Cartographie / Clonage positionnel

hearingstartΒιοτεχνολογία

23 Οκτ 2013 (πριν από 3 χρόνια και 7 μήνες)

549 εμφανίσεις

Cartographie / Clonage positionnel
1. Principe de la cartographie
Génétiqueclassique
ou
forwardgenetics
:
duphénotypeaugène
Quelestle
Génétique

classique

ou
«
forward

genetics
»
:
«
du

phénotype

au

gène
».
Quel

est

le

gène muté responsable du phénotype mutant ?
Généti
q
ue inverse ou «reverse
g
enetics» : «du
g
ène au
p
hénot
yp
e». Quel
au niveau de l’organisme: phénotype macroscopique
q
g
gpyp
phénotype est associé à la mutation du gène ?
au niveau des cellules: phénotype cellulaire
au niveau des molécules: phénotype moléculaire
2010 –L3 BIO58
1
Défit du clonage positionnel :
trouver une mutation parmi 120.106pb (120Mb) pour Arabidopsis thaliana
Organisme
Taille du génome (Mpb)
Nombre de gènes protéiques 
estimés
Virus de la grippe
0,013
Taille des génomes d'espèces modèles
Virus
Bactériophage
λ
〬〵
䉡捴楯灨慧B

〬ㄶ0
䵩浩癩牵M
ㄬ11㈶2
Mycoplasma pneumoniae
0,816689
Bactéries
Haemophilus
1,81657
Staphylococcus aureus
2,82619
Bacillus subtilis
4,24106
Escherichia coli
4,644243
Archaea
Nanoarchaeum equitans
0,49536
Pyrococcus abyssi
1,771898
Sulfolobus solfataricus
32977
Sacc
h
a
r
o
m
yces
 
ce
r
e
vi
s
i
ae
(
l
e
v
u
r
e)
12
5
863
Saccaoycesceesae
(eue)
5
863
Plasmodium falciparum
21,85314
Caenorhabditis elegans
(nématode
)
10022628
Drosophilamelanogaster
(
insecte
)
118
16
548
Eucaryotes
Drosophila
 
melanogaster
(
insecte
)
118
16
548
Arabidopsis thaliana
(plante)11927379
Populus trichocarpa
(peuplier)48545500
Z
ea mais(maïs
)500054606
Mus musculus
(souris)340030000
Homo sapiens
(homme)340026517
Amoebadubia
675 000
Cartographie / Clonage positionnel
Prérequis :
-Phénot
yp
e dû à une seule mutation mendélienne :
yp
si un phénotype est dû à deux mutations génétiquement très liées, le clonage
positionnel sera problématique.
-Polymorphisme
Polymorphisme de l’ADN
Polymorphisme: variabilités d'origine génétique des populations. 
Une population est dite polymorphe si dans cette population une portion d'ADN a une 
variation de séquence correspondant à plusieurs formes alléliques. 
Nb: un gène polymorphe possède au moins deux allèles ayant une fréquence supérieure 
ou égale a 1%. S'il ne possède pas deux allèles avec une fréquence supérieure ou égale 
à 1% mais que le gène existe quand même en plusieurs exemplaires, il est polyallélique
(
)
(
un gène polymorphe est donc obligatoirement polyallélique
)
.
écotype:Variétéd'uneespèce(généralementvégétale)génétiquementadaptéeàun
milieuparticulierqu'elleoccupenaturellement,maisconservantsesadaptations
héréditaireslorsqu'ellesedéveloppedansunmilieudifférent(Larousse)
Ecotypes Arabidopsisthaliana
http://www.arabidopsis.org/i/arabidopsis_ecotype_map.jpg
htt//btt/
Principe : La cartographie génétique est basée sur l’analyse des événements de
recombinaison génétique
qui se sont produits entre les marqueurs
et le locus étudié
.
Plus un marqueur sera génétiquement proche de la mutation moins il aura de
chances de recombiner avec celle-ci.
les gènes sont liés
(sur le même chromosome)
les génes sont indépendants
(sur des chromosomes différents)
gamétes:
AB, Ab, aB, ab
> 1/4
> 1/4
gamétes:
AB, ab
+ recombinants
< 1/4
< 1/4
50% recombinants => génes non-liés
< 50% recombinants=> génes liés
En réalisant des croisements entre génotypes polymorphes
et à
partir des fréquences de recombinaison entre gènes liés, on peut
faire des cartes de liaisons génétiques qui reflètent la structure des
chromosomes
la précision des cartes dépend du nombre de marqueurs utilisés, les
p
remières cartes ont été faites en observant des caractères
morphologiques ou biochimiques simples (peu de gènes)
ilidiliidédl’ADN
autant ut
ili
ser
di
rectement
l
es var
i
at
i
ons
d
e s
é
quence
d
e
l’ADN
->
marqueurs moléculaires
Carte génétique Arabidopsis
Cartographie / Clonage positionnel
1.Principe de la cartographie
2.Marqueurs moléculaires
2010 –L3 BIO58
9
Marqueurs 
moléculaires
moléculaires
1-Restriction Fragment Length Polymorphisms (RFLPs)
2-Cleaved Amplified Polymorphic Sequences (CAPS)
3-Simple Sequence Length Polymorphisms (SSLPs)
/
SimpleSequenceRepeats(SSR):Microsatellites
/

