Section 13-2

igocheddarΒιοτεχνολογία

14 Δεκ 2012 (πριν από 4 χρόνια και 10 μήνες)

199 εμφανίσεις

Mutations

Germ Mutations


Affect only the reproductive cells (egg &
sperm)


Mutation passed on to offspring


Somatic Mutation


Affect only body cells


Mutation NOT passed on to offspring

Point Mutations (1 nucleotide is affected)


Substitution (
May

change in ONE amino acid)


Insertion (Frameshift mutation)


Deletion (Frameshift mutation)


Frameshift mutations


DNA sequence is “shifted” left or right


Downstream codons are changed…drastic change in the
protein.


**We ALL have some potentially dangerous mutations


Polyploidy


More than two sets of chromosomes.


Occurs because of a problem in
chromosome separation in Meiosis, call
Nondisjunction.















All gametes are haploid; they each have one copy of each chromosome.
When two gametes are used for fertilization, each new cell should be
have two copies of each chromosome and be diploid.


Normal Meiosis should produce haploid gametes.


Nondisjunction in Meiosis I:



Nondisjunction in Meiosis II:



Selective Breeding

Pick best traits and cross them (potato)


1. Inbreeding

Cross those with similarities (Dogs)

Can result in an increase in genetic defects in inbred
population. (cheetahs, dogs)

2. Hybridization

Cross those with different characteristics

Results in hardier offspring (Corn)

3. Mutagens

Create mutations using chemicals, UV light, etc.

Selection for best or most desirable traits

(seedless grapes)

Genetic Engineering

(Techniques that directly affect the DNA)


1.
DNA Extraction

2.
Polymerase Chain Reaction (PCR)

3.
Restriction Enzymes (RE) cut DNA

4.
DNA Fingerprints

5.
Transformation (Recombinant DNA)

6.
Gene Therapy

7.
Cloning (Somatic Cell Nuclear Transfer)

8.
DNA Sequencing



DNA Extraction

(Get DNA out of the cell.)


“Mash up cells” (blend)

Add Water

Add Salt

Add baking powder

Add detergent


Breaks down cell membrane


Dissolves lipids and proteins

Filter out solution

Add solution to cold isopropyl alcohol

DNA is not soluble in alcohol

See stringy white DNA

P
olymerase
C
hain
R
eaction (PCR)

Heat

Add Primer

Add A, C, G, T

Add DNA Polymerase

Repeat 20
-
30 cycles

Millions of copies of the
desired portion of DNA!

DNA polymerase adds
complementary strand

DNA heated to
separate strands

DNA fragment
to be copied

PCR

cycles 1

DNA

copies 1

2


2

3


4

4


8

5 etc.


16 etc.

Section 13
-
2

Figure 13
-
8 PCR

Go to
Section:

Restriction Enzymes (RE)

Cut DNA at
specific

base sequences



CTTAAG


GAATTC

Example of
Eco
RI RE



AACTTAAGTTTTTCTTAAGCCC


TTGAATTCAAAAAGAATTCGGG


RE’s leave fragments that have “sticky ends”.

These ends have unpaired bases.

AAC T T A A






GCCC

TTG





AAT T CGGG


Recognition sequences

DNA sequence

Restriction enzyme

EcoR
I
cuts the DNA
into fragments.

Sticky end

Section 13
-
2

Restriction Enzymes

Go to
Section:

Recognition sequences

DNA sequence

Restriction enzyme

EcoR
I
cuts the DNA
into fragments.

Sticky end

Section 13
-
2

Restriction Enzymes

Go to
Section:

DNA plus restriction
enzyme

Mixture of DNA
fragments

Gel

Power
source

Longer
fragments

Shorter
fragments

Section 13
-
2

Figure 13
-
6 Gel Electrophoresis

Go to
Section:

DNA Gel Electrophoresis



Original Well

A

B

C

D

DNA is negatively charged

DNA moves away from negative (
-
) terminal; and towards
the positive (+) terminal

Shortest pieces move through porous gel fastest.

Longest pieces move more slowly.

Thickest bands represent most common fragment size.


A is longest fragment.

D is shortest fragment.

D is also the most common fragment length.

DNA Fingerprint is read.

Blood

DNA is
Extracted

PCR Copies a
segment of DNA

DNA is broken Into
fragments by
Restriction Enzymes


Gel Electrophoresis

(separates based on size)

Radioactive Probes


Label DNA

DNA
---

Person 1


TTGTGGCCCCCCAATTGTT 1

CTTAGAAAGGAGGGGAAGT 2

ATGAGATTTTTTTTTAGGC 3

ACACACAAGAGATATAGAG 4

AAAAATTGTGGTGTAGAGC 5

CCCCGAAAAAAAAAAAACA 6

CACACAAGATAGATGTGTG 7

TGCGCGCGGGGGGGAATAA 8

CAGTGTTGTATTAATTTAT 9

AGAAAATAAGATATATGGG 10

DNA
---

Person 2


TTGTGGCCCCCCAATTGTT 1

ATTAGAGGGGAGGGGAAGT 2

ATGAGATTTTTCTTTATGC 3

ACACACATGAGATATAAAG 4

AACAATTGTGGTGTAGAGC 5

CCCCGAAAACCCCAAAACA 6

CACAAAAGATAGATGTGTG 7

TGAGCGCGGGGGGGAATCT 8

CAGTGTTGTATTAACCTAT 9

AGAAAATTTGATATATGGG 10

DNA
---

Person 1

TTGTGGCCCCCCAATTGTTCTTAGAAAGGAGGGGAAGT
ATGAGATTTTTTTTTAGGCACACACAAGAGATATAGAGA
AAAATTGTGGTGTAGAGCCCCCGAAAAAAAAAAAACAC
ACACAAGATAGATGTGTGTGCGCGCGGGGGGGAATAA
CAGTGTTGTATTAATTTATAGAAAATAAGATATATGGG


DNA
---

Person 1

TTGTGGCCCCCCAATTGTTCTTAGAAAG

GAGGGGAAG

TATGAGATTTTTTTTTAGGCACACACAAG

AGATATAGAGAAAAATTGTGGTGTAGAGCCCCCGAAAAAAAAAAAACACACACAAG

ATAGATGTGTGTGCGCGCGGGGGGGAATAACAGTGTTGTATTAATTTATAGAAAATAAG

ATATATGGG


DNA
---

Person 2

TTGTGGCCCCCCAATTGTTATTAGAGGGGAGGGGAAGT
ATGAGATTTTTCTTTATGCACACACATGAGATATAAAGA
ACAATTGTGGTGTAGAGCCCCCGAAAACCCCAAAACAC
ACAAAAGATAGATGTGTGTGAGCGCGGGGGGGAATCT
CAGTGTTGTATTAACCTATAGAAAATTTGATATATGGG


DNA
---

Person 2


TTGTGGCCCCCCAATTGTTATTAGAGGGGAGGGGAAG

TATGAGATTTTTCTTTATGCACACACATGAGATATAAAG

AACAATTGTGGTGTAGAGCCCCCGAAAACCCCAAAACACACAAAAG

ATAGATGTGTGTGAGCGCGGGGGGGAATCTCAGTGTTGTATTAACCTATAGAAAATTTGATATATGGG


DNA Person #1

DNA Person #2

TTGTGGCCCCCCAATTGTTATTAGAGGGGAGGGGAAG

AACAATTGTGGTGTAGAGCCCCCGAAAACCCCAAAACACACAAAAG


TATGAGATTTTTCTTTATGCACACACATGAGATATAAAG


ATAGATGTGTGTGAGCGCGGGGGGGAATCTCAGTGTTGTATTAACCTATAGAAAATTTGATATATGGG



ATATATGGG

ATAGATGTGTGTGCGCGCGGGGGGGAATAACAGTGTTGTATTAATTTATAGAAAATAAG


AGATATAGAGAAAAATTGTGGTGTAGAGCCCCCGAAAAAAAAAAAACACACACAAG


TATGAGATTTTTTTTTAGGCACACACAAG

GAGGGGAAG

TTGTGGCCCCCCAATTGTTCTTAGAAAG


-


-


-



-

+


+



+



+



Blood from victim A



well 1



Blood from victim B



well 2




Semen collected on victim A


well 3



Semen collected on victim B


well 4



Blood from suspect X


well 5



Blood from suspect Y


well 6



Blood from suspect Z


well 7


Results from the Restriction Enzyme (RE) Digest:


1


2


3


4


5


6


7




Mother’s blood


well 1


Child’s blood


well 2


Possible Father 1


well 3


Possible Father 2


well 4



Possible Father 3


well 5


Who is the father?


