DNA Sequencing (06/11)

disturbedtonganeseΒιοτεχνολογία

2 Οκτ 2013 (πριν από 3 χρόνια και 10 μήνες)

75 εμφανίσεις


ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGAAGCAGCTTTGGCTTCTGCTAGGATGCAATGTAATACGCTTTTGATTACTCATAATATTGATACTCT
TG
GACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACT
TAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCAAGCGTCAGTAG
A
AGATTTAATAGTTAGTGGGAACAAGATTGTTGGAGTAATTACTCCAAAATTAGGAATGAAATTTAGTGGTACGTCTGTTGTGTTGACAACCGGAACCTTTCTCAATGGTAAGATTCATATTGGGA
T
GAATAATTTTAGAGGAGGTCGATCTGGAGATTCGGAGTCATCGTCATTGTTATCAGAGCGATTGAAAGAATTGTCTTTTCAGATTAGTCGGTTAAAAACGGGTACTTCTCCTCGTGTGCATACCA
AAGGGATAAATTTTGGTTCTTTACGTGCACAATATAGTGATGATCCCATTCCTGTGTTTTCATTTATAGGATCTACAAAACTACATCCTACGCAGGTGCCTTGTTATATTACCCATACTAATAAC
AA
AACACATGAAATAGTTAGATCAAATTTATATCAGAGTCCTATGTATACAGGTTTAATAAAAGGAATAGCACCTCGGTATTGTCCATCTATAGAAGACAAAATAACTCGTTTTTCAGATCGTAATG
CT
CATCAAATTTTTTTAGAACCTGAAGGTTTGACAACACCTGAAGTATATCTTAATGGTATTTCTACTAGCTTACCTTTTTGTGTACAAATGCAAATGATTAAATCAATTCAGGGATTAGAGAATGC
TTG
TATAATTAGGCCAGGTTATGCTATTGAATACGATTTTTTTGATCCTCGTGATTTAAAATTAACATTAGAGAGTAAAATTATTTCTGGATTATTTTTTTCTGGTCAAATTAATGGTACTACTGGTT
ATG
A
AGAAGCAGCTGCCCAAGGATTATTGGCCGGAATTAATGCAGCTAGGTTTTCCAAAAATAAAGAAGGATGGTACCCTAGAAGAGATCAGGCATATTTAGGGGTGCTTGTAGATGATCTCTGTACA
CATGGAACAGAAGAACCTTATCGTATGTTTACTTCGCGTGCTGAATATCGTCTGTCTTTACGTGAGGATAATGCTGATTTAAGATTAACTGAAATCGCGCGACAGTTAGGTTTGATAGATGAGTC
A
CGGTGGAAAGCTTTTTGTTGCAAAAAAGAAAACATTGAAAAAGAACGTCAGAGATTACGTAATACTTATATTTTCCCGTATAGCTCAGATGTTGCACAATTAAATAATTTTCTTAAAACACCTTT
AA
CACATGAAACAAATGGCGAAGATCTTTTGAGAAGGCCAGAAATTAATTATAAAAAGTTATCTCAACTAAGTACTTTTAGTCCATCTATATTGGATCGTCAAGTATTCGAGCAAATTGAAATTCAA
AT
AAAATATGAAGGTTATATTCGTCATCAACAAGAAGAAATAAAGAGACATATTTATAATGAAAATACATTGTTACCGACTGATATAGATTTCAATATTGTTTCTGGATTATCTCAGGAGGTCATTG
AC
AAACTCAATAATTATAAACCTTATTCTATTGGGCAGGCTTCTCGCATTTCTGGTATCACTCCTGCGGCTATTTCTAATTTATTGGTTTGGTTAAAAAAACAAGGTTTGTTAGAGCATAATACATG
CTA
ATCTGTTGAATAATGTATTTTCTATTAATCAAGGTATTATTTAATTTCCTATATAGGGTGTTTGTGATTGTTACAATATGGAGAGAGTTGATCGTGTAGAAAACCGGTATATTTATGTCTTTTCC
AAT
AATAATTTTATAGAAATAATAATAGTAATTAGATTATTATTTTAATGGGTTTGTTATGTATGGCATTATTTTTAATATTATACGGTTGTTTATACGTATCTAAATTTGCGCTTTGAATTTTTTTG
AAA
AT