Simple

Sequence

Repeats

(SSR)

:

Microsatellites
6-Single Nucleotide Polymorphisms (SNPs)
Cartographie / Clonage positionnel
1.Principe de la cartographie
2.Marqueurs moléculaires
3
Céid’lidhi
3
.
C
r
é
at
i
on 
d’
une popu
l
at
i
on 
d
e cartograp
hi
e
2010 –L3 BIO58
15
Génétique classique ou «forward genetics» :
«du phénotype au gène/génotype»
Quel est le gène muté responsable du phénotype mutant ?
au niveau de l’organisme: phénotype macroscopique
au niveau des cellules: phénotype cellulaire
au niveau des molécules: phénotype moléculaire
Phénotype: Ensemble des caractères observables d'un individu. Le phénotype
correspond à la réalisation du génotype (expression des gènes) mais aussi des
effets du milieu, de l'environnement
Clonage positionnel d’une mutation récessive chez Arabidopsisthaliana
1.CroisementdelalignéepureA(écotype)homozygoteprésentantlamutationavecune
autrelignéepure(écotype)Bhomozygotepolymorphe‐>F1hétérozygote(hybrideF1)
2.autofécondationd’unindividuF1etgénérationd’unepopulationF2(qqmilliersde
plantes)chezlaquelledesrecombinaisonssontintervenuesentreleschromosomesAetB
3.recherched’individus
p
résentantle
p
hénot
yp
emutant
,
donchomoz
yg
otes
(
a
y
antdeux
i
e
p
pyp
,
yg
(y
portionsdechromosomesissusdeA)
4.génotypaged’environ150F2homozygotespourlamutationavec20‐30marqueurs
répartis
sur
tout
le
génome
(
20
cM)
et
différenciant
les
lignées
A
et
B

>
recherche
de
r
tograph
i
répartis
sur
tout
le
génome
(
20
cM)
et
différenciant
les
lignées
A
et
B
>
recherche
de
séquencesdeBlesplusprochesdelamutationvenantdeA,cartographiegrossiéredela
mutationàquelquesdizainesdecM,encadrementdelamutationpardeuxmarqueurs.
5
A
partir
de
3
4000
plantes
recherche
d

événements
de
recombinaison
entre
les
deux
ca
r
5
.
A
partir
de
3

4000
plantes
,
recherche
dévénements
de
recombinaison
entre
les
deux
marqueursencadrantlamutationpourconstruireunecartegénétiquefinedelarégion
contenantlamutational’aided’autresmarqueursconnus(intérêtdelaséquencedu
génome,
soit
les
marqueurs
sont
déjà
connus,
soit
on
peut
en
générer
d

autres
rapidement)
.
génome,
soit
les
marqueurs
sont
déjà
connus,
soit
on
peut
en
générer
dautres
rapidement)
.
Défintiond’unintervalledequelquesdizainesdekilobases(0,1‐0,2CM)
6.Clonagedelarégion,séquençage,comparaisonavecséquencesauvageA,identification
du
gène
mutant
vérification
par
complémentation
du
mutant
avec
l’
alléle
sauvage
du
gène
mutant
,
vérification
par
complémentation
du
mutant
avec
l
alléle
sauvage
(transformation).
Clonage positionnel d’une mutation récessive chez Arabidopsisthaliana(2n)
1.
Croisementdelalignéepure
Ler
homozygoteprésentantlamutation
*
avecune
1.
 
