ml

culture
) and exposure
251

time (0, 24, 48 and 72h) on biomass (A) and
silymarin (B) production in hairy root cultures of

S. marianum.
252

Data show means ± SD from triplicate experiments.

253


254

No significant differences were found between
interactions of concentration and
255

feeding time of elicitation in total silymarin and flavonolig
nan content

(
F
ig. 3B)
.
There were
256

significant differences among
media treated with
different concentration of
R. solani
in

257

silybin and total silymarin.
From this data we can see that
feeding time had
significant effect
258

in total silymarin, silybin, silychri
stin and taxifolin.

The highest content of silymarin was
259

observed in media containing 20
mg/ 50 ml culture

R. solani
after 72 h.

260

The results obtained from the HPLC analysis of silymarin (flavonolifnans) extracted
261

from
R. solani

treated hairy roots are shown in table 3.

As can be seen from the table 3,
no
262

significant increase in taxifolin production was detected in treated hairy roots after 24 and 48
263

h. The more surprising enhancement is with the

R. solani

treated hairy roots (10

and 20
mg/
264

50 ml culture) after 72 h that were 1.79
-

fold higher than the control (0.034 mg
/
g DW). It is
265

apparent from this table that very few changes were observed in silychristin content in
R.
266

solani

treated and non
-

treated hairy roots. None of these
differences were statistically
267

significant.
As
t
able 3 shows, there is a significant difference between the two groups of
268

treatments (0 and 20 mg/ 50 ml culture) in different exposure times for silydianin production.

269


270

Silydianin
content in cultures
treated with 20 mg

R. solani

/ 50 ml culture was 0.037, 0.04
271

and 0.051 mg
/
g DW that were 1.1, 1.25 and 1.13
-

times that of the control, respectively.

The
272

-0.1
6E-16
0.1
0.2
0.3
0.4
0.5
0.6
0
24
48
72
Dry Weight(g)

Time after elicitation(h)

control
A. niger(10mg)
A. niger(20mg)
0
0.05
0.1
0.15
0.2
0.25
0.3
0.35
0.4
0
24
48
72
Silymarin Content(mg / g DW)

Time after elicitation (h)

control
A. niger (10mg)
A. niger (20mg)
0
0.1
0.2
0.3
0.4
0.5
0.6
0
24
48
72
Dry Weight (g)

Time after elicitation (h)

Control
R. solani (10mg)
R. solani (20mg)
0
0.05
0.1
0.15
0.2
0.25
0.3
0.35
0.4
0
24
48
72
Silymarin content (mg /g DW)

Time after elicitation (h)

Control
R. solani (10mg)
R. solani (20mg)
A

highest conten of silydianin (0.051 mg
/
g DW) was observed in media elicited with 20 mg

R.
273

solani
/ 50
ml culture after 72 h.

274

Elicitors induced accumulation of secondary metabolites have received wide
275

acceptance because of its ability to improve productivity of the plant tissue cultures
276

significantly (
20,

34,

and 35)
.

Elicitors can stimulate the synthesis
of plant metabolites or
277

induce accumulation of new secondary metabolite compounds; a specific eliciting effect of
278

fungal homogenates and fractions
therefore

has been widely documented

(
36,

21
)
.

279

The effects of fungal elicitor
s

dose and exposure time on the silymarin accumulation
280

of hairy root cultures of
S. marianum

were examined.
Our results show
ed

that the
281

accumulation of total silymarin and flavonolignans can be stimulated by a
fungal
elicitor.

282

These findings raise
a possibi
lity that some fungus could affect the secondary metabolism of
283

cultured tissues. From a biotechnological point of view, the increase of productivity after
284

elicitor treatment is of great practical value.

285

At the present study, it was shown
that
S. marianum

h
airy root cultures accumulated
286

considerable amounts of silymarin in response to treatment with
F. proliferatum
. For
287

maximum production of silymarin, the optimum period of elicitation was 72 h and the
288

optimum concentration of this fungal elicitor was 20 mg/

50 ml culture.