Results from the Restriction Enzyme Digest:


Mother


Child


Father #1 Father #2 Father #3


Add RE

+

EcoRI RE site

“Sticky Ends”

INSULIN

INSULIN


“Recombinant DNA”


Insulin gene inside bacteria.

*Bacteria produce Human INSULIN!!!

EcoRI RE sites

TRANSFORMATION

Human Cell

Gene for human
growth hormone

Recombinant
DNA

Gene for human
growth hormone

Sticky
ends

DNA
recombination

DNA
insertion

Bacterial Cell

Plasmid

Bacterial
chromosome

Bacterial cell for
containing gene for
human growth hormone

Section 13
-
3

Figure 13
-
9 Making Recombinant DNA

Go to
Section:

Transgenic tobacco plant with a gene from a firefly.


Gene Therapy



Replace a defective gene with a good copy.



Put “good” gene into a virus. Have virus infect your cells.
Virus puts DNA (with good gene) into YOUR cells.



Not YET common. Best treatment so far has been
treatment of SCIDS. (Bubble Boy Syndrome).



Promising treatment for a form of muscular dystrophy and a
form of blindness known as Leber’s congenital amaurosis
(LCA).


Recombinant
plasmid

Gene to be
transferred

Agrobacterium
tumefaciens

Cellular
DNA

Transformed bacteria introduce
plasmids into plant cells

Plant cell colonies

Complete plant is
generated from
transformed cell

Inside plant cell,
Agrobacterium
inserts part of
its DNA into host cell
chromosome

Section 13
-
3

Figure 13
-
10 Plant Cell
Transformation

Go to
Section:

Cloning

Section 13
-
4

Flowchart

A body cell is taken from a donor animal.

An egg cell is taken from a donor animal.

The fused cell begins dividing, becoming an embryo.

The nucleus is removed from the egg.

The body cell and egg are fused by electric shock.

The embryo is implanted into the uterus of a foster mother.

The embryo develops into a cloned animal.

Go to
Section:

A donor cell is taken from
a sheep’s udder.

Donor
Nucleus

These two cells are fused
using an electric shock.

Fused Cell

The fused cell
begins dividing
normally.

Embryo

The embryo is placed
in the uterus of a foster
mother.

Foster
Mother

The embryo
develops normally
into a lamb

Dolly

Cloned Lamb

Egg Cell

An egg cell is taken
from an adult
female sheep.

The nucleus of the
egg cell is removed.

Section 13
-
4

Figure 13
-
13 Cloning of the First
Mammal

Go to
Section:

Fluorescent
dye

Single strand
of DNA

Strand broken
after A

Strand broken
after C

Strand broken
after G

Strand broken
after T

Power
source

Gel

Section 13
-
2

Figure 13
-
7 DNA Sequencing

Go to
Section:

The Future of DNA Sequencing?

Pacific Biosciences SMRT DNA Sequencing

DNA Sequencing in under an hour for $100?

http://www.pacificbiosciences.com/video_lg.html

The Power of RNAi (RNA Interference)

RNAi NOVA Video 15 min

http://www.pbs.org/wgbh/nova/sciencenow/3210/02.html


Can we bring back extinct organisms?

60 Minutes "Resurrecting the Extinct" (12 min)

http://www.cbsnews.com/video/watch/?id=6078982n&tag=contentMain;cbs
Carousel


Quick Video from HHMI

HHMI 2002 Holiday Lecture Series

http://media.hhmi.org/hl/02Lect1.html

41:46


Clip 26 through 50:00 (8 minutes)

1000 Smell receptors