Chapter 9: DNA & Biotechnology

groupmoujeanteaΒιοτεχνολογία

23 Οκτ 2013 (πριν από 3 χρόνια και 8 μήνες)

162 εμφανίσεις


DNA & Biotechnology:

113

Name: ____________________


Chapter
9
: DNA & Biotechnology

Revised: Spring 2007


Learning Objectives
:




Gain familiarity with the structure and properties of DNA.



Develop skills necessary to isolate and manipulate DNA.



Understand the process of gel elec
trophoresis.



Be able to interpret the results of a DNA fingerprinting experiment.



Table of Contents
:


Introduction

................................
................................
................................
.............

114

Exercises

Exercise 1: D
NA Extraction from Onion Cells

................................
................

118

E
xe
rcise 2: DNA fingerprinting

................................
................................
......

120


Appendix 1: Gel Electrophoresis: sam
ple loading

................................
..................

1
26

DNA Samples

................................
................................
................................
.........

127



DNA & Biotechnology:

114

Introduction
:


DNA is present in all living organisms’ cells.
The long thin fibers of DNA store genetic information that
is passed on to new cells.
In this lab we will be exploring the structure and properties of DNA and
how it
can be used as a tool in modern forensics laboratories.


In order to understand DNA, one must first understand the structure of the DNA.
We learned earlier in the semester that DNA is one of two major types of
nucleic
acids
found in cells (the o
ther is RNA, which is necessary for protein synthesis).
These macromolecules are composed of
nucleotide

monomers (building blocks).
The general structure of a nucleotide is shown in the diagram to the right. Note that
it consists of 3 major parts: 1)
a nitrogenous base; 2) a 5
-
carbon sugar; and 3) a negatively charged
phosphate group. A more detailed picture is shown below (
Figure 1A
). The sugar and phosphate are the
same in all nucleotides; only the base is different. Each DNA nucleotide has one of

the following four
bases: adenine (A), guanine (G), cytosine (C) and thymine (T), shown in
Figure 1B
. These nucleotide
monomers are linked together by dehydration synthesis to form long polymers or DNA strands (
Figure
1C
). Two DNA strands come together
to form a double helix (
Figure 1D
). The outside of the helix
consist of alternating sugar and phosphate units, and the center of the helix consists of bases on one strand
hydrogen bonded to bases on the other stand. The pairing of bases is specific: A ca
n only pair with T and
G can only pair with C. One long DNA molecule contains many genes, each with a specific sequence of
nucleotide bases. The sequence of nucleotide bases stores information which cells translate into an amino
acid sequen
ce to make a s
pecific protein.


A

B

C

Figure 1
. A) A DNA nucleotide. B) The nitrogenous bases of DNA. C) A DNA
stran
d is a polymer of nucleotides. D ) The structure of DNA . The double helix
consists of two DNA strands held together by bonds between the bases.

D

C


DNA & Biotechnology:

115

Figure 2
: Cutting DNA with
a restriction enzyme

Recognition
sequence

DNA Technology


DNA Technology is a set of methods for studying and manipulating genetic material. This
technology has brought about some of the most remarkable scientific advances in recent years: production
of drugs in bacte
ria, genetically modified foods, screening for and treatment of genetic diseases, and DNA
fingerprinting. This lab will focus on
DNA fingerprinting

and the laboratory methods used to create a
DNA fingerprint.
A DNA fingerprint is a pattern of DNA bands o
n a gel, which can only be obtained
after cutting up DNA and then forcing it to diffuse along a line of a gel.


Restriction Enzymes

Scientists use molecular tools to cut DNA; these cutting tools are bacterial
enzymes called
restriction enzymes
. Restricti
on enzymes recognize
short double stranded nucleotide sequences in DNA molecules and cut at
specific points within these recognition sequences. There are several
hundred different restriction enzymes, each recognizing different
sequences. The top of
Figu
re 2

shows a piece of DNA that contains
the

recognition sequence
GAATTC

for a

particular restriction enzyme.
Notice that that although the site the enzyme recognizes is written as
GA
A
TTC, the enzyme actually recognizes and cuts the double stranded
sequenc
e shown to the left. The enzyme would not recognize or cut the
sequence GAATTC
if it were
on the bottom strand.
The restriction
enzyme cuts the DNA between the bases G and A within the recognition
sequence on both strands, resulting in pieces with uneve
n ends. Longer
pieces of DNA may be cut into many pieces by restriction enzymes.