Similar results were
289

obtained after the addition of fungal elicitor

(
F
.
moniliforme)

to

cell cultures of
Catharanthus
290

roseus

(
37
).

In the present study,
exposure time plays an important role for the

production of
291

flavonolignans.

The optimum exposure time
favored

silymarin production
.

Thus, it may be
292

concluded that there is an optimum exposure time for maximum formation and accumulation
293

of desired bioactive molecules. This finding is in agreement
with the results of
Namdeo et al
294

(
2002)
who
showed the exposure time of 48 h resulted in a significant accumulation of
295

ajmalicine in
C. roseus
cells elicited with
A. niger, F. moniliforme
, and
T. viride.
. Khalili et al
296

(2009) have reported that the production of silymarin was 2
.
52
-

fold hi
gher than the control
297

after 24 h and a further increase in the exposure time inhibited the synthesis of silymarin in
298

media treated with salicylic acid

(11)
.
Previously, we

observed that the accumulation

of
299

silymarin
had

a

4.9
-
fold increase

when
hairy roots

were treated for
72

h

with yeast extract
300

(2.5 mg/50 ml culture)

while content of this compound decreased by 96 and 120 h after
301

treatment
(10)
.

Our results showed that silymarin production decreased between 48 h (when it
302

reached maximum production) and 72 h

after
addition of 10 mg/50 ml culture
A.

niger
.

These
303

results seem to be related to toxic effects of elicitor. The toxic effect of elicitors may be
304

related to their mechanism of action. It has previously been suggested that cellular damage is
305

caused

by el
icitors, especially to membranes

(10)
.

306


307

Wiktorowska et al (2010) were investigated the effects of elicitors on cell growth and
308

oleanolic acid (OA) accumulation in shaken cell suspension cultures of
Calendula officinalis.
309

Elicitors were added individually
at various concentrations to 5
-
day
-
old cell cultures and their
310

effects monitored at 24 h intervals for 4 days. After 72 h of treatment with 100

M J
asmonic
311

acid
, the intracellular content of OA reached its maximum value (0.84

mg
/
g DW), which was
312

9.4
-
fold gr
eater than that recorded in an untreated control cultures

(38)
.

313


314



Table 1
.

The
flavonolignan content (mg/g
DW)
in
F. proliferatum

treated (
0, 10 and 20 mg/ 50 ml culture
) and non
-
treated (control) hairy root cultures of
S. marianum

24,
315

48 and 72 h after elicitation. The flavonolignans were analyzed with HPLC.
Data show means ± SD from triplicate experiments.

316

Time

Concentration
of fungi

Flavonolignan

TXF

SC

SD

ISB

SB

24

0

0.043±0.113

0.036±0.000

0.081±0.007

0.015±0.002

0.012±0.002

10

0.047±0.006

0.034±0.001

0.079±0.008

0.012±0.000

0.013±0.004

20

0.042±0.011

0.03±0.001

0.084±0.01

0.013±0.001

0.018±0.002

48

0

0.033±0.004

0.038±0.006

0.086±0.0009

0.014±0.002

0.009 ±0.000

10

0.046±0.006

0.035±0.000

0.079±0.007

0.012±0.000

0.018±0.000

20

0.072±0.014

0.036±0.003

0.117±0.026

0.013±0.001

0.021±0.001

72

0

0.039±0.011

0.035±0.005

0.094±0.02

0.013±0.001

0.008±0.000

10

0.10
±0.017

0.061±0.006

0.055±0.004

0.016±0.000

0.022±0.002

20

0.068±0.002

0.034±0.001

0.119±0.004

0.013±0.000

0.02±0.002


317

Table 2
.

The
f
lavonolignan content (mg
/
g DW)
in
A. niger

treated (
0, 10 and 20 mg/ 50 ml culture
) and non
-
treated (control) hairy root cultures of
S. marianum

24, 48 and
318

72 h after elicitation. The
flavonolignans were analyzed with HPLC.
Data show means ± SD from triplicate experiments.