Croisement
 
de
?
la
?
lignée
?
pure
?
Ler
homozygote
?
présentant
?
la
?
mutation
??
avec
?
une
?
autre lignée pure Col homozygote polymorphe ‐> F1 hétérozygote (hybride F1)
Nb: 1% de différence au niveau de l’ADN entre les écotypes Leret Col.
Clonage positionnel d’une mutation récessive chez Arabidopsisthaliana(2n)
2
.
autofécondation
d

un
individu
F
1
et
génération
d

une
population
F
2
(
qq
milliers
de
plantes)
2
.
autofécondation
dun
individu
F
1
et
génération
dune
population
F
2
(
qq
milliers
de
plantes)
chezlaquelledesrecombinaisonssontintervenuesentreleschromosomesLeretCol
Vision générale de la méiose. Durant l'interphase, le matériel génétique
sedupliqueetilseproduitlephénomèned
'
enjambement(représenté
se

duplique

et

il

se

produit

le

phénomène

denjambement

(représenté

par des chromosomes rouges et bleus qui se recombinent). Durant la
méiose réductionnelle, les chromosomes homologues se répartissent
endeuxcellulesdistinctesPuisdurantlaméioseéquationnelle
en

deux

cellules

distinctes
.
Puis

durant

la

méiose

équationnelle
,
comme lors d'une mitose, ce sont les chromatides de chaque
chromosome qui se séparent. Il en résulte quatre cellules haploïdes (n).
Clonage positionnel d’une mutation récessive chez Arabidopsisthaliana
3
.
recherche
d

individus
F
2
présentant
le
phénotype
mutant,
donc
homozygotes
(ayant
deux
3
.
recherche
dindividus
F
2
présentant
le
phénotype
mutant,
donc
homozygotes
(ayant
deux
portionsdechromosomesissusdeLer)
Clonage positionnel d’une mutation récessive chez Arabidopsisthaliana
4
.
génotypage
d

environ
150
F
2
homozygotes
pour
la
mutation
avec
~
20
marqueurs
4
.
génotypage
denviron
150
F
2
homozygotes
pour
la
mutation
avec
20
marqueurs
répartissurtoutlegénome(20cM)etdifférenciantleslignéesLeretCol‐>recherche
deséquencesdeCollesplusprochesdelamutationvenantdeLer,cartographie
g
rossièredelamutationà
q
uel
q
uesdizainesdecM
,
encadrementdelamutation
p
ar
g
qq
,
p
deuxmarqueurs.
F19B11
F4P13
T10P11
IIIIIIIVV
F21M12
F4P13

CIW5
MWD9
CIW11
MED24
FCA6
CIW12
T21L14
MPA22
CIW4
nga280
T3G21
T8B10
ATA22
CIW4
AAA ATPase
K9I9
4.1. Utilisationdu programmeBLAST (Basic Local Alignment SeachTool) pour prédirela 
tailledes ampliconsCAPS
Les amorcessuivantesontétéutilisées:
g4026 5'‐GGGGTCAGTTACATTACTAGC‐3' (Forward Primer)
5'‐GTACGGTTCTTCTTCCCTTA‐3' (Reverse Primer)
H77224 5'‐GGATTTGGGGAAGAGGAAGTAA‐3' (ForwardPrimer)
5'‐TCCTTAGCCTTGCTTTGATAGT‐3' (Reverse Primer)
m235 5'‐GAATCTGTTTCGCCTAACGC‐3' (ForwardPrimer)
5'‐AGTCCACAACAATTGCAGCC‐3' (Reverse Primer)
UFO 5'‐GTGGCGGTTCAGACGGAGAGG‐3' (ForwardPrimer)
5'‐AAGGCATCATGACTGTGGTTTTTC‐3' (Reverse Primer)
4.1. Utilisationdu programmeBLAST (Basic Local Alignment SeachTool) pour prédirela 
tailledes ampliconsCAPS
g4026 5'‐GGGGTCAGTTACATTACTAGC‐3' (Forward Primer)
5'‐GTACGGTTCTTCTTCCCTTA‐3' (Reverse Primer)
1. Démarrerunerecherchepar BLAST:BLAST search.
a. Ouvrirle site internet du National Center for Biotechnology Information (NCBI) 
wwwncbinlmnihgov/
www
.
ncbi
.
nlm
.
nih
.
gov/
b. Click BLAST dans“Popular Resources”
c. Click “nucleotide BLAST” (blastn).
d
Entrer
les
séquences
des
amorces
g4026
dans
la
fenêtre
Search
d

