Supplemental figure S1

muscleblouseΤεχνίτη Νοημοσύνη και Ρομποτική

19 Οκτ 2013 (πριν από 3 χρόνια και 7 μήνες)

84 εμφανίσεις

mips1
-
1
/35S::MIPS1
-
RFP/PMIPS1::MIPS1
-
GFP

mips1
-
1
/PMIPS1::MIPS1
-
GFP

mips1
-
1
/35S::MIPS1
-
RFP/PMIPS1::MIPS1
-
GFP

mips1
-
1
/PMIPS1::MIPS1
-
GFP

GFP

Transmission

Supplemental figure S1


Supplemental

figure

S
1

PMIPS
1

required

MIPS
1

to

be

activated
.

mips
1

mutant

plantlets

were

transiently

transformed

with

both

PMIPS
::
MIPS
-
GFP

and

35
S
::
MIPS
-
RFP

or

with

PMIPS
::
MIPS
-
GFP

alone
.

Picture

was

obtain

by

using

Confocal

microscopy
.

Supplemental figure S2


Supplemental figure 2:

NetNES

prediction, which is the output after submission of
MIPS1 amino acid sequence. The prediction server calculates the NES score from the
HMM and Artificial Neural Network (ANN) scores and all three values are given for
each residue.

Supplemental

figure

S
3

Distribution

of

MIPS
1

expression

in

leaf

and

root

tissues
.

Plants

were

transformed

with

a

construct

allowing

the

expression

of

GFP

fused

to

a

nuclear

envelope

targeting

signal

downstream

of

the

MIPS
1

promoter

(
MIPS
1
::
NTF
-
GFP
)
.

A
:

Observation

of

GFP

distribution

in

roots
:

GFP

fluorescence

is

observed

mainly

in

the

stele

and

in

cortical

cells

close

to

the

vasculature
.

B
:

to

quantify

the

proportion

of

cells

expressing

MIPS
1

in

roots

and

leaves,

we

used

flow
-
cytometry
.

Nuclei

were

extracted

in

Galbraith

buffer,

and

analyzed

using

a

MoFlo

flow

cytometre

to

monitor

Propidium

Iodide

(PI)

fluorescence

and

GFP

fluorescence

simultaneously
.

Whole

wild
-
type

plants

were

used

as

a

control

to

establish

the

gate

for

GFP

positive

nuclei
.

GFP

fluorescence

was

observed

in

30
%

of

root

cells,

and

95
%

of

leaf

cells
.

Supplemental figure S3


MIPS1::NTF
-
GFP


GFP

transmission

MIPS1::NTF
-
GFP

Root

MIPS1::NTF
-
GFP

Rosette
leaves

Col0

GFP+

GFP+

GFP+

GFP
-

GFP
-

GFP
-

A

B

WCL

M

IP

GFP

IP

IgGM

IP

GST

Col PMIPS1::MIPS1
-
GFP

ATXR6
-
GST

Anti
-
GFP

Anti
-
GST

80
kD

50
kD

Supplemental figure S4


Supplemental

figure

S
4

MIPS
1
-
GFP

and

GST
-
ATXR
6

interact

in

vitro
.

GST
-
tagged

ATXR
6

purified

from

E
.

coli

was

mixed

with

proteins

extracted

from

plants

expressing

a

MIPS
1
-
GFP

fusion
.

Immunoprecipitation

was

performed

using

either

anti
-
GFP

antibodies

or

anti
-
IgG

antibodies

as

negative

controls,

and

immunoprecipitates

were

analyzed

with

anti
-
GFP

and

anti
-
GST

antibodies
.

As

positive

controls,

we

respectively

used

WCL

(whole

cell

lysate
)

of

PMIPS
1
::
MIPS
1
-
GFP

for

MIPS
1
-
GFP

and

a

direct

GST

immunoprecipitation

from

the

GST
-
ATXR
6

protein

production

(white

arrow

indicates

MIPS
1
,

black

arrow

indicates

ATXR
6
)
.

0
0.2
0.4
0.6
0
5
10
15
0
0.2
0.4
0.6
0.8
0
5
10
15
20
ATXR6 activity

ATXR6 inhibition assay

ATXR6 /
IP_IgG

ATXR6 / IP_MIPS1

ATXR6 activity in arbitrary units

ATXR6 quantity

ATXR6 activity in arbitrary units

Immunoprecipitate

quantity

A

B

Supplemental figure S5


Supplemental

figure

S
5

MIPS
1

could

inhibit

ATXR
6

activity

in

vitro
.

ATXR
6

was

produced

in

vitro

and

we

measured

specifically

its

HMT

activity

alone

(A)

or

supplemented

with

MIPS
1
-
GFP

immunoprecipitated

from

transgenic

plant

(B)
.