319

Time

Concentration
of fungi

Flavonolignan

TXF

SC

SD

ISB

SB

24

0

0.023±0.005

0.028±0.003

0.026±0.004

0.01±0.000

0.009±0.000

10

0.045±0.001

0.032±0.003

0.035±0.004

0.01±0.002

0.013±0.004

20

0.031±0.003

0.033±0.002

0.029±0.005

0.009±0.001

0.012±0.002

48

0

0.037±0.004

0.03±0.002

0.032±0.0002

0.01±0.000

0.01 ±0.000

10

0.071±0.024

0.036±0.006

0.038±0.012

0.016±0.005

0.019±0.006

20

0.057±0.023

0.039±0.005

0.052±0.023

0.009±0.001

0.018±0.003

72

0

0.032±0.009

0.03±0.003

0.025±0.003

0.008±0.000

0.01±0.002

10

0.049±0.008

0.029±0.001

0.029±0.005

0.009±0.003

0.015±0.000

20

0.039±0.007

0.03±0.005

0.024±0.003

0.008±0.001

0.015±0.003


320


321


322


323

Table 3
.

The
flavonolignan content (mg/g DW)
in
R. solani

treated (
0, 10 and 20 mg/ 50 ml culture
) and non
-
treated (control) hairy root cultures of
S. marianum

24, 48 and
324

72 h after elicitation. The flavonolignans were analyzed with HPLC.
Data show means ± SD from

triplicate experiments.

325


326

Time

Concentration
of fungi

Flavonolignan

TXF

SC

SD

ISB

SB

24

0

0.031±0.011

0.028±0.002

0.032±0.002

0.008±0.001

0.009±0.001

10

0.038±0.000

0.025±0.001

0.035±0.003

0.008±0.000

0.012±0.001

20

0.033±0.013

0.026±0.004

0.037±0.014

0.008±0.000

0.012±0.000

48

0

0.035±0.003

0.027±0.001

0.032±0.005

0.009 ±0.002

0.009 ±0.000

10

0.036±0.008

0.024±0.000

0.03±0.002

0.012±0.001

0.01±0.000

20

0.037±0.007

0.026±0.002

0.04±0.006

0.009±0.001

0.009±0.000

72

0

0.034±0.006

0.027±0.002

0.045±0.004

0.07±0.000

0.07±0.001

10

0.061±0.01

0.026±0.003

0.035±0.006

0.011±0.004

0.016±0.006

20

0.061±0.034

0.029±0.006

0.051±0.024

0.014±0.007

0.023±0.01


327

A possible explanation for this might be that, the fungal extracts included
chitin oligomers (oligochitin, N
-

acetylchitooligosaccharides)
328

and Chitosan (the deacetylated form of chitin), which can be generated from fungal cell walls. The main component of the cell

walls of some
329

fungal species can be inducing defense
-
related cellul
ar responses in plants (39). Chitin oligomers have been shown to induce various defense
-
330

related cellular responses and increased production of secondary metabolites in plant tissue cultures (38, 40). The productio
n of anthraquinone
331

colorants in madder (
Rub
ia akane

Nakai) cell culture elicited with 25 mg/ L chitosan, was increased approximately two times in a seven
-
day
332

culture as compared to that in the unelicited cells (41).The positive effects of chitosan elicitation on xanthone biosynthesi
s in calli and i
n cell
333

suspension cultures of
Hypericum perforatum

subsp. angustifolium was reported by Tocci et al (2010) (42). The addition of chitosan at 50 mg/ l
334

produced a 5
-
fold enhancement of OA accumulation (0.37mg/g DW) after 48 h of treatment in cell suspension
cultures of
Calendula officinalis

335

L.. Chitosan induces cell wall lignification (43). Production of phytoalexins and the generation of hydrogen peroxide, a reac
tive oxygen species,
336

are also responses of plants elicited with chitosan (44, 45). There is scarc
e evidence on the signal transduction pathways involved in the elicitor
337

actions. It has been reported that chitosan stimulates the accumulation of jasmonic acid, a signal molecule related to defens
e
-
gene regulation
338

(34).

