Bioinformatics - Primer Design - CTE Online

moredwarfΒιοτεχνολογία

1 Οκτ 2013 (πριν από 3 χρόνια και 8 μήνες)

82 εμφανίσεις


1

Bioinformatics
-

Primer Design


In lab, if you want to isolate a segment of DNA or RNA

using PCR
, you must first
design primers to locate that specific segment
.



In this activity, you are going
to
work off NCBI and the Human Genome Project.
You will:


1.

C
hoose a genetic disease.

2.

Find a locus on the gene that is associated with the disease.

3.

Find the location and sequence the disease
-
causing portion of the gene.

4.

Identify the exon (protein coding) portion and intron (non
-
protein coding)
portion of the sequenc
e.

5.

Choose one exon to work with.

6.

Design forward and reverse primers that would amplify the specific exon
segment of DNA.


Procedure:

1.

Go to
www.google.com
. Type in NCBI into the search engine.


2.

Click on “NCBI Homepag
e.” NCBI stands for National Center for
Biotechnology Information. The address to go straight to NCBI is
www.ncbi.nlm.nih.gov
.



3.

Click

on the drop down box next to

Search.”



4.

Choose the “Nucleotide” sear
ch.


5.

In the next blank drop down box
(next to “for”) type in your locus
accession. This is the locus you
signed up for in Table 1.


6.

Click the “GO” button.







2

7.

Click the blue number next to the title “CoreNucleotide Records.”



8.

Your specific locus
for your disease should come up. Click on the link to
take you to that report.


9.

Make sure your information is from Homo sapiens (humans) by looking
under “SOURCE.”

Fill this information into table 2.


10.


Check and record
in table 2
how many bases are being

referenced in
your disease.


11.


Read through the information and discover exactly what disease the locus
you are looking
at deals with
.

If you click on the numbers next to
“PUBMED” a summary of that article will pop up and give you a lot of
details. R
ecord the
name of the disease in

table

2
.













Source

Base
Reference

PUBMED


3


12.

You want the sequence from the mRNA strand. If you scroll down you will
find “Origin.” Highlight the entire mRNA sequence. Copy the sequence
using either your right click


Copy or EDIT


COPY.



















13.

Do not include the poly
-
A tail at the end of the sequence. Highlight
everything except the multiple A’s at the end. Only some of you will have
this.

















14.


Open a new window in your internet browser. Do this by clicking on
FILE


NEW


WINDOW.




Origin

Do not highlight
the poly
-
A tail.


4

15.


Go to
http://genome.ucsc.edu
. You will use this site to determine what
portions of your mRNA strand code for proteins (exons) and which
portions do not code for proteins


or non
-
coding sect
ions (introns).

It will
also tell you exactly where in the human genome the locus can be found.


16.


Click on “BLAT.”




17.

In the white box under GENOME


HUMAN, use your right click to paste
your mRNA sequence.



18.


Click “Submit.”

Paste
mRNA

sequence
in this
box.


5

19.


Choose the
query

that i
s 100% under “IDENTITY” (or as close to 100%
as
possible). To choose, click on “DETAILS.”


20.


Find your specific chromosome and locus location on top of the page.
Reco
rd this information in

table

2
.


21.


You need to also choose
one

exon
from the entire
gene
to i
solate and
design primers for.
To choose an exon, click one of your “block1”
,

block2”, “block 3”, etc.




Details


6


22.


Those nucleotides (A, T, G, and C) that are blue are your exons


or
portions of mRNA that code for proteins. Those nucleotides that ar
e black
are introns


or non
-
coding segments. Choose a “block” or exon that has
enough blue nucleotides to isolate and minimally 100 black nucleotides
before and after the blue segment.















23.


It is now t
ime to design primers to cut out

your ex
on. You need to design
both forward and reverse primers



a primer on the top of your exon and a
primer on the bottom of your exon. To be an ideal primer, it should
:

a.

B
e 20 base pairs (bp)
long.

b.

Be 50% G and C for stability

(meaning the other 50% is A and

T)
.

c.

Be about 50 to
150 bp away from the exon.

d.

End in G or C. This is really hard to do, so don’t worry if you can’t
get your primers to end in G or C.

e.

Do not choose a sequence that is complementary to itself and will
fold into a hairpin. For example ACA
CAC…GTGTGT will fold on
itself because it is complement to itself.


24.


First we will work on the forward primer. You want to find a series of 20
bases about 50
-
150 bp away from the
start of the
exon:

Exon


7


25.

After you have chosen 20 bases, make sure that there is

a total of 10 G
and C’s (or 50%). If you met that requirement, you can try to find one that
ends in a G or C to make sure it is the most stable primer you can design.
If you cannot find this combination, don’t worry. It is more important to
design a pr
imer that is 50% G and C. Remember to record your forward
primer sequence in table 2
.