AGGATTATACTGAACTTTTAGTTGTATACAAGTGTATTATTTCATATTTTTGAATAAATATACGTGCTGTACTAATGGTTATTAATTACAAGATAAATTACTTGTCGACCGAACTATAGTTCGGT
CGT
GTGTTTGTTTCTGTAAGTTGTAACATATTATGTGAAATTTACTAATTAATTCATAGTGTCATTTTAATTCTCTTTTATTGCATTAGTATATGGTTGTGTAAAAAGAGAGAGAGTGTTCTTGTTAT
TTT
C
TATTAGTACTAATTTTTTAAAAGTTGATGCAGGCACTGTCGTTCTTTTCGGATACAACATCATTGTAAGTTATATATAAAAATGATTTAGAATTTCGACATGTTAGTGACAAGTTGTATATCGAG
GTT
GTAATGTTGTATTATACAAGAACATTGTAAAATATTTATAGTATATTGCAGCCAATATTTTTTGAAAGGTGGTTTATGTCAGGAATCAAAGGCACTTCCCAAGAATATATTGGACATCATTTATA
TCA
TCTGCAATTTGATTTAAGTACTTTTTCGTTAGTGAGCTCGGAGAATACTTCTTCATTCTGGGTATTAAATGTAGATTCGATGTTTTTTTCAATATTATTGGCTACTTTATTTTTATTAATTTTCG
GTC
G
TTTGGCTACAGTGGCAACTTATGCGGTTCCCACAAAACTGCAAGTGTTTATTGAGTTAGTAATATTGTTTATTGATAGCAATGTAAAAGATATGTTTCATGGTAAAAATAAACTAATTGCGCCAT
TA
TCTATGACGGTTTTTGTTTGGATTTTTTTAATGAATACCATGGATTTATTTCCCATAGATTTATTTCCTGCTATAGCTAAATTGTTAGGATTACCTGCTTTACGTGTTGTGCCGTCTGCCGATGT
GAA
TATCACTTCTTCGCTAGCTTTAAATGTATTTGTACTTGTTATGTACTACAATATTTACGTTAATGGCGTTCATGGTTTTATTAAAGGACTGATGTATCATCCATTTAATCATCCAACATGTATTC
CTA
T
TAATTTTATTATTGAAGTTGTTAGTTTGTTATCTAAACCAGTATCACTTAGTCTTAGATTATTTGGCAATATGTATTCTGGTGAGTTGATTTTTATTTTGATATCTGGTTTATTACCATGGTGGG
GAC
A
ATGGGTTTTAAATTTACCATGGGCTATTTTTCATATTTTAGTCGTTACATTACAGGCTTTTATTTTTATGGTTTTAACGGTGATTTATTTATCTACAGCCCATGACTCCTGTTAAAATGAATCAT
GTA
A
TACAGAAGATTGCAGAGAGGTTATTATGGAACATTTAAATTTTGATATGTTATATATTGCTGCAGCAATAATGATGGGATTAGCAGCAATTGGAGCGGCTATCGGTATTGGCATCTTAGGTAGTA
A
ATTTTTAGAGGGGGCTGCACGTCAACCAGATCTCATTCCGATCCTTCGAACTCAGTTTTTTATTGTTATGGGATTGGTTGATGCAATACCAATGATTACTGTAGGTCTTGGTTTGTATGTGATGT
TT
TCTGCGGTTTAACAATGAAAATTAATTGCATGTATTTATTATATTGATTATTAAATATCAGGATTTGCGCTGTGAATCTTAATGCAACAATATTAGGTCAAACTATTTCATTTGTTTTGTTTGTT
TGG
T
TTTGTATGAAGTATGTGTGGTATCCATTTATATCTATTATTGAGAAACGCCAAAAAGAAATTTCTGATAATTTAGTTTCTGCTACTCATGCCAAAACAGAATCTGAGCGTGTCAATGCTGAAGCT
TT
GCTTTGTTTGAGACAGGCTCGGGTCAAAGCTCAAGAAATTATAAAACAAGCAAATAAATGTAAAATGCAAATAATTAATGAAGCTAAACATGAAGCTGAAAAGGAGCAAAGTAGAATTTTATCTC
AAGCGCGAGAACAGATTATTTATGAAAGAAAACGTGTTACTGACGAATTAAGAAAGCAAATTAGCGAACTTGTAATTGAGGGTACAGAGAAAGTTATAGAACATTCTATAAATGAAATGATTGAT
ATAGATCTTTTAAATAATATTATTAATACGTTGTCATATAAGGATTAGATGTCTAGTATGCTTGTGGTTGCGCGTACGTATGCTCAAGCTATATTTGATATAGCTGTAGAACAGAAAAATATAAA
CA
