BIOTECHNOLOGY AND GENETIC ENGINEERING

igocheddarΒιοτεχνολογία

14 Δεκ 2012 (πριν από 4 χρόνια και 10 μήνες)

241 εμφανίσεις

BIOTECHNOLOGY AND
GENETIC ENGINEERING

Text reading

LAB Lyle and Louis Murder Mystery

LAB Splicing a plasmid

LAB Extracting DNA

Worksheet “Gene Technology”

Worksheet

Chap 16 DNA Tech

Web activity
http://learn.genetics.utah.edu/content/labs/gel/

Important 3
rd

Quarter Dates:


Bonus #1


Feb. 18


Bonus #2


March 18


CP #1
-

Feb 11


CP #2


March 11


Video


April 6


Vocabulary (69
-
75) restriction
enzyme, plasmid, gene cloning, gene
therapy, chimera, hybrid


read 226
-
228, 234,236
-
239, 246, 247
for next section on genetic
engineering


BIOTECHNOLOGY ARTICLES TO
READ
(ques. due Wednesday) (13 pts.)


Definitions…


Technology



any tool that makes life easier
(toothpick, phone, space shuttle, screwdriver,
computer)


Biotechnology



the tool is a living creature
that makes our life easier or better (usually
dealing at the cellular or DNA level but might
also include a cow pulling a plow)


Genetic Engineering

-

modification of the
DNA in an organism or exchange of DNA
between organisms


why would we want to do
this?

BASICS OF INHERITANCE


DNA

is the
hereditary
molecule


BLUE PRINT

for
all traits


Universal and
Interchangeable

HUMAN CHROMOSOMES


Coiled strands
of DNA


23 pairs of
chromosomes


23 from


egg


23 from


sperm

DNA EXTRACTION LAB


Crack open cells (squishing bag of fruit)


Extract DNA (salty soapy solution)


Isolate DNA (cold ethanol)


Stringy and clumpy DNA


how does this
fit with what we learned last chapter?


Is strawberry DNA the same as human
DNA?


Would we extract human DNA the same
way?

I. Sexual reproduction


ADD DRAWING TO NEXT PAGE

II. Hybrid


Offspring produced by the mating of
different species.


Every cell contains DNA from both
species


Can you name some hybrid animals?
Peekenese and a poodle = peek
-
a
-
poo


Horse and a donkey= mule



ADD DRAWING TO NEXT PAGE

Wolf/dog hybrid

Liger or tiglon

Zonkey or zedonk

Llamal llama/camel hybrid

III Chimera



Produced in the laboratory


EMBRYO FUSION
-

see article on "GEEP"


Draw diagram of hybrid and chimera

III Chimera



Produced in the laboratory


EMBRYO FUSION
-

see article on "GEEP"


Draw diagram of hybrid and chimera

GEEP

IV IN VITRO FERTILIZATION



Test tube babies


Procedure


female injected with hormones to cause
ovulation of many eggs


Male donates sperm


Egg and sperm are mixed in a dish in a
lab to create embryos


Embryo implanted in surrogate mother

Test Tube Babies


In Vitro
Fertilization
(IVF)

and
Embryo
Transfer
(ET)


20% success
rate


Can be used for :


Infertile couples


Experimentation


Increase the population of
endangered species


QUESTION? What do we do with
the left over human embryos?

V. Surrogate Motherhood


VI Genetic Engineering
and Moving Genes


-
Human Genome Project (video) HGP
READ pg. 236


-
(HGP)sequence all the base pairs in the
human genome (2
-
3 billion pairs)







(100,000 genes)


-
genome

-
all the possible bases in a
species or individual


gene
-

DNA sequence that codes for a
protein. The protein may lead to a
visible trait (I.e. eye color, hair texture,
blood type etc)


Genetic Disease
-

disease caused by
a defective or mutant gene.
Considered hereditary, if it can be
passed on to the next generation (i.e.
Huntingtons, Sickle Cell are major
examples)

MOVING GENES
(the basics)


Recombinant DNA involves 4 steps


Procedure


1. DNA is cut and desired gene is
removed


2. gene is attached to a vector for delivery
into another cell


3. cloning
-

multiple copies of the gene
are made by allowing the host cell to
multiply


4. screening
-

cells with the new gene are
sorted from the multitude produced

BT Corn

Insulin
from

bacteria

Artificial
insemination
or embryo
transfer

How is the DNA cut?


Restriction enzymes
-

recognize a
specific DNA sequence and cuts it at
every location


How is the DNA delivered? Viruses,
yeast or plasmid can be used.


A plasmid is a loop of DNA that are
independent of the main DNA of a
bacteria cell.


The same restriction enzyme is used to
open the plasmid.


Nucleotide pairs on the end of the gene
and plasmid join in a complimentary
fashion.


The gene is now part of the host’s DNA

How is the DNA separated?


electrophoresis

VIII Moral and Ethical issues


WHY IS THIS BEING DONE?


HOW IS THIS BEING DONE?


WHO OR WHAT CAN IT BE DONE TO?