Gel Electrophoresis

Once a DNA sample is cut by restriction enzymes, the resulting different sized fragments can be sorted by
gel electrophoresis
. This method sorts DNA m
olecules primarily on the basis of their charge and length.
Figure 3

shows how gel electrophoresis can be used to separate the various DNA fragments in three
different mixtures. A sample of each mixture is placed in a well at one end of a flat, rectangul
ar gel, a
thin slab of jelly
-
like material made of agarose. The gel is placed in an electrophoresis chamber, covered
with electrophoresis buffer and connected to a power supply. A negatively charged electrode is then
attached at the DNA
-
containing end of

the gel, and a positive electrode is placed at the other end.
Because the DNA fragments have a negative charge
due to

their phosphate groups (PO
4
--
, see Figure 1A)
they w
ill move through the gel toward

the positive electrode. Shorter DNA fragments can m
ove quickly
through the gel, whereas longer DNA molecules move more slowly. The mixture of DNA in each “lane”
of the gel is separated into a series of bands on the completed gel. Each band consists of DNA molecules
of one size. The bands can be visualiz
ed by different staining methods.










Figure 3
: Gel electrophoresis of DNA molecules


DNA & Biotechnology:

116

DNA fingerprinting


DNA technology has rapidly revolutionized the field of forensics, the scientific analysis of
evidence for crime scene investigations and other legal proceedings. Because the DNA sequence fo
r
every person is unique (except for identical twins),
DNA fingerprinting

a
procedure that analyzes a
person’s unique collection of restriction fragments

can
be used to determine whether two samples of
genetic material are from the same individual. There
are many different DNA Fingerprinting techniques,
but this lab will focus on one called
Restriction Fragment Length Polymorphism (RFLP) Analysis
.
RFLP analysis is the comparison of the set of restriction fragments produced by cutting DNA from
different in
dividuals. The goal of DNA fingerprinting by RFLP analysis is to determine whether samples
of DNA contain identical restriction fragments or not. Because individuals have different DNA
sequences, if their DNA is cut with a particular restriction enzyme,
the resulting pattern of DNA
fragments will be differ
ent for different individuals.


To create a DNA fingerprint, a forensic laboratory technician treats each DNA sample with a
restriction enzyme, creating a mixture of restriction fragments. In the exampl
e shown in
Figure 4A
, the
restriction enzyme HpaII recognizes and cuts at the sequence CCGG. The first DNA sample was
extracted from biological evidence collected at a crime scene and the second from a suspect’s blood.
Notice that the two sequences diffe
r by a single base pair (boxed). Because the DNA sample from the
crime scene has two recognition sequences for the restriction enzyme, it is cut in two places, resulting in
three restriction fragments (w, x and y). The suspect’s DNA has only one recognit
ion sequence and
yields only two restriction fragments (z and y). The two sample’s DNA fragments differ in length and
number. Hence the name RFLP: the
length

of
restriction fragments

differs (is
polymorphic
) among
different individuals.
Figure 4B

shows
the bands that would result from using gel electrophoresis to
separate these DNA fragments. The differences in number and size of the bands prove that the crime
scene DNA
did not come from the suspect.


It is possible for some people to have the same RFLP

with a particular restriction enzyme. In
other words, two individuals might have identical bands when their DNA is cut with HpaII. Therefore,
when DNA fingerprinting is done several different RFLPs are examined and only of there is a match at
every RFLP

is it considered an accurate identification of an individual.





















A

B

Figure 4
: DNA Fingerprinting by RFLP an
alysis. A) Restriction fragment length reflects DNA
sequence. The sequence CCGG is recognized by the restriction enzyme HpaII. B) The bands that
would result from gel electrophoresis of the DNA fragments shown in A.




DNA & Biotechnology:

117

Addition
al

information about DNA Fingerprinting and Crime Scene Analysis:


Forensic scientists can create a DNA Fingerprint from a drop of blood, strands of hair, or o
ther biological
material left at the crime scene.


Forensic investigators take many precautions to prevent mistakes, but human error can never be reduced
to zero. To detect possible contamination of DNA samples during collection or handling, DNA
fingerp
rints are often compared with those from detectives at the crime scene, the victim, a randomly
chosen person or a DNA fingerprint from a database.