AGTGGAAATCAGTTCTTGATTTATTTTCTGAGATTAGTCTAAATAGACTAGTACAATCTTTATTTTTTAGATGTTTAGAACCAAAAAGATTGTCAGATATATTTATTGCTATTTGTGAAGATTAC
CAA
AAGAAACAAGTTGATACCTTCAGTAAAAATATAATCTATATTATGGCGGAAAATAATCGTTTATTATTATTACCAATTGTATTTAAAGAGTTTACTTATTTATGTTCTATATATGTTCATACTGT
AGA
A
ATAGAAATTATCTCTGCTTGGCCTTTGAAGTATAATCAGCTGAAAAAAATTACTGATATAATGGCTAAACGTTTATCTAAAACAGTGAATCCAGTACACAAAGTAGATAAAGATATATTGGCTGG
T
GTAATTATTCGTATTGGAGATACTGTGATTGATGGAAGTATACGTGGACGTATTTTTCGCTTAAATCACGTACTACAATCTTAATATTTTAACAGTAGTTAAAAGGTATAAACAAAAGATTATGC
AA
TTAAATTCAAATGAAATTTCAGATAATGGAGAAGTTATTATTAATGATTTAAAGTTATTTTATAATAAAGCTAGACAAACTAAAATTACAGAAGAACTTACAGAAATTGTTTCAGGAGCTTCTGT
AAT
ATAAACTTAAAAGATAGTTAGAGGTATAATTAATATGAGTTCTGGAAAAATTGTCCAGGTTATTGGAGCGGTGGTTGATGTTGCGTTCAATCAAGATGTGGTACCGACTGTATACCATGCACTTG
A
GGTGTAATACTTATATTTTCCCGTATAGCTCAGATGTTGCACAATTAAATAATTTTCTTAAAACACCTTTAACACATGAAACAAATGGCGAAGATCTTTTGAGAAGGCCAGAAATTAATTATAAA
AA
GTTATCTCAACTAAGTACTTTTAGTCCATCTATATTGGATCGTCAAGTATTCGAGCAAATTGAAATTCAAATAAAATATGAAGGTTATATTCGTCATCAACAAGAAGAAATAAAGAGACATATTT
AT
AATGAAAATACATTGTTACCGACTGATATAGATTTCAATATTGTTTCTGGATTATCTCAGGAGGTCATTGACAAACTCAATAATTATAAACCTTATTCTATTGGGCAGGCTTCTCGCATTTCTGG
TAT
CACTCCTGCGGCTATTTCTAATTTATTGGTTTGGTTAAAAAAACAAGGTTTGTTAGAGCATAATACATGCTAATCTGTTGAATAATGTATTTTCTATTAATCAAGGTATTATTTAATTTCCTATA
TAG
G
GTGTTTGTGATTGTTACAATATGGAGAGAGTTGATCGTGTAGAAAACCGGTATATTTATGTCTTTTCCAATAATAATTTTATAGAAATAATAATAGTAATTAGATTATTATTTTAATGGGTTTGT
TAT
GTATGGCATTATTTTTAATATTATACGGTTGTTTATACGTATCTAAATTTGCGCTTTGAATTTTTTTGAAAATAGGATTATACTGAACTTTTAGTTGTATACAAGTGTATTATTTCATATTTTTG
AAT
AA
ATATACGTGCTGTACTAATGGTTATTAATTACAAGATAAATTACTTGTCGACCGAACTATAGTTCGGTCGTGTGTTTGTTTCTGTAAGTTGTAACATATTATGTGAAATTTACTAATTAATTCAT
AGT
GTCATTTTAATTCTCTTTTATTGCATTAGTATATGGTTGTGTAAAAAGAGAGAGAGTGTTCTTGTTATTTTCTATTAGTACTAATTTTTTAAAAGTTGATGCAGGCACTGTCGTTCTTTTCGGAT
ACA
ACATCATTGTAAGTTATATATAAAAATGATTTAGAATTTCGACATGTTAGTGACAAGTTGTATATCGAGGTTGTAATGTTGTATTATACAAGAACATTGTAAAATATTTATAGTATATTGCAGCC
AAT
ATTTTTTGAAAGGTGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATT
ATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCAAGCGTCAGTAGAAGATTTAATAGTTAGTGGGAACAAGATTGTTGGAGTAATTACTCCAAAATTAGGAA
TG
AAATTTAGTGGTACGTCTGTTGTGTTGACAACCGGAACCTTTCTCAATGGTAