MAJOR MICROBIOLOGY.pptx - Yimg

neighgreasycornerΒιοτεχνολογία

14 Δεκ 2012 (πριν από 4 χρόνια και 8 μήνες)

341 εμφανίσεις

MAJOR MICROBIOLOGY

DEPARTMENT OF BIOLOGY

POST GRADUATE SCHOOL

BOGOR AGRICULTURAL UNIVERSITY

2009

MAJOR MICROBIOLOGY : AN OVERVIEW


Established in 1990 as Subprogram Study in the Study Program of
Biology



Composed on 2 division: Microbiology (Bacteriology)




Mycology


Staffs: 1 Prof, 10 doctors



Number of Student : ongoing student: 13 master, 8 doctoral


incoming student: 16 master, 3 doctoral


Programmes

:


1. Master in Microbiology: microbial biodiversity and
bioprospecting
,


and

environmental microbiology


Doctor of Philosophy in Microbiology


Supporting unit: IPB Culture Collection (currently developing through I
-
MHERE project

VISION


To

be

recognized

world
-
wide

as

the

leading

centre

in

tropical

microbiological

science

for

agriculture

development

and

for

human

life

quality

improvement

in

2020
.


MISSION


To

develop

human

resources

with

high

capacities

in

tropical

microbial

knowledge

and

technologies

through

undergraduate

and

postgraduate

education
.


To

expand

and

transfer

microbial

knowledge

and

technologies

for

continuous

improvement

of

agriculture

and

human

life
.


Increase

the

quality

and

quantity

of

research

in

tropical

microbial

knowledge

and

technologies

particularly

in

biodiversity

and

bio
-
prospecting
.


Increase

networking

through

research

and

education

partnership

locally,

nationally

and

globally
.


CURRICULUM

Master

of Science Program (39 CSU)

General courses


English



3 CSU


Stastical Analyses


3 CSU


Compulsory courses



Advanced Microbiology


2 CSU


Microbial Physiology


2 CSU


Microbial Genetic


2 CSU


Microbial Laboratory


2 CSU


Microbial Biotechnology


3 CSU


Fungal Biotechnology


3 CSU


Methodology of Science 2 CSU


Colloqium





1 CSU


Seminar




1 CSU


Research and Thesis


6 CSU

Elective courses

Bio
-

prosepecting



Industrial Microbiology


3
CSU


Molecular Biotechnology 3 CSU


Biotechnology of Antimicrobial
Susbtance




3
CSU

Environmental Microbiology


Host
-
Microbes Interaction


3
CSU


Environmental Microbiology 3 CSU


Spoilage Fungi and Mycotoxins in
foodstuff




3
CSU


CURRICULUM

Doctor of Philospophy Program (41 CSU)

General Course


Philosophy of Science



2 CSU

Compulsory courses

Advanced Microbial Physiology 3 CSU

Advanced Fungal Biology 3 CSU

Molecular Biology of Prokaryotic

Diversity



3 CSU

Microbial Genetic Engineering 3 CSU

Colloqium


1 CSU

Seminar


1 CSU

Research and Thesis


12 CSU



Elective courses

Biology of Pathogenic Bacteria

2
CSU

Gene Expression and Regulation

3
CSU

Biology and Productivity of

Actinomycetes



3
CSU

Biology of Mycorrhiza



3
CSU

Biology and Productivity of

Macrofungi



3
CSU

Teaching Staffs and Field Interest

1.
Prof
.

Dr
.

Antonius

Suwanto,

MSc
.
,

Ph
.
D

(Microbiology

and

Molecular

genetics)

2.
Dr
.

Anja

Meryandini,

MS

(Microbial

Physiology

and

Enzymology)

3.
Dr
.

Aris

Tri

Wahyudi,

MSi

(Microbial

Biotechnology)

4.
Dr
.

Iman

Rusmana,

MSi
.

(Environmental

Microbiology)

5.
Dr
.

Nisa

Rachmania,

MSi
.

(Microbiology

and

Microbial

Physiology)

6.
Dr
.

dr
.

Sri

Budiarti

(Medical

Microbiology,

Bacterial
-
Human

Cell

Interaction)

7.
Dr
.

Yulin

Lestari

(Microbial

Ecophysiology)

8.
Dr
.

Gayuh

Rahayu

(Mycology

and

Phytopathology)

9.
Dr
.

Lisdar

A

Manaf

(Mushroom

Biology

and

Fungal

Ecophysiology)


10.
Dr
.

Nampiah

Sukarno

(Mycology

and

Mycorrhizal

Biology)

11.
Dr
.

Okky

S
.