Vasconsuelo
et al (2003) recently p
rovided evidence on the participation of the PLC/PKC pathway in the anthraquinones response elicited
339

by chitosan in
Rubia tinctorum

(46). Additionally, they searched for interactions of this pathway with PKC, phosphoinositide 3
_
-
OH
-
kinase
340

(PI3K) and adenyl
yl cyclase (AC)/cAMP/PKA messenger systems. The transduction of elicitor signals in plant cells may utilize a mechanism
341

similar to the process reported in animal cells in response to extracellular stimuli, where second messengers are generated,
leading to
the
342

activation of protein kinase cascades which may activate the biosynthetic ability for specific plant products (47).

343



Another possible explanation for this is that, H
2
O
2

from the oxidative burst link to
344

biosynthesis of second metabolites that was reported by many researchers. Hydrogen
345

peroxide (H
2
O
2
), the most stable compound among reactive oxygen species (ROS), has been
346

implicated in plant disease resistance and in a num
ber of plant pathogen interactions at the
347

early stage. However, it is not clear whether inhibition or enhancement of H
2
O
2

would affect
348

second metabolites biosynthesis. Treatment of
Taxus chinensis

cultures with fungal elicitor
349

stimulated the H
2
O
2

accumulat
ion (
48
), which agrees with the observations by Yuan et al.
350

(
49, 50
) and Yu et al. (2002)

(24)
. Lan et al (2003) reported that elicitor
-
induced taxol
351

production was not accorded with the amount of H
2
O
2
production. In cell suspension cultures
352

of
Taxus chine
nsis
, fungal elicitor (
A
.

niger
) and HgCl2 elicited taxol, which was a 9
-
fold and
353

5
-
fold increase compared with the control. The fungal elicitor induced hydrogen peroxide
354

(H
2
O
2
) accumulation but HgCl2 did not, indicating that H
2
O
2
was not necessary for
355

enha
ncement of taxol induced by elicitor.
These

results showed that elicitor
-
induced taxol
356

production did not depend on the intensity of H
2
O
2

from oxidative burst, which is in contrast
357

to the observations of Yuan et al. (2001

and

2002)

(49, 50)
. Therefore, fur
ther investigations
358

are required to identify fungal elicited silymarin production in
S.

marianum

hairy root
359

cultures is or not related to oxidative burst.

360

The obtained results indicated that synthesis of silymarin in hairy root cultures of
S.
361

marianum

was elicited by fungal elicitation. Further research should be done to investigate
362

the
JA

as a part of signal transduction pathway that mediates the induction of defensive genes
363

and study of the activated defensive genes that has been proposed to occur vi
a the JA
364

pathway. Chitosan is the deacetylated form of chitin, which is the main component of the cell
365

walls of some fungal species, a further study with more focus on chitosan elicitation and
366

other fungal cell wall parts, is therefore suggested.

367


368

4.

Conclusions

369

1.

Both the type and concentration of fungal elicitors are very important in determining the
370

enhancement of silymarin accumulation in the
S. marianum

hairy root culture.

371

2.

The

F. proliferatum

elicitors (20 mg/ 50 ml culture) were identified as the
most effective
372

elicitor to enhance silymarin accumulation (0.34 mg/g DW), regardless to its
373

concentration.

374

3.

The application of elicitors to
S. marianum

hairy root culture could be a useful tool for
375

studying the regulation of plant cell metabolism in respons
es to various stress factors.

376

4.

Further investigations are required to characterize the mechanisms underlying the
377

intracellular accumulation of silymarin in elicited
S. marianum

hairy root cultures
378

medium, and also to identify key steps participating in the

signaling network activated by
379

the elicitor. Such knowledge may be useful for manipulating the biosynthesis of
380

silymarin in
S. marianum
.