Forensic DNA is just one of many types of evidence. It is important to examine other clues such as
motive, w
eapon, or additional evidence linking a suspect to the crime scene. The more evidence collected,
the less likely it is that samples from a particular suspect were planted, either on purpose or by accident, at
the crime scene.


DNA fingerprinting can be a

powerful tool in criminal investigations. Its success in the courtroom
depends upon many factors, including:



Proper handling of evidence



Careful analysis by an unbiased forensic laboratory



Fair and appropriate interpretation of the results



Accurate and

effective reporting of results to judges and jurors

When used correctly, DNA fingerprinting is a powerful forensic tool. It can be used to quickly eliminate a
suspect, saving time in searches for perpetrators. And it can provide compelling evidence to su
pport a
conviction and, most importantly, reduce the chances of a wrongful conviction.






DNA & Biotechnology:

118

Exercise #1
:


DNA Extraction from Onion Cells


It is time to learn about nucleic acids, and,
specifically, DNA. You will be extracting DNA from
raw (uncooked) on
ion cells.
Extraction of DNA is
the first step in many biotechnology experiments.



Objective:

The purpose of this experiment is to extract DNA so that you can see it and observe its physical and
chemical properties.


Background Information:

To extract DN
A from tissue, it is necessary to breakdown the cell walls and cell membranes to gain
access to the DNA. This is called lysing. To accomplish this, a detergent is added to break down the cell
membranes and expose the proteins and DNA within the cell. The n
ucleus is then opened to release the
DNA. It is at this point that DNA must be protected from enzymes that would degrade the DNA. Once the
DNA is released it is then precipitated in alcohol. In water, DNA is soluble. When it is in alcohol, it
uncoils and p
recipitates leaving behind the other cell components that are not soluble in alcohol.


Procedure

when starting from the raw onion
:

1.

Dice on onion into small pieces (about 0.5
-
1cm).

2.

Weigh out 50g diced onion and transfer it to a 250mL beaker.

3.

Add 100mL Homog
enizing Solution to the diced onion in the beaker and incubate in a 60
o
C water
bath for 15 minutes. This step softens cell wall, helps dissolve cell membranes and denatures
proteins that interfere with the isolation procedure.

4.

Quickly place the beaker in
an ice/water bath and cool it to 15
-
20
o
C.

5.

Pour the cooled solution into a blender, fasten the lid and homogenize for 30
-
60 seconds at
medium speed. This breaks the cells open and releases their contents. Rinse the beaker out with
water; it will be re
-
u
sed in step 7.

6.

Pour the homogenate into a 500 or 1000mL beaker and allow it to stand in an ice bath for 15
minutes. It will be very foamy.

7.

Filter the homogenate through 4 thicknesses of cheesecloth into another 500 or 1000mL beaker.
Try to leave the foam

behind.

8.

Transfer 10mL of filtered homogenate into a 50mL graduated cylinder and chill in an ice bath to
10
-
15
o
C.

Continue procedure from here when prepared onion juice is available:

9.

Slowly pour 20ml ice cold ethanol down the side of the graduated cylinder

until a stringy, white
precipitate (DNA!) appears.

10.

Place a Pasteur pipette “hook” or small glass rod into the cylinder and rotate it while moving it in
large circles around the beaker. The DNA will wind around the pipette like a spool and can then
be li
fted out of the beaker.







DNA & Biotechnology:

119


Questions for Exercise #1:


1.

In your own words, describe the appearance of the DNA you extracted:







2.

How does the appearance of the DNA relate to what you known about the structure of DNA?






3.

Besides the cell membrane, wh
at other membrane has to be disrupted to extract the DNA?






4.

Why does the onion/kiwi have to be raw? In other words, why wouldn’t this experiment work with a
cooked sample?







5.

Isolation of DNA is often the first step in DNA technology methods. What
are some methods or
techniques that would require isolation of DNA?




DNA & Biotechnology:

120

Exercise #2:

DNA Fingerprinting


Objective:


In this experiment, you will analyze DNAs using aspects of RFLP analysis. In this hypothetical case, the
DNAs obtained from a crime scene
and two suspects have been cut by restriction enzymes and the
fragmentation patterns serve as the individual’s fingerprints. The objective is to analyze and match the
DNA fragmentation patterns and determine if Suspect 1 or Suspect 2 was at the crime scen
e.