Entrer
les
?
séquences
des
?
amorces
g4026
?
dans
la
?
fenêtre
Search
E. Choisissezl’organisme(Arabidopsis thaliana)
F. BLAST !
2. Résultats
2. Résultats
Quelle est la taille de l’amplicon(écotypes Leret Col) ? 
Répétez la même procédure avec les autres paires d’amorces (écotype Col).
4.2. Extraireet sauvegarderles séquencesdes markers CAPS
Suivez les liens des N°d’accession pour chaque écotype
‐Regardez les informations et annotations
‐Sélectionnez et co
p
iez la re
g
ioncontenant le mar
q
ueur CAPS 
g
4026 dans un fichier text
p
g
qg
Alignez les séquences Col & Lerdu marqueur CAPS g4026 
http://npsa‐pbil.ibcp.fr/
choisissez «Multiple alignment ClustalW
DNA
Observezle polymorphisme
Répétez la même procédure avec les autres paires d’amorces.
H77224 5'‐GGATTTGGGGAAGAGGAAGTAA‐3' (ForwardPrimer)
5
'‐
TCCTTAGCCTTGCTTTGATAGT
?r
3
'
(ReversePrimer)
5
TCCTTAGCCTTGCTTTGATAGT
3
 
(Reverse
?
Primer)
Sélectionnez et copiez la regioncontenant le marqueur CAPS H77224 (Col) dans le fichier 
text
text
Rhh
l
é
L
R
ec
h
erc
h
er
l
a s
é
quence
L
er
a. Ouvrirle site internet du TAIR (The ArabidopsisInformation Resource) 
http://www.arabidopsis.org/
bClick

MonsantoSNPand
Ler
collections

dans

Browse

b

Click
?
Monsanto
 
SNP
?
and
?
Ler
collections
?
dans
Browse
c. Access Lersequence
username: laloich
password
:syUrutj0
password
:
 
syUrutj0
d. Click “BLAST againstthe LandsbergSequence”
e. Sélectionnez et copiez la regioncontenant le marqueur CAPS H77224 (Ler) dans le 
fichier
text
fichier
?
text
4.3. Digestion in silicodes markers CAPS
‐ouvrezhttp://old.dnalc.org/bioinformatics/nucleotide_analyzer.htm
‐copiez/collezla séquence contenant le marqueur CAPS g4026
‐Entrez le nom de l’enzyme de restriction à utiliser pour générer le marqueur CAPS (RsaI)
Ntlldftéé
L
tCl

N
o
t
ez 
l

l
ongueur 
d
es 
f
ragmen
t
s g
é
n
é
rez pour 
L
ere
t
 
C
o
l
 
Marqueur Enzyme de restriction Fragments Ler (bp) Fragments Col (bp) 
  
g4O26   RsaI         
H77224  TaqI 
m2
35
HindIII
m2
35
 
HindIII
UFO   TaqI 
4.3. Digestion in silicodes markers CAPS
‐ouvrezhttp://old.dnalc.org/bioinformatics/nucleotide_analyzer.htm
‐copiez/collezla séquence contenant le marqueur CAPS g4026
‐Entrez le nom de l’enzyme de restriction à utiliser pour générer le marqueur CAPS (RsaI)
Ntlldftéé
L
tCl

N
o
t
ez 
l

l
ongueur 
d
es 
f
ragmen
t
s g
é
n
é
rez pour 
L
ere
t
 
C
o
l
‐Répétez la même analyse pour les autres marqueurs
 
Marqueur Enzyme de restriction Fragments Ler (bp) Fragments Col (bp) 
  
g4O26   RsaI         
H77224  TaqI 
m2
35
HindIII
m2
35
 
HindIII
UFO   TaqI 
Clonage positionnel d’une mutation récessive chez Arabidopsisthaliana
4
.
génotypage
d

environ
150
F
2
homozygotes
pour
la
mutation
avec
~
20
marqueurs
4
.
génotypage
denviron
150
F
2
homozygotes
pour
la
mutation
avec
20
marqueurs
répartissurtoutlegénome(20cM)etdifférenciantleslignéesLeretCol‐>recherche
deséquencesdeCollesplusprochesdelamutationvenantdeLer,cartographie
g
rossièredelamutationà
q
uel
q
uesdizainesdecM
,
encadrementdelamutation
p
ar
g
qq
,
p
deuxmarqueurs.
‐extractiondel’ADNdeplantesF2présentantlephénotypemutant
‐amplification par PCR des régions polymorphiques contenant les 
marqueurs SSLP, CAPS,etc…(20 marqueurs répartis sur tout le génome )