381


382

Acknowledgments

383

This research was funded (No. 12
-
05
-
05
-
8702
-

87001) by Agricultural Biotechnology
384

Research Institute
of Iran (ABRII).

385


386

References

387

1.

S. NYIREDY, Z. ZOLTA´N SZUCS, S.N. ANTUS, Z. SAMU, Z.

New Components from
Silybum

388

marianum

L. Fruits: A Theory Comes True
.

Chrom
atographia Supplement
, 68, 5, 11 (2008).

389

2.

J.V. SCHNFELD, B. WEISBROD, M.K. MULLER,
Silibinin

a plant extract with antioxidant and
390

membrane stabilizing properties protects exocrine panceas from cyclosporine

toxicity
,

Cellular and
391

molecular li
fe sciences
. 53, 917, 920 (1997).

392

3.

N.C. KIM, T.N. GRAF, C.M. SPARACINO, M.C. WANI,

Wall ME. Complete isolati
on and
393

characterization of silybins and isosilybins from milk thistle (
Silybum marianum
).
Org
.

Biomol
.

Chem
.
,

394

1, 1684,
1689 (2003).

395

4.

D.Y.W. LEE, Y.Z. LIU,
Molecular structure and stereochemistry of silybin A, silybin B, isosilybin A,
396

and isosilybin

B, isolated from
Silybum marianum

(milk thistle).

J. Nat. Prod
., 66, 1171, 1174 (2003).

397

5.

B.V.
Charlwood,
K.A.
Charlwood
,

Terpenoid production in plant cell culture

In: Harborne JB, Tomas
-
398

Barberan FA. Ecological chemistry and biochemistry of plant terpenoid
s. Clarendon Press. Oxford,
399

1991
,
pp
.
122
-
125.

400

6.

G.
SIVANANDHAN,
M.
ARUN,S.

MAYAVAN,
M.
RAJESH,
M.
JEYARAJ,

G.K.
DEV,
M.
401

MANICKAVASAGAM,
N.
SELVARAJ,
A.
GANAPATHI,
Opt
imization of Elicitation Conditions with
402

Methyl Jasmonate and Salicylic Acid to Improve the Productivity of Withanolides in the Adventitious Root
403

Culture of Withania somnifera (L.) Dunal.
Appl
.

Biochem
.

Biotechnol
.
,

168, 681, 96 (2012).

404

7.

G.
Singh
,

Elicitation

manipulating and enhancing secondary metabolite production
. In: Fu TJ, Sing
405

G, Curtis W, editors. Plan cell and tissue culture for the production of

food ingredients. New York:
406

Kluwer Academic; 1999
, pp. 301
-
332.


407

8.

H. RAHNAMA, T. HASANLOO, M.R. SHAMS, R. SEPEHRIFAR,

Silymarin production by hairy
408

root culture of
Silybum marianum

(L.) Gaertn.
Iran J Biotechnol
.,

6
,

113
,
118

(2008)
.

409

9.

T. HASANLOO, R.A. KHAVARI
-
NEJAD, E. MAJIDI E, M.R. SHAMS
-

ARDAKANI,
410

Flavonolignan production in cell suspension culture of
Silybum marianum
(L.) Gaertn
.
Pharm.

Biology
.

411

46,

1
,
6

(2008)
.

412

10.

T. HASANLOO, R. SEPEHRIFAR, H. RAHNAMA, M.R. SHAMS,

Evaluation of the
yeast
-
extract
413

signaling pathway leading to silymarin biosynthesis in Milk thistle hairy root culture.
World

Journal of
414

Microbiolo

and Biotechnol
.,

25, 1901,

1909

(2009)
.

415

11.

M. KHALILI, T. HASANLOO, S.K. KAZEMI TABAR, H. RAHNAMA,
Influence of exogenous
416

salicyl
ic acid on flavonolignans and lipoxygenase activity in the hairy root cultures of
Silybum
417

marianum. Cell Biology International
. 33, 988,
994

(2009)
.

418

12.

H.M. SCHUMACHE, H. GUNDLACH, F. FIEDLER, M.H. ZENK.
Elicitation of benzophenanthridine
419

alkaloid synthesis i
n Eschscholtzia cell cultures.
Plant Cell Rep
.

6,

4
10,
413

(1997)
.

420

13.

L.C. JUN, H.S. SHENG,
Effects of fungal elicitors on the cell growth and the shikonin biosynthesis in
421

Arnebia euchroma

cells in suspension culture.
Acta Phytophysiologica

Sin
.
,

24, 6
-
10

(1998)
.

422

14.

F. MARINELLI, S. DI
-
GREGORIO, V.N. RONCHI,
Phytoalexin production and cell death in elicited
423

carrot cell suspension cultures.
Plant Sci.
(Limerick) 77
,

261
-
266
, (1991)
.

424

15.

F. GARNIER, C. DEPIERREUX, P. G. PETIT, S. HAMDI, J.C. CHENIEUX, M. RIDEAU,

In
duction of
425

the accumulation of trytamin and phenols by endogenous elicitors in cell suspension cultures of
426

periwinkle.
J. Plant Physiol
., 148, 701,

706

(1996)
.

427

16.

A. VASCONSUELO, A.M. GIULIETTI, R. BOLANC,
Signal transduction events mediating chitosan
428

stimula
tion of anthraquinone synthesis in
Rubia tinctorum
.
Plant Science
.
166,
405,
413

(1996)
.

429

17.

C.Z. LIU, Y.C. WANG, F. OUYANG, H.C. YE, G.F. LI,
Production of artemisinin by hairy root cultures
430

of
Artemisia annua
L.
Biotechnol.

Lett
.

927
,
929
, (1997)
.

431

18.

S.K.
RIJHWANI, J.V. SHANKS,

Effect of elicitor dosage and exposure time on biosynthesis of indole
432

Alkaloids by
Catharanthus roseus
hairy root cultures.
Biotechnol
.

Prog
. 14, 442
,
449

(1998)
.

433

19.

C. LIU, Y. WANG, X. XU, F. OUYANG,
H.
YE,
G.
LI
,

Improvement of artemi
sinin accumulation in
434

hairy root cultures of
Artemisia annua

L. by fung
al elicitor
.

Bioproc Eng
., 20, 161,
164

(1999)
.

435

20.

J.W. WANG, F.X. KONG, R.X. TAN,
Improved artemisinin accumulation in hairy root cultures of
436

Artemisia annua

by (22S, 23S)
––
homo
brassinoli
de.
Biotech. Lett
., 24, 1573,

1577

(2002)
.

437

21.

J.
ZHAO
, K.
FUJITA
, J.
YAMADA
, K.
SAKAI
,
Improved beta
-
thujaplicin production in
Cupressus

438

lusitanica

suspension cultures by fungal elicitor and methyl jasmonate
.

Appl
.

Microbiol
.

Biotechn
ol
.,

55:
439

301
,
5
, (2001)
.

440

22.

P.B. HARSH, S.W. TRAVIS, P.S. HERBERT, M.V. JORGE,
Root specific elicitation and antimicrobial
441

activity of rosmarinic acid in hairy root cultures of
Ocimum basilicum
.
Plant

Physiol. Biochem
., 983,
995

442

(2002)
.

443

23.

A.
Balazová,

F.
Bilka,

V.

Blanáriková,
M.
Psenák,

Effect of a fungal elicitor on levels of sanguinarine and
444

polyphenoloxidase activity in a suspension culture of
Papaver somniferum

L.

Ceska Slov Farm
.

51, 182
,
445

5

(2002)
.

446

24.

L.J. YU, W.Z. LAN, W.M. QIN, W.W. JIN, H.B. XU,

Oxidative stress and taxol production induced
447

by fungal elicitor in cell suspension cultures of
Taxus chinensi
s
.
Biol. Plant
.

45
,

459
,
461

(2002)
.

448

25.