26.


Next we will design the reverse primers
. Similarly to your forward primer,
find a series of 20 bases about 50
-
150 bp away from the end of the exon.

27.

The reverse prime
r needs to be reverse compliment to the segment you
chose. For example, from the segment above “gc tgaattaacc ccctgaac”
you need to first make the opposite DNA strand:

EXAMPLE:
NM_000330 Retinoschisis

Set of 20 bases for reverse primer

gctgaattaaccccctga
ac

Opposite DNA strand

cgacttaattgggggacttg


Do the same in the following table for the set of 20 primers you chose:


YOUR PRIMER:

Set of 20 bases for reverse primer


Opposite DNA strand



28.

Now you must make the primer go in th
e reverse direction:

EXAMPLE:
NM_000330 Retinoschisis

Opposite DNA strand

cgacttaattgggggacttg

Reverse Direction

caag
tcccccaattaagtcg



8




Do the same in the following table for the set of 20 primers you chose:


Your Primer:

Op
posite DNA strand


Reverse Direction



29.


Record your reverse primer in table 2.


30.


You are finished with your disease. When another team of two students
finish
es
, go and share your findings with one another. Record the
information from the other group in

table 2.








Extensions:

-
You can do an oligo calculation using the website:
http://www.basic.northwestern.edu/biotools/oligocalc.html

-
Students enter forward and reverse primer

sequence into the appropriate
window. Click on calculate to determine
hairpin

loops, primer conditions and
melting
temperatures
. Students may also BLAST their primer sequences. Play
with the website and have fun!


Acknowledgements:

Furtado, Manohar (20
07). Lead Scientist, Foster City, Applied Biosystems.

Pawar, Hemant (2007). Lead Scientist, Foster City, Applied Biosystems.

Vatta, Paolo (2007). Lead Scientist, Foster City
, Applied Biosystems.

Fang, Rixun (2007). Lead Scientist, Foster City, Applied B
iosystems.



9

Table 1: Locus Accession Numbers and Student Sign
-
Up

Locus Accession Number

Student Name

NM_00033
0

Example completed in class

NM_004999


NM_058164


NM_139281


NM_012151


NM_000133


Z68193


NM_001079878


DD_323416


NM_007144


NM_0198
94


NM_018897


EF550135


NM_003018


NM_005166


NM_003127


NM_001085427


NM_000249


AB271913


BC148442




Table 2: Individual Primer Design

Locus
Accession

Disease

Source

Base
Reference
(# of
bases)

Specific
Chromosome
& Locus
Location

Exon
You
Ch
ose
to
Isolate

Forward
Primer

Reverse
Primer

NM_000330

Retinoschisis

Homo
Sapiens

1 to 3046

Chr X:
18567731
-

18600150

3

tggccattgt
agcaaagctg
(18584901)

caagtccccc

aattaagtcg
(18584601)



















10



Rubric
Bioinformatics
-

Primer Design





















Teacher Name:
Tina Doss














Student Name:




________________________________________







CATEGORY

4

3

2

1

Information
Gathering

Accurate
information taken
from several
sources in a
systematic manner.

Accurate
information
taken
from a couple of
sources in a
systematic manner.

Accurate
information taken
from a couple of
sources but not
systematically.

Information taken
from only one
source and/or
information not
accurate.

Scientific
Knowledge

Explanations by all
group membe
rs
indicate a clear and
accurate
understanding of
scientific principles
underlying the
construction and
modifications.

Explanations by all
group members
indicate a relatively
accurate
understanding of
scientific principles
underlying the
construction and
m
odifications.

Explanations by
most group
members indicate
relatively accurate
understanding of
scientific principles
underlying the
construction and
modifications.

Explanations by
several members
of the group do not
illustrate much
understanding of
scienti
fic principles
underlying the
construction and
modifications.

Plan

Plan is neat with
clear
measurements and
labeling for all
components.

Plan is neat with
clear
measurements and
labeling for most
components.

Plan provides clear
measurements and
labeling f
or most
components.

Plan does not
show
measurements
clearly or is
otherwise
inadequately
labeled.

Data Collection

Data taken several
times in a careful,
reliable manner.

Data taken twice in
a careful, reliable
manner.

Data taken once in
a careful, reliabl
e
manner.

Data not taken
carefully OR not
taken in a reliable
manner.

Function

Structure functions
extraordinarily well,
holding up under
atypical stresses.

Structure functions
well, holding up
under typical
stresses.

Structure functions
pretty well, but
deteriorates under
typical stresses.

Fatal flaws in
function with
complete failure
under typical
stresses.









TOTAL:_____/20