The case:


At 9:00 p.m. on Saturday night, neighbors in the quiet suburb of Havenville heard a scream. Linda
Ackerly had discovered her sister’s body in a pool of blood. Police were called and arrived at the scene.
Sarah McMahan had been stabbed w
ith her own kitchen knife, and appeared to have struggled with her
assailant. There were no signs of forced entry. The police collected evidence from the crime scene,
including blood, hair samples, and traces of skin from under the victim’s fingernails.



After questioning family, friends and neighbors, police learned more about the victim. Sarah, a recent
divorcee, lived with her two small children in her home. Her ex
-
husband John visited frequently to see
the children and by all appearances they had
a good relationship. Neighbors reported hearing a minor
argument between Sarah and John the day before the murder. Sarah’s current boyfriend Keith Johnson
had known her only a few months but had confided in friends that he considered her “the one”. Sara
h’s
sister Linda reported that she and Sarah were supposed to meet for pizza and movies the night of the
murder. Neighbors reported seeing a pizza delivery car in the vicinity at approximately 8:30 pm on the
night of the murder.


The police arrest three

men: John McMahan, Keith Johnson, and George Kramer, the pizza deliveryman.
All of the suspects proclaim their innocence, and want to see their lawyers. At their indictments, it is
learned that:




Suspect 1, John McMahan claims to have been out of town w
hen the crime was committed, but is
unable to offer proof.



Suspect 2, Keith Johnson, said he was home alone at the time of the murder.



Suspect 3, George Kramer, the pizza deliveryman, says he was out delivering pizza in a
neighborhood other than where
the murder took place. His lawyers are able to present evidence
supporting his claim, and he is released.


The remaining two suspects are ordered to provide blood samples for DNA Fingerprinting analysis.

You are the forensics lab technician who has be
en handed the DNA samples from the two suspects
involved plus the DNA from the samples collected at the crime scene. Your job is to determine which of
the suspects may have been at the crime scene. The court awaits your decision.





DNA & Biotechnology:

121

Procedure 1:

Simu
lated restriction enzyme digestion and gel
electrophoresis


1.

Your DNA samples are shown as the

DNA sequences
on the
last

page

of this lab
handout
.
Samples A
and B are DNA from the crime scene, Samples C and D are DNA from suspect 1 and sample E and F
are f
rom suspect 2.


2.

Your instructor will assign a particular DNA sequence to you. Cut the entire piece of DNA out in one
long strip.


Read this before proceeding to Step #3
:
As discussed in the introduction to this lab, a DNA fingerprint is
a unique patter
n of DNA fragments that result when an individual’s DNA is cut by a restriction enzyme.
The restriction enzymes we will use in this simulation are
EcoRI
(pronounced
eh
-
co
R

one), which cuts
DNA wherever the sequence
GAATTC

is found (shown

below
, left
) and

HpaII (pronounced Hip
-
a two),
which cuts DNA wherever the sequence
CCGG

is found (shown below, right
).
Remember

th
at

a
restriction enzyme recognition sequence is a double stranded seq
uence, and restriction enzymes usually
cut DNA in an

uneven manner as s
hown below.























3.

Examine your lab group’s piece

of DNA.
Cut this piece of DNA as instructed here:




If you have sample
A
,
C
, or
E
,
search along the sequence for the
EcoR1

sequence and use
the
scissors provided to cut your DNA molecule at
every EcoR1 sequence.
Be sure to cut the DNA

exactly

as illustrated above.
You will cut your piece of DNA into two or three smaller pieces.




If you have sample
B
,
D
, or
F
, along the sequence for the
HpaII

sequence and use the scissors
provided to
cut y
our DNA molecule at every HpaII sequence.
Be sure to cut the DNA
exactly
as
illustrated above.
You
will cut your piece of DNA into two or three smaller pieces.

AGGATAGAT
CCGG
ATTCGA
CA

TCCTATCTA
GGCC
TAAGCTGT


HpaII
Recognition
sequence

AGGATAGAT
C


CGG
ATTCGA
CA

TCCTATCTA
GGC

C
TAAGCTGT


Cutting DNA with
HpaII

AGGATAGAT
GAATTC
ATTCGA
CA

TCCTATCTA
CTTAAG
TAAGCTGT


C
utting DNA with
EcoR1

EcoRI
Recognition
sequence

AGGATAGAT
G AATTC
ATTCGA
CA

TCCTATCTA
CTTAA G
TAAGCTGT



DNA & Biotechnology:

122

Gel showing DNA fingerprints


Fragment sizes are shown to the left

Lane A: DNA from crime scene/EcoR1

Lane B: DNA from crime scene/HpaII

Lane C: DNA from suspect 1/EcoR1

Lane D:
DNA from suspect 1/HpaII

Lane E: DNA from suspect 2/EcoR1

Lane F: DNA from suspect 2/HpaII


This gel is equivalent to a real gel in a
forensics lab. The DNA fingerprints
should help you determine who committed
the crime.



