Genetic Engineering

polarbearfellowshipΒιοτεχνολογία

12 Δεκ 2012 (πριν από 4 χρόνια και 4 μήνες)

195 εμφανίσεις

Bio J


Molecular Biology


1


Genetic Engineering

Genetic engineering

is

:
_
_______________________________
_________________________________________:



Make transgenic organisms



Clone an organism



Gene therapy

Transgenic Organisms
:
___________________
_______________________________
____________________________



Insert gene of interest into another organism, receiving organism now makes the protein from that gene

Practical applications




_____________________________________________



_____________________________________________



________
_____________________________________


Making Insulin for Diabetics:



Diabetes
: mutated insulin gene which creates a dysfunctional insulin protein; no or low amounts of insulin
protein made




we can force bacteria to make insulin for us

(insert a gene to turn the bacteria into an “insulin factory”

PLASMIDS



Bacteria have circular pieces of DNA called
Plasmids

(
these are in addition to their
“regular” genome
”) Any gene on the plasmid can be replicated, transcribed or
translated.



They con
tain promoter
sequences (control transcription of the gene)
and regulatory
sequences

(control gene expression)

and can contain coding regions


Plasmid


Bio J


Molecular Biology


2


How do we work with plasmids?

_____________________________________________________________________________________


_____________________________________________________________________________________




In plasmids there are specific sequences called
restriction sites



Restriction site
s are locations that contain

_________________________________________________



Restriction enzymes

recognize the sites and cut one strand of the DNA at that site




Example of a recognition sequence:



Single stranded ends are called “sticky”



What do the stick single stranded ends want to bind to?

______________________
_______________



We can take advantage of this and insert the coding region of another gene into the breaks



What enzyme can we use to “seal the gaps” between plasmid DNA and insu
lin DNA?




Put plasmid back into bacteria
using a process called
____________________
_____________



______________________________________________________________________________________



Then we can take out the insulin protein and use it to treat diabetics.

Diagram of Process used to insert a gene into a plasmid:











Bio J


Molecular Biology


3


Cloning




Mammals usually fuse info from two parents



Cloning takes all the chromosomes from 1 parent.





Answer these questions:


-

Which sheep is dolly identical to and why?


-

Which of the experimental sheep have to be female and why?


-

Why does the DNA have to come from a somatic cell instead of a gamete?

-
What are some good scientific reasons to clone?





Bio J


Molecular Biology


4


Write a summary that explains how Dolly is cloned (be sure to
include the number of animals and genders required,
the types of cells used from each organism
, and who is the animal being cloned (and how you know this).








Human Genome project

What it did do
: Tell us each an
d

every
nucleotide of the human genome
-

all approx.
3
.2 billion

What it did not do
: _____________________________________
__________________________________________

What we need to do next: break it down

and determine:


-

which pieces are genes


-

which pieces a
re junk


-

what info the genes hold.


Where will we store all this information (and other information we learn about DNA sequences in chromosomes or in
people?


BIOINFORMATICS IS __________________________________________________________________


What

are some things that are included in this new “science”?


What does it help us to do?


What is the purpose of BLASTing a sequence?

Bio J


Molecular Biology


5


DNA FINGERPRINTS:

The newest “computerized” way to determine guilt, identity, etc.


What are the uses of a DNA Fin
gerprint?



DNA FINGERPRINTING IS BASED ON THE IDEA THAT __________________________________________ But

__________________________________________________________


How to do a DNA fingerprint



Get a sample of DNA and digest it with
restriction enzymes



If ev
eryone’s DNA is unique, the enzyme will cut each person

s DNA differently



Example:



1.
TCAT
GAATTC
ATTGCC
GAATTC
CGTGAATCCA
GAATTC
GGACTA



2.
TCATGAAGTCATTGCC
GAATTC
CGTGAATCCAGACTTCGGACTA



How many pieces would each

of the above examples

be cut into?


1.


2.



Run cut up DNA on through electrophoresis



See website for animated tutorial
. A
dd notes below!

Which child is adopted?

Who are
the children of this Mom and Dad
?







Bio J


Molecular Biology


6



Gene Therapy



Taking geneti
c testing one step further



_________________________________________________



How do we fix a gene?

1
. __________________
_______________________________
_______________________________________

2. _________________
_______________________________
_________________________________________

3. __________________________________________________________________________________________

What are we trying to do? ________________________________________________________________________

Possibilities:



Cysti
c fibrosis: _________________
_______________
_____________________________________________



Hemophilia: ________________________________________________________________________________



Cancer: _________________________________________________________________
__________________