Should this be done?


Will anyone or any organism be injured?


Who will benefit from this research?


Are there alternatives to this procedure?


How will this be paid for?


What will be done after the process?


Is there a danger to the environment?

The Use of Animals in Science and Industry
Place an "X" in each box that you agree with the use of that species for that purpose.
Place an "NO" in each box that you do not agree with the use of that species for that purpose.
Place a "n/a" is placed where a decision is not applicable)
Animal Use
(general, - specif ic)
No animal of any kind should be used
for this purpose.
Any animal of any kind should be
used for this purpose.
Worms (invertebrate with simple
nervous system)
Octopi (invertebrate with advanced
nervous system)
Fish/ Zebrafish (vertebrate with
relatively simple nervous system)
Frogs (vertebrate with relatively
simple nervous system)
Birds/ Fowl (vertebrate with
relatively simple nervous system)
Rodent/Rat/Rabbit (vertebrate with
more advanced nervous system)
Cow/ livestock (vertebrate with
advanced nervous system)
Dog/Cat (vertebrate with advanced
nervous system)
Monkey (vertebrate with advanced
nervous system)
Chimpanzee (vertebrate with very
advanced nervous system)
sources of f ood (whole animal)
sources of f ood byproduct (i.e. eggs, milk)
industrial raw materials applications
- source of f abric/clothing (i.e. wool, leather)
- source of industrial molecules (i.e. rennin)
- testing of cosmetics
medical applications
- source of pharmaceutical molecules (i.e. insulin)
- source of transplant organs (i.e. valves, cornea)
transportation and laborers
laboratory test specimen
- testing of new drugs
- testing of environmental hazards
- f or endangered species protection
- f or broadening scientif ic knowledge
educational tools/teaching purposes
- dissection
- surgical practice
- behavioral observation
- physiological observation
companions/pets
Cloning Around



(reproductive cloning)


All
SOMATIC CELLS

(body
cells) contain DNA blueprint
for the individual organism


Any cell can behave like a
ZYGOTE to produce an entire
individual

HISTORY OF CLONING



1953

frog


1996

sheep

277


2002

cat


82


2003

horse

841


2005

dog


ATTEMPTS BEFORE
SUCCESS


CLONING BASICS



Reproductive
Cloning is
expensive and
inefficient


CC cost $50,000


Horse 1/841 .12%


Sheep 1/277 .36%

STEM CELL RESEARCH


What’s so
special about
Stem Cells?



Biological
immortality


Pluripotent
-

can become
any of 220
cell types

Therapeutic potential



Pancreas beta cells to
produce insulin to relieve
diabetes


Dopamine producing cells in
the brain to relieve
Parkinson’s disease


Regrowth of missing limbs


ADULT STEM CELLS


“cells in adult tissues that are
undifferentiated”


Multipotent

(can become many of the
220 cell types)


Sources


bone marrow, umbilical cord,


hair follicle, skin,


adipose cells, More are known



Most well know example of Adult
Stem Cell… bone marrow stem cells


TEST FRIDAY
BIOTECHNOLOGY

Text pages (226
-
228, 234, 236
-
239,246,247)

2 articles w/questions

Worksheets Gene tech and DNA tech

L and L Lab activity

Interpret electrophoresis banding patterns

Diagram and explain hybrids and chimera

Provide examples of above

Explain techniques and uses of IVF and ET

Vocabulary (68
-
75)

Be able to answer the question “Pick one example of
biotechnology that we have studied, explain what it
is and provide your view of the technology”


Biotechnology Test Review Questions:


Easy


Small, circular piece of bacterial DNA is called a ____.


Give two examples of vectors:


The entire collection of genes within human cells is called
the _______________.


Difference between technology and biotechnology?


Function of restriction enzymes?


HGP stands for? How many base pairs in HG? How
many proteins?


Difference between surrogate and biological mother?


A _____________ is caused by a defective or mutant
gene.


Define gene.


The first cell created by sexual reproduction is called a


Medium


1. Inserting unrelated pieces of DNA together will
result in ____________________.


2. IVF stands for? What is a synonym used for
IVF?


3. What does transgenic mean?


4. Identical twins are considered to be genetic
___________.


5. How does IVF work? What does the female
have to do? What does the male have to do?


6. Why does IVF sometimes result in twins, triplets,
or quads?


7. Difference between fraternal vs. identical twins?


8. How does Gel Electrophoresis separate DNA
fragments?


9. What is an example of a genetic disease?


10. What kind of ethical questions arise from IVF?


Difficult


What is the difference between gene therapy and
genetic engineering?


Difference between a hybrid and chimera?


Steps of genetic engineering?


The Hind R1 restriction enzyme is used to slice
DNA at the GAATTC between the G and C.
Illustrate how this enzyme would precisely cut the
fragment:


ATTAGATCGCCCTAGAATTCAAGCTGGTAGCTAGCTACATCTA


TAATCTAGAGGGATCTTAAGTTCGACCATCGATCGATGTAGAT


What research can be done using gel
electrophoresis?