4.

Determine the length of your pieces of DNA.
Count the total number of bases
(letters)

on
th
e top
strand of
each
piece of
DNA
. For example, the DNA cut with HpaII above is cut into two pieces; the
one to the left is 10 letters long, and the other is 11 letters long.


5.

Find your “lane
” on the gel drawn below and draw lines in the lane that corre
spond
s to the length of
each piece of DNA
. These are your DNA’s fingerprints.


6.

Visit the other lab groups to observe their fingerprints and record in the gel below.


7.

Compare the samples from the crime scene to the suspects


samples to determine who comm
itted the
crime.






Fragment
size

A

B

C

D

E

F








65







60







55







50







45







40







35







30







25







20







15







10








DNA & Biotechnology:

123

Procedure 2: Gel electrophoresis


1.

Obtain DNA samples from your lab instruc
tor.

Samples A and B are DNA from the crime scene,
Samples C and D are DNA from suspect 1 and sample E and F are from suspect 2.
The DNA samples
have already been cut with restrictions enzymes

which will cut the piece of DNA into two or three
smaller pie
ces. Y
ou are going to separate the different sized pieces of DNA by gel electrophoresis.
Samples
A
,
C

and
E

have been cut with
EcoRI
. Sample
B
,
D

and
F

have been cut with
HpaII
.


2.

Immerse your gel in the buffer in the
chamber. Remove the comb from th
e
gel carefully, and save it for re
-
use.


3.

Using a plastic transfer pipet or
micropipette, load 40

l of your DNA
sample into the appropriate lane on
the gel. [For instructions on loading,
see Appendix 1]
To remove samples
from the Quickstrip™ tubes, simply
pierce the foil top with the pipet or
micropipet tip and withdraw the
sample. *Be sure to use
a clean pipet
for each sample*


4.

Connect the electrodes to the
electrophoresis chamber, making sure
that the negative and positive color
-
coded indicators on the cover and
apparatus chamber are properly
oriented. Set the voltage to 100 volts
(or High setti
ng on power supply).


5.

Run the gel 30
-
45 minutes, or until
the bands have moved approximately
3 to 4 centimeters from the wells and
before they move off the gel.


6.

After the electrophoresis is
completed, turn off the power, unplug
the power source, disconn
ect the leads
and remove the cover.


7.

Draw the bands that you observe on
the gel
on the diagram of a gel on the next page.


DNA & Biotechnology:

124

Gel show
ing DNA fingerprints


Lane A: DNA from crime scene/EcoR1

Lane B: DNA from crime scene/HpaII

Lane C: DNA from suspect 1/EcoR1

Lane D: DNA from suspect 1/HpaII

Lane E: DNA from suspect 2/EcoR1

Lane F: DNA from suspect 2/HpaII


Compare the samples from the cr
ime
scene to the suspects’ samples to
determine who committed the crime.






A

B

C

D

E

F
























































DNA & Biotechnology:

125


Questions for Exercise 2:


1.

(Answer only if you use
d procedure 2)
Why is it important to position the sample wells near the
negative electrode?





2.

(Answer only if you used procedure 2)
Why is it important to wash the pipet between uses?





3.

What kind of evidence would you look for at a crime scene to obtai
n DNA?





4.


Which suspect was at the crime scene? How did you determine that?




5.

W
ould

you have been able

to determine the correct suspect by looking

only at samples cut with
EcoRI?

Why or why not?





6.

If a DNA fingerprint from suspect matches blood fou
nd at a crime scene, should the suspect be
convicted? Why or Why not?





7.

What determines that each person has a unique pattern within their DNA?





8.

Why might two related individuals share more similar DNA fingerprints than unrelated individuals?





9.

Can

you think of a case when two people will have identical DNA patterns
?



DNA & Biotechnology:

126


Appendix

1
: Gel electrophoresis

Sample Delivery


S
ample

D
elivery

W
ith

P
lastic

T
ransfer

P
ipets


1.