Darmaputra

(Post

Harvest

Mycology)


RESEARCH

BACTERIOLOGY

Marine
Bioechnology


Producing Anti
-


microbial Compounds


Producing

Enzyme Inhibitors

Student Involved:
4 Students

Sponge
-
Associated


Bacteria

Targets: 1. Antimicrobial Compounds from sponge
-
associated Bacteria



2. Molecules/Compounds as Enzyme Inhibitors



3. Molecular Genetic of Antimicrobial Compounds Synthesis

Molecular

Genetics

Aris

Tri
Wahyudi
,
PhD

Plant Growth Promoting


Rhizobacteria

(PGPR)

Plant Growth


Promotion

Bioactive Compounds

Anti Phytopathogen

Student involved:
7 Students


(2 PhD ; 2 S
-
2, 3 S
-
1)

1.
Formulation of PGPR as plant growth and Biocontrol

2.
Molecular Genetic of Bioactive Compound Synthesis

3.
Bioactive Compounds/Antibiotic from PGPR


Biocontrol of

Phytopathogen

Formulation and


Inoculant Prod.

-
Pseudomonas

sp


-
Bacillus

sp

Aris Tri Wahyudi, PhD

Aris Tri Wahyudi, PhD

Dr.
Anja

Meryandini

Research Interest: Microbial enzymes

-

Bacterial protease

-

Bacterial
mannanase

-

Bacterial
xylanase


for animal feed processing

Clostridium

bifermentans

producing

protease

enzyme

Streptomyces

sp
.

producing

xylanase

enzyme

451
-
3

234P
-
16

SKK1
-
8

Dr. Nisa Rachmania Mubarik, MSi

Head of Microbiology Division, Department of Biology, Faculty of Mathematics and Natural
Sciences, Bogor Agricultural University

Research Interest
:



Symbiotic Effectiveness of Inoculant Acid
-
Alumunium Tolerant
Bradyrhizobium
japonicum

Strains with Soybean Cultivar Slamet in Acid Soils

(3 master
students, 2007
-
2009)



Isolations,

Characterizations and Applications Microbial Enzymes (Protease,
Amylase, Chitinase)

(7 undergraduate student, 1 master students, 2007
-
2009)


Inoculant
B. japonicum
on
peat carrier.

0.5 mm

0.5 mm

0.5 mm

0.5 mm

0.5 mm

0.5 mm

0.5 mm

Chitin
hydrolization

at 12 hours by
cell cultures and
chitinase

of
bacterial
isolates I.5 and I.21 test
ed

to
Bemisia

tabaci

. C
ontrol

(a), cell cultures treatment (b
-
d), enzyme treatment (e
-
g).

Dr.
Iman

Rusmana

(irusmana@ipb.ac.id)



䕮癩v潮浥ot慬a
䵩捲潢楯汯o楳t

RESEARCH INTEREST:

Current Research Topics:


Methanotrophic

bacteria as
biofertilizers

and methane
emission
reducers in rice fields


N
2
O
reducing bacteria to reduce N2O emission from agriculture system


Nitrate
reducing bacteria and
Bacillus

spp.

as
bioactive of
biofilter

in
close system of larval rearing and nursery of aquacultures



Nitrate reducing and nitrifying bacteria as
bioconditioner

controlling
nitrite and ammonia in shrimp ponds

Nitrogen cycling and N
2
O emission in
tropical estuaries and agricultural
system

Student involved (9 master, 1 PhD)

Amplification

of
mmo
X gene

Amplification

of
pmo
A gene

Size of DNA
fragments

Molecular characterization of methane
monooxygenase

genes

Forward sequence of BGM9
mmo
X gene:


ATAANCGCAGCGTGTTNCAGGTCCGCGAGATCGCCGACCAGTCCGCCGCCGNCAGCNAGCAGACCGCCAGCTCCAGCA
ACGAACTGGCGCACCTGGGCAACGAGCTGCAACTGCAGGTGGGACGTTTCCGCCTGTGACACGCCNGTCGGTCGGTAC
GCCCGCTCCGGCCGATAACGGCAGGACAGTTGTCATGCGCATGGCGTAGGATCGGACACTCGCCATGAAGGGAGAGTG
ACCATGCGCCCGCTGACCATCGATATCGACGAACTGGACCTTCGCGCTTGATACCCAGGGTATCGATCACTACCTCGACC
TGTTCAGTGGCCAGGTGCTGCTGATACCGGAGGACGACCCCGACCCGGAGCTCGCCGAACTGCTGCACCGCGAGCCGG
AGCGCTACGAGTG

Reverse sequence of BGM9
mmo
X gene:

GGTATCANCAGCACCATGGCCACTGAACAGGTCGAGGTAGTGATCGATACCCTGGGTATCAAGCGCGAAGGCCAGTTC
GTCGATATCGATGGTCAGCGGGCGCATGGTCACTCTCCCTTCATGGCGAGTGTCCGATCCTACGCCATGCGCATGACAA
CTGTCCTGCCGTTATCGGCCGGAGCGGGCGTACCGACCGACAGGCGCGTCACAGGCGGAAACGTCCCACCTGCAGTTG
CAGCTCGTTGCCCAGGCGCGCCAGTTCGGTGCTGGAGCTGGCGGTCTGCTCGCTGGCGGCGGCGGACTGGTCGGCGAT
CTCGCGGACCTGCACCACGCTGCGGTTGATCTCCTCGGCAACGCTGCTCTGCTCCTCGGCGGCCGANGCGATCTGCAGG
TTCATGCCCTTCCACAGCGGATATAATA