MIPS1

Col

atrx5/6

mips1
-
1

Relative


expression

Supplemental figure S6

Supplemental

figure

S
6
:

MIPS
1

mRNA

accumulation

is

decreased

in

atxr
5
/
6

double

mutants
.

Real
-
time

PCR

quantification

of

the

MIPS
1

mRNA

accumulation

was

performed

using

Col
0

and

mips
1
-
1

as

controls
.

Error

bars

represent

sd

values

from

at

least

three

repetitions
.

Supplemental figure S7

mips1
-
1

PMIPS1::GUS

mips1
-
1

PMIPS1::GUS

Zebularine


-

+

Supplemental

figure

7
:

Spatial

expression

pattern

of

MIPS
1

promoter

in

mips
1
-
1

treated

or

not

with

zebularine

50
µM
.

Promoter

activity

was

visualized

via

GUS

staining
.


Supplemental figure S8

0
5
10
15
20
25
Col

PMIPS1::GUS

ddm1

PMIPS1::GUS#1

uidA

Supplemental

figure

S
8
:

Real
-
time

PCR

quantification

of

the

uidA

reporter

expression

driven

by

MIPS
1

promoter

in

the

wild

type

and

ddm
1
-
2
.

0
0.2
0.4
0.6
0.8
1
2
3
4
5
6
7
8
9
10
0
0.1
0.2
0.3
0.4
1
2
3
4
5
6
7
8
9
10
H3K27me1

H3K9ac

Col

Col+flg22

Col

Col+flg22

Supplemental figure S9


%of input

%of input

Supplemental

figure

S
9

A
.

Acetylation

of

H
3
K
9

decreased

in

the

MIPS
1

promoter

after

flg
22

treatment
.

H
3
K
9
ac

state

at

the

whole

MIPS
1

locus

was

analyzed

by

ChIP

on

chromatin

extracted

from

Col
0

treated

or

not

with

flg
22

using

an

anti
-
H
3
K
9
ac

antibody
.

t
.

Error

bars

represent

sd

values

from

at

least

three

repetitions
.


B
.

Methylation

of

H
3
K
27

increases

in

the

MIPS
1

promoter

after

flg
22

treatment
.

H
3
K
27
me
1

state

at

the

whole

MIPS
1

locus

was

analyzed

by

ChIP

on

chromatin

extracted

from

Col
0

treated

or

not

with

flg
22

using

an

anti
-
H
3
K
27
me
1

antibody
.

Error

bars

represent

sd

values

from

at

least

three

repetitions
.

A

B

0
0.2
0.4
0.6
0.8
1
1
2
3
4
5
6
7
8
9
10
Total H3

Col

mips1
-
1

Col+flg22

%of input

Supplemental

figure

S
10

Total

Histone

H
3

occupancy

on

MIPS
1

locus
.

The

total

H
3

at

the

whole

MIPS
1

locus

was

analyzed

by

ChIP

on

chromatin

extracted

from

mips
1
-
1

and

Col
0

treated

or

not

with

flg
22

using

an

anti
-
H
3

antibody
.

Error

bars

represent

sd

values

from

at

least

three

repetitions
.


Primer
name

DNA sequence (5' to 3')

1
-
for

GGACATAATCAAGCGTACGAGA

1
-
rev

CATTTTGTATAAAGGGTGATGTTGA

2
-
for

CGAGAGCCAAGATCACACGTTT

2
-
rev

TCAGATTTGGGTGTGGCATGTT

3
-
for

AGGTACCTTGAAATCATCGGCA

3
-
rev

TGGGTTTGACACGTGAATTACCTT

4
-
for

CCAAACGACCGTTAACACCGAT

4
-
rev

TGTCAATTGGTCGCCGTAGGAA

5
-
for

AGGTCCCATGTTGACGAAAC

5
-
rev

CATTTTTGTGGGGAACGTTAG

6
-
for

TCTATCTCCCTTGCTGTCTCGTCT

6
-
rev

TCGGAATTTGGATCGGTTTTGGGG

7
-
for

GACCGTCAATGGCACTTACC

7
-
rev

GACACGAATATCGGTTTTGAAAT

8
-
for

GAAGAGATCTATGCTCCTTTCAAGA

8
-
rev

AAAAGCTAGCTAATCACCAACCA

9
-
for

TCATGGAGTCTGTGGATAGGG

9
-
rev

CACAAGCAATCGCATAAAGTG

10
-
for

GGGCTATGCTGGAGAATATTATGA

10
-
rev

ATTCATGCTTCTTCATGTTCACTT

GUS_for

TGCTGTCGGCTTTAACCTCT

GUS_rev

TGAGCGTCGCAGAACATTAC

Supplemental

table

I

:

List

of

primers

used

in

this

study
.