⡭慲煵敵qs䍁偓C摩dest楯i摥d灲潤畩瑳偃P灡pl
’
敮ey浥摥rest物捴楯温

⡭慲煵敵qs
 
CAPS:
?
digestion
?
des
?
produits
?
PCR
?
par
?
lenzyme
?
de
?
restriction)
?ranalyse des marqueurs par électrophorèse su gel d’agarose:
SSLP
‐La fréquencede recombinaison(r) entre un marqueurCAPS marker et le gène
mutéresponsible du phénotypeestproportionnelleaux au nombrede 
chromosomesavec
l

allèle
Col
ou
la
fréquence
de
l

allèle
Col
chromosomes
 
avec
?
lallèle
Col

ou
la
?
fréquence
de
?
lallèle
Col
La fréquencede recombinaison(%) is calculated using the following estcalculée
selon
la
formule
:
selon
la
 
formule
:
r = 100 (N Col Alleles / Total Alleles)
‐La fréquencede recombinaison(%) estconvertieen distance génétique(D, in cM) .
Chez Arabidopsis, unebonneestimation de la distance génétiqueestdonnéepar la 
fonction
de
Kosambi
(ln
=
natural
log):
fonction
de
 
Kosambi
(ln
??
natural
log):
D = 25 x ln [ (100 + 2r) / (100 –2r) ]
Si on veut isoler un gène de part sa position dans le génome, par rapport a des
mar
q
ueurs connus
,
il est utile d’avoir la
p
lus
p
etite corres
p
ondance entre la
q,ppp
distance génétique (en cM) et a distance physique (en kb). Cette relation dépend
de la taille du génome.
•Mais 14-1,750 kb/cMmoyenne = 1,500 kb/cM
•Tomate 43-3,300 kb/cMmoyenne= 550 kb/cM
Arabidopsis40
550kb/cM
moyenne=200kb/cM

Arabidopsis

40
-
550

kb/cM
moyenne=

200

kb/cM
on peut espérer couvrir la distance entre deux marqueurs génétiques a l’aide
d’un seul fragment cloné (100-500kb)
Plantes F2 mutantes
‐Qu’elleestla fréquencede recombinaison(r) entre cemarqueurSSLP et le gène
mutéresponsabledu phénotypemutant des plantesF2 sélectionnées? 
r
=
100(NColAlleles/TotalAlleles)
r

100

(N

Col

Alleles

/

Total

Alleles)
‐Distance en cM?
D = 25 x ln
[

(
100 + 2r
)
/
(
100 –2r
)

]
[()(
)]
‐CemarqueurSSLP et la mutation d’intérêtsont‐ilsliés?
Plantes F2 mutantes
PlantesF2mutantes
Plantes

F2

mutantes
‐Qu’elleestla fréquencede recombinaison(r) entre cemarqueurSSLP et le gène
muté
responsable
du
phénotype
mutantdes
plantes
F2
sélectionnées
?
muté
responsable
du
 
phénotype
mutant
?
des
?
plantes
F2
?
sélectionnées
?
?
?rDistance en cM?
‐CemarqueurSSLP et la mutation d’intérêtsont‐ilsliés?
les gènes sont liés
(sur le même chromosome)
les génes sont indépendants
(sur des chromosomes différents)
gamétes:
AB, Ab, aB, ab
> 1/4
gamétes:
AB, ab
+ recombinants
> 1/4
< 1/4
< 1/4
50% recombinants => génes non-liés
< 50% recombinants=> génes liés
Une astuce consiste à «bulker» l’ADN des individus pour
détecter les recombinants
p
as PCR
p
Bulk
F19B11
F4P13
F21M12
T10P11
MED24
Bulk

analysis
50
p
lants
MWD9
F21M12
CIW11
Ciw5
p
FCA6 12.9
CIW12
T21L14
CIW11
MPA22
CIW4
nga280
T3G21
T8B10
A
TA22
AAA ATPase
K9I9
het./bulk F2
Clonage positionnel d’une mutation récessive chez Arabidopsisthaliana
5
.
A
partir
de
3