Sampling for measurement and
molecular analysis of nitrate
reducing bacteria in sediment of
tropical estuaries

Bacteriocins purification and its
antimicrobial activity from
Bacillus

spp. isolated from shrimp
ponds

FROM MOLECULAR TO ECOLOGY

Dr. dr. Sri
Budiarti

Research Interest: Medicinal Microbiology



Enteropathogenic

Eschericia

coli:


-

mode of infection


-

Extracellular protease activity


-

Monoclonal antibody
antiprotease

activity


-
Diagnostic kit design



Dengue and environmental health



Screening of Antimicrobial substance from bacteria and fungi

INDONESIAN ACTINOMYCETES AS SOURCE OF
BIOACTIVE COMPOUNDS USED FOR SOLVING
AGRICULTURE, ENVIRONMENT AND HEALTH
PROBLEMS


1.
Collection of
Actinomycetes

isolates from unique
tropical environment, and
endophyte

actinomycetes


2.
In vitro and in vivo assay for:
antimicrobes
, enzyme
inhibitor (e.g. a
-
glucosidase
, b
-
lactamase
), degrading
enzymes (lipase, cellulose and
lignolitic

enzymes)

3.
Target organisms: agriculture & horticulture plants,
plantation, poultry, and human )

4.
Student involve: undergraduates (2) ,graduates ( 4
Master students), and 3 PhD students)

Dr.Ir
.
Yulin

Lestari

MYCOLOGY

Diversity of Indonesian Filamentous Fungi (205 genera)

Entomophthorales
Kickxellales
Mortierellales
Mucorales
Botryosphaeriales
Capnodiales
Chaetosphaeriales
Chaetothyriales
Coniochaetales
Diaporthales
Dothideales
Eurotiales
Helotiales
Hypocreales
Hysteriales
Microascales
Onygenales
Ophiostomatales
Orbiliales
Pezizales
Pleosporales
Saccharomycetales
Sordariales
Trichosphaeriales
Xylariales
Incertae sedis
Agaricales
Polyporales
Tremellales
Ustilaginales
Incertae sedis
Agaricales

Mucorales

Eurotiales

Hypocreales

Incertae


sedis

Polyporales

Zygomycota

Basidiomycota

Ascomycota

RESEARCH TITLE (Year 2009)

: Population of
Aspergillus

flavus

and
Aflatoxin

B
1
Contents from Processed Peanut Products in Municipality of Bogor.




ACTIVITIES
: • Survey of processed peanut product consumptions



• Sampling method of processed peanut products



• Determination of
A.
flavus

population and
aflatoxin

B
1
contents


EXPECTED OUTPUT

:
informations

on
A.
flavus

population and the levels of


aflatoxin

B
1

in processed peanut products at retail


levels

Dr.
Okky

Setyawati

Darmaputra


FUNGI ON FOODSTUFF AND THEIR MYCOTOXIN

Research Interest:


Biology and Application of Phosphate
Solubilizing

Fungi



Biology and Application
Mycorrhizal

Fungi

Dr. Ir.
Nampiah

Sukarno

Development of
Aspergillus

carrying GFP gene for

studying the ecological and
colonization process

T.
caccao

Curcuma
sp.

P.
falcataria

a b. c.


a b. c

.

a b. c.

.

a b. c.

.

a b. c.

.

J.
curcas

a b. c.

.

Post tin mining
area

P.
macrocarpa

P.
macrocarpa

Agriculture
area

Green house

a.

Control, b.

A.
niger
,
c.
AMF

Edible
Ectomycorrhiza

Dr. Ir.
Gayuh

Rahayu

Research Interest:



Artificial Production of
agarwood

(Jin
-
koh
)
in
planta


and
in vitro culture
:

-

Inoculant

Production

-

Mechanisms of
terpenoid

production

-

Inoculation Techniques



Manipulation of Soil Fungi for Forest Tree
Growth and Health

-
Fungal decomposer of
Shorea

and
Dryobalanops

litter

and plant growth regulator producers



(student involved: 1 master, 1 undergraduates)

Student involved ( 3 master students)

Thermophilic

Fungi

compost

ZPT bioassay



Amylolytic

Fungi and its fermentation capacity for ethanol
production

-

Screening of potential mold and yeast




Dr.Ir
.
Lisdar

A.M.
Sudirman

Research Interest:

-
Mushroom Biology and Biotechnology

-

Mushroom Antimicrobial activity