Breaking barriers: getting biologists involved in everyday data ...

lilactruckInternet και Εφαρμογές Web

4 Δεκ 2013 (πριν από 3 χρόνια και 6 μήνες)

59 εμφανίσεις

Breaking Barriers:

getting biologists involved in everyday data integration
using Moby

Paul Gordon

Genome Canada Bioinformatics Platform

University of Calgary, Canada

Outline



concept, usage, future



Getting Biologists Involved:
Seahawk &

DNASequence

NCBI_gi

Sequence_Alignment

Core Moby Service

Providers in Europe

Founding partner

SADI In A Nutshell


As OWL Axioms


HomologousMutantImage

is owl:equivalentTo {


Gene Q
hasImage

image P


Gene Q
hasSequence

Sequence Q


Gene R
hasSequence

Sequence R


Sequence Q
similarTo

Sequence R


Gene R = “my gene of interest”
}

Mobify the World.

Paul’s Maxims


You cannot get rid of work


You can:


Distribute work amongst parties with
vested interests & required
capabilities


Avoid redoing the same work
repeatedly

Agenda


Motivation


Audience


Mechanism

Larry Wall’s “Virtues of a Programmer”

HUBRIS

LAZINESS

IMPATIENCE

Audience

God

Amoeba

Self
-
perception of computer skills

Man’s Prayer


I’m a man…


But I can change…


If I have to…


I guess…


Bioinformatician

Take the output of the

U of C service and send it

to iHOP, then send its

output to DDBJ’s service…


myGRID RDF

Semantic Annotations for WSDL

bioxml.info

MOB Rule Syntax

>gi|12434353 glycerol kinase

cgatcagcatcgactagcatcgactatttgctatcat

cagctacgatcagctacgactac…

Shared Responsibility

Tu deviens responsable pour toujours de ce que tu as apprivoisé.




Service Providers



Proxy Provider



Third Party Developers



Biologists

SAWSDL Required Infrastructure

Calgary (Sun v240)

Calgary

Anywhere

Anywhere

Compute Cloud

(e.g. Calgary or Google App Engine)

To Do


Formal user studies


HTML Form wrapping


Enactment portal


Biocatalogue?

If you can not measure it, you can not improve it.


Lord Kelvin

Acknowledgements