P.B. HARSH, B.S. DATTATREYA, G.A. RAVISHANKAR,

Production of volatile compounds by
449

hairy root cultures of
Cichorium intybus
L under the influence of fungal elicitore

and their analysis
450

using solid
-
phase micro extraction gas chromatography
-

mass spectrometry.
Journal of the Scienc
e of
451

Food and Agriculture
.

83
,

769
,
774

(2003)
.

452

26.

C.T.
LU
, X.G.
MEI
,
Improvement of phenylet
hanoid glycosides production by a fungal elicitor in cell
453

suspension culture of
Cistanche deserticola
.,

Biotechnol Lett.
,

25
,

1437
,
9

(2003)
.

454

27.

S.J.
Hwang
,

Baicalin prod
uction in transformed hairy root clones of

S
cutellaria

baicalensis
.
455

Biotechnology and

Bioprocess Engineering
. 11, 105,
109

(2006)
.

456

28.

W.
PUTALUN
, W.
LUEALON
, W.
DE
-
EKNAMKUL
, H.
TANAKA
, Y.
SHOYAMA
,
Improvement
457

of artemisinin production by chitosan in hairy root cultures of
Artemisia annua

L.

Biotechnol.

Lett
.,

29,
458

1143
,
1146

(2007)
.

459

29.

L. AJUNGLA L, P.P. PATIL, R.B. BARMUKH, T.D. NIKAM,

Influence of biotic and abiotic elicitors
460

on accumulation of hyoscyamine and

scopolamine in root cultures of
Datura metel
L.
Indian
J
461

Biotechnol
.
,

8
,

317
,
322

(2009)
.

462

30.

W. ZHENG, K. MIAO, Y. ZHANG, S. PAN, M. ZHANG, H. JIANG,
Nitric oxide mediates the
463

fungal
-
elicitor
-
enhanced biosynthesis of antioxidant polyphenols insubmerged

cultures of
Inonotus
464

obliquus

Microbiology
.
155, 3440,
3448

(2009)
.

465

31.

Lu, D
.
Dong, J
.
Jin, H
.
Sun, L
.
Xu, X
.
Z
hou, T
.
Zhu, Y
.
Xu, M
. (2011) Nitrate

reductase
-
mediated
466

nitric oxide generation is essential for fungal elicitor
-
induced camptothecin accumulation of
467

Camptotheca acuminata

suspension cell cultures.
Appl Microbiol Biotechnol.

90, 1073
-
81
, (2011)
.

468

32.

T. MURASHIGE, F. SKOOG,

A revised medium for rapid growth and bioassays with tobacco tiss
ue
469

cultures.
Physiol. Plant
,

15
,

473
,
497

(1962)
.

470

33.

J. ZHAO, L.C. DAVIS,
Verpoorte R.Elicitor

signal transduction leading to production of plant
471

secondary me
tabolites.
Biotech. Adv
., 23,

283

333

(2005)
.

472

34.

M.B.
Ali,
K.W. Yu
,
E.J.
Hahn,
K.Y.
Paek
,

Copper
-
induced changes in the growth, oxidative
473

metabolism, and saponin production in suspension culture
roots of
Panax ginseng

in bioreactors. Plant
474

Cell Rep. 25
,

613
,
620

(2006)
.

475

35.

F. DI COSMO, M. MISAWA,
Eliciting secondary metabolites in plant cell cultures.
Trends

Biotechnol

476

1985; 3: 318

322

(1985)
.

477

36.

A. NAMDEO, S. PATIL, D.P. FULZELE,
Influence of fungal el
icitors on production of ajmalicine by
478

cell cultures of
Catharanthus roseus
.
Biotechnol Prog
.,

18
,
159
,
62

(2002)
.

479

37.

E. WIKTOROWSKA, M. DŁUGOSZ, W. JANISZOWSKA
,

Significant enhancement of oleanolic
480

acid accumulation by biotic elicitors in cell suspension cul
tures of
Calendula officinalis

L.
Enzym
e and
481

Microbial Technol
.,

46
,

14
,
20

(2010)
.