4000
plantes,
recherche
d

événements
de
recombinaison
entre
les
5
.
A
partir
de
3
4000
plantes,
recherche
dévénements
de
recombinaison
entre
les
deuxmarqueursencadrantlamutationpourconstruireunecartegénétiquefinedela
régioncontenantlamutational’aided’autresmarqueurs
connus(intérêtdela

q
uencedu
g
énome
,
soitlesmar
q
ueurssontdé
j
àconnus
,
soiton
p
euten
g
énérer
q
g,
q
j
,
p
g
d’autresrapidement).Définitiond’unintervalledequelquesdizainesdekilobases
(0,1‐0,2CM)
nb
:
plus
on
réduit
la
taille
de
la
région
contenant
la
mutation
plus
la
probabilité
de
nb
:
plus
on
réduit
la
taille
de
la
région
contenant
la
mutation
,
plus
la
probabilité
de
pouvoirutiliserdesmarqueursSSLP,CAPS,etc…estfaible.Commentutiliserles
marqueursSNP?
Query: 366 gatgtagctacaaggctcttcttgaggaaaatgaaaatggagcttaagcttccggtactt 425
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1135 gatgtagctacaaggctcttcttgaggaaaatgaaaatggagcttaagcttccggtactt 1194


Query: 426 gccttggtggatagtgatccttacggattgaagatcttgtcggtgtatggatgtgggtcg 485
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1195 gccttggtggatagtgatccttacggattgaagatcttgtcggtgtatggatgtgggtcg 1254


Query: 486 aagaacatgtcatatgatagtgcaaacttgactacgcttgatattaagtggcttggaatt 545
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 1255 aagaacatgtcatatgatagtgcaaacttgactacgcctgatattaagtggcttggaatt 1314


Query: 546 aggccgagtgatttggacaagtataagatacctgaacagtgtaggttgccgatgactgag 605
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1315 aggccgagtgatttggacaagtataagatacctgaacagtgtaggttgccgatgactgag 1374


Query: 606 caggatattaagaccgggaaggatatgctagaggaggatttcgtgaagaaaaatcccggg 665
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1375 caggatattaagaccgggaaggatatgctagaggaggatttcgtgaagaaaaatcccggg 1434

MED24
Cartographie fine (~500 plantes)
T20L15 0.27Mbp 3.08cM 5 het
Chr. V
F17C150.9 Mbp 9het
T7H20 0.37 Mbp 2het
MED240.98Mbp4.6cM 27 heter
Nga225
13cM
Nga225
13cM
2 het 3 het
1 het 
1 het 
0 het
Cartographiefine:
>
500
àqqmilliersdeplantes
Cartographie

fine:

>
500

à

qq

milliers

de

plantes
-Recherche de marqueurs de plus en plus proches de la mutation
IdentificationdeYACouBACcontenantlesplusprochesmarqueurs
-
Identification

de

YAC

ou

BAC

contenant

les

plus

proches

marqueurs
Cf
C
hromosomes arti
f
iciels
bactériens (BAC)
Basés sur l’épisome F’ d’E.
coli
Capacité > 300 kb
(plasmides conventionnels,
10-20 kb
Clonage positionnel d’une mutation récessive chez Arabidopsisthaliana
6
.
Clonage
de
la
région,
séquençage,
comparaison
avec
séquence
sauvage
Ler
,
6
.
Clonage
de
la
région,
séquençage,
comparaison
avec
séquence
sauvage
Ler
,
identificationdugènemutant,vérificationparcomplémentationdumutantavec
l’allélesauvage(transformation).
Transformationdumutant
Identificationdeclonescomplémentantlamutation
M
ap based cloning of executer 1
F8B4
F17M5
T19K4
Ex1
Chromosome IV
115
4
Recombinations:
90 kb
flu
ex1/flu
44
Cosmidcontig
76
ex1/flu
+ cosmid 41
(control)
ex1/flu
+ cosmid 44
(T3)
Complementation
assays
ex1/flu
flu
ex1/flu, complemented with cosmid 44
Wagner et al. 2004
Science 306, 1183-1185
Clonage positionnel d’une mutation dominante chez Arabidopsisthaliana?
Très très bréve introduction à la génétique quantitative
Beaucoupdephénotypesobservablesnecorrespondentpasàl