Gently squeeze the pipet stem to slowly draw the sample up into the pipet. The sample
should remain
in the lower portion of the pipet. If the sample is overdrawn and becomes lodged in the bulb or on the
walls, tap until the sample moves down into the lower stem of the pipet. Eject it back into the tube.
Try step 1 again.

2.

While holding t
he pipet tip above the sample tube, slowly
squeeze until the sample is nearly at the opening of the pipet
tip.

3.

Place the pipet tip in the electrophoresis buffer so it is directly
above barely inside the sample well. Avoid placing the pipet
tip all the way

inside the well
-

this will minimize the chances
of inadvertently piercing the bottom of the well.

4.

MAINTAIN STEADY PRESSURE on the pipet stem to
prevent buffer from being drawn in and diluting the sample.

5.

Slowly squeeze to eject the sample. Stop squee
zing when the well is completely full. Put any
remaining sample in the pipet back into the sample tube.

6.

Rinse the pipet with distilled water before obtaining the next sample for gel loading.


Sample Delivery With Variable

Automatic Micropipets:


1.

Se
t the micropipet to the
appropriate volume and place a
clean tip on the micropipetor.
Press the top button down to the
first stop. then immerse the tip
into the sample.


2.

Once the tip is immersed in the
sample, release the button
slowly to draw sample in
to the
tip.


3.

To release the sample:

a.

Position the pipet tip over the well. Be careful not to puncture or
damage the well with the pipet tip.

b.

Deliver the sample by press
ing the button to the first stop. When
the entire content of the tip
is empty, you a
re done

do not press to
the second stop.

c.

After delivering the sample, do not release the top button until the
tip is out of the buffer.


4.

Press the ejector button to discard the tip. Obtain a new clean tip for the
next sample.




DNA & Biotechnology:

127

DNA Samples
:


Instructions

first cut out the entire strip of DNA that was assigned to you. Then cut your strip in the manner that your restriction
enzyme would cut it. Keep all the pieces together for each DNA sample (A through F). Count the number of nucleotides (lette
rs) in the

top row of each piece and record that information on the gel on page 122.


ATCGAGA
T
CCGGCAGAATTCGAACATTCCG
A
CCGGCATGCG
GTGTAAAGTGATCCTAGCCT
G
AAGGGCCCACGAG

TAGCTCT
A
GGCCGTCTTAAGCTTGTAA
G
GC
T
GGCCGTACGCCACATTTCACTAGGATCGGA
C
TTCCCGGGTGCTC



ATCGAGA
T
CCGGCAGAATTCGAACA
TTCAG
A
CCGGCATGCG
GTGTAAAGTGATCCTAGCCT
G
AAGGGCCCACGAG

TAGCTCT
A
GGCCGTCTTAAGCTTGTAA
GTC
T
GGCCGTACGCCACATTTCACTAGGATCGGA
C
TTCCCGGGTGCTC



ATCGAGA
T
C
CGGCAGAATTCGAACATTCCGACCAGCATGCGGTGTAAAGTGATCCTAGCCGG
AAGGGCCCACGAG

TAGCTCTAGGCCGTCTTAAGCTTGTAA
TG
CTGGTCGTACGCCACATTTCAC
TAGGATCGGCC
TTCCCGGGTGCTC
C



ATCGAGA
T
C
CGGCAGAATTCGAACATTCCGACCAGCATGCG
GTGTAAAGTGATCCTAGCCG
G
AAGGGCCCACGAG

TAGCTCT
A
GGCCGTCTTAAGCTTGTAA
TG
CTGGTCGTACGCCACATTTCACTAGGATCGGC
C
TTCCCGGGTGCTC



ATCGAGA
T
CCGGCAGAATTCGAACATTCCG
A
CCGGCATGCG
GTGTAAAGTGATCCTAGCCT
G
AAGGGC
CCACGAG

TAGCTCT
A
GGCCGTCTTAAGCTTGTAA
G
GC
T
GGCCGTACGCCACATTTCACTAGGATCGGA
C
TTCCCGGGTGCTC



ATCGAGA
T
CCGGCAGAATTCGAACATTCAG
A
CCGGCATGCG
GTGTAAAGTGATCCTAGCCT
G
AAGGGCCCACGAG

T
AGCTCT
A
GGCCGTCTTAAGCTTGTAA
GTC
T
GGCCGTACGCCACATTTCACTAGGATCGGA
C
TTCCCGGGTGCTC



A

C

D

E

F

B


DNA & Biotechnology:

128