482

38.

G. STACEY, N. SHIBUYA,

Chitin recognition in rice and legumes.
Plant Soil
,

194
,

161
,
169

(1997)
.

483

39.

T. MIIN CHONG, M.A. ABDULLAH, O.M. LAI, F.M. NOR’AINI, N.H. LAJIS,
Effective elicitation
484

factors in
Morinda elliptica

cell suspension culture.
Process Biochemistry
,

40
,

3397
,
3405

(2005)
.

485

40.

H. JIN
,
J.
SHIN
,
J.
KIM
,
S.
CHUNG
,
H.
LEE,
Effect of chitosan elicitation and media components on
486

the production of anthraquinone color
ants in Madder

(
Rubia akane Nakai
) cell culture
.
Biotechnol
.

487

Bioprocess Eng
.,

4
,

300
,
304

(1999)
.

488

41.

N.
TOCCI
, F.
FERRARI
, A.R.
SANTAMARIA
,
A.
VALLETTA
, I.
ROVARDI
, G.

PASQUA,
489

Chitosan enhances xanthone production in
Hypericum perforatum

subsp. angustifolium cell cultures.
490

Nat
.

Prod
.

Res.
,

24, 286,
93

(2010)
.

491

42.

C.H. ZHANG, P.S. FEVEREIRO, G. HE, Z. Chen,

Enhanced paclitaxel productivity and release
492

capacity of
Taxus chinesis

cell suspension cultures adapted to chitosan.
Pl
ant Sci
., 172, 158,
63

(2007)
.

493

43.

H. GUNDLACH, M. MÜLLER, T.M. KUTCHAN, M.H. ZENK,
Jasmonic acid as a signal transducer
494

in elicitor
-
induced plant cell cultures.
Proc
. Nat.

Acad
.

Sci
., 89, 2389,
93

(1992)
.

495

44.

J.W. WANG, Z.H. XIA, J.H. CHU, R.X. TAN,

Simultaneous production of anthocyanin and
496

triterpenoids in suspension cultures of
Perilla frutescens
.
Enzyme Microb Technol
., 34, 651,
6

(2004).

497

45.

A. VASCONSUELO, R. BOLAND,

Molecular aspects of the early stages of elicitation of secondary
498

metabo
lites in p
lants.
Plant Sci
., 172, 861,
75

(2007)
.

499

46.

M.P. Popp
,
M.S.
Lesney,
J.M. Davis,

Defence responses elicited in pine cell suspension cultures.
Plant
500

Cell Tissue Org
.

Cult
.,

50
,

185
,
93

(1997)
.

501

47.

C.H. ZHANG, X.G. MEI, L. LIU, L.J. YU,

Enhanced paclitaxel production

induced by the combination of
502

elicitors in cell suspension cultures of
Taxus chinensis
.
Biotechnol. Lett
.
,22,

1561
,
1564

(2000)
.

503

48.

Y.J. YUAN, C. LI, Z.D. HU, J.C. Wu,

Signal transduction pathway for oxidative burst and taxol

504

production in suspension cultures of
Taxus chinensis
var.
mairei
induced by oligosaccharide from
505

Fusarium oxysporum
.
Enzyme Microb. Technol
.
,
29, 372
,
379

(2001)
.

506

49.

Y.J. YUAN, C. LI, Z.D. HU, J.C. WU
,

A double oxidative burst for taxol production in
507

suspen
plantsion cultures of
Taxus chinensis
var.
mairei
induced
by oligosaccharide from
Fusarium
508

oxysprum
.,

Plant Mol. Biol
.
, 48,

251
,
275 (2002).


509

50.

W.Z. LAN, W.M. QINB, L.J. YU, X. YANG
, Hydrogen Peroxide from the Oxidative Burst is Not
510

Involved in the Induction of Taxol Biosynthesis in
Taxus chinensis
.,

Cells. Notes
, 3, 606,
608

(2003)
.

511