analyse
Beaucoup

de

phénotypes

observables

ne

correspondent

pas

à

lanalyse

génétique mendélienne «classique» discontinue (œil rouge/blanc, ridé/pas
ridé) ex: la taille, le poids, la sensibilité aux maladies etc…. On observe une
variationcontinuedansladescendanced

uncroisement
variation

continue

dans

la

descendance

dun

croisement
-> distribution normale.
Teneurensucrosedans
Nb
Teneur

en

sucrose

dans

La racine de betterave
%sucrose
d’individus
%

sucrose
Leur déterminisme génétique est contrôlé par plusieurs gènes qui se
répartissent au hasard et c’est la résultante de leur activité qui gouverne le
p
hénotype (déterminisme poly-ou oligogénique)
Même des caractéres discontinus peuvent
p
résenter une variation
q
uasi-continue
pq
Ex: nb de petits par portée chez le porc
Les phénotypes déterminés par un seul gène sont finalement assez rares( cas
d’école)=> génétique mendélienne n’est qu’un cas particulier de la génétique
quantitative ou le phénotype n’est déterminé que par un seul géne
…!
Dans une descendance de deux individus présentant une forte différence
de phénotype, on peut trouver tous les intermédiaires (ex: Saint Bernard
X caniche) -> distribution normale pour la taille
Pour identifier les ré
g
ions du
g
énome im
p
li
q
uées dans la variation d’un
ggpq
phénotype quantitatif on essaie d’associer la fréquence de marqueurs
moléculaires connus avec la mesure du phénotype
->
cartographiedeQTL(quantitativetraitloci)

cartographie

de

QTL

(quantitative

trait

loci)
Les QTLs sont très utiles en amélioration des plantes
(tailledesorganesrésistanceauxstressauxmaladies)
QTLs impliqués dans
La résistance aux virus chez le pime
n
(INRA)
(taille

des

organes
,
résistance

aux

stress
,
aux

maladies)

P1
0
20
23
7
14
P2
0
9
11
11
10
TG056
p
vr
P3
0
18
13
16
0
TG591
TG057
CD008
poty3.1
P5
0
13
15
6
7
0
2
P6
0
17
11
18
15
9
P4
0
16
7
0
TG132
AC10_0.3
pv
r2
poty4.1
0
19
14

7
19
7
18
17
0
7
15
14
5
6
30
27
TG056
TG059
TG076
poty1.1
TG370
TG496
p
ot
y
1.2
vr
6
17
7
6
6
2
11
6
12
7
TG414
5
24
CD008
0
6
13
19
7
0
P11
9
CT204
18
12
pot
y6.1
0
5
9
P1
2
0
13
27
16
7
6
0
P10
Pvr
QTLs cholesterol
Chli
0
30
11
12
8
14
P7
30

0
9
14
17
16
8
12
P8
TG496
py
0
13
10
7
17
7
3
6
P9
0
18
9
19
11
13
8
11
TG046
8
15
8
TG124
17
16
0
10
GL PY2
CT135
PY21
poty12.1
0
18
12
15
7
6
5
12
11
P10
TG122
pot
y10
.
1
CT268
CT259
Pvr
4
Pvr
7
Ch
ez
l
a sour
i
s
14

12

10
5
17
4
16
9
19
6
TG036
poty11.1
10

18
CT135
pot
yPY2
.
1
7
pvr3?
Pour cartographier les QTLs on peut croiser deux lignées pures (complétement
homozygotes) , puis caractériser de nombreux individus (50) de la F2 pour l’association
tlhététlétdbd
en
t
re
l
e p

no
t
ype mesur
é
e
t

l
e g
é
no
t
ype avec un gran
d
nom
b
re
d
e marqueurs
génotype Xgénotype Y
grand
petit
moyen
On peut cartographier dès la F2
mais il est utile d’en dériver des lignées
complétementhomozygotes
F2
F2
F2
F2
complétement

homozygotes

pour générer une population de cartographie
permanente : lignées recombinantes
Bbbiliéd’id’
Par ex: culture de gamétes puis
diploidisation(haploïdes doublés)
Ou autofécondation répétée
B
onne pro
b
a
bili
t
é

d’
ex
i
stence
d’
un
QTL déterminant la taille dans
l’intervalle ADN provenant de X
Plutot grand
Plutot petit
Plutot grand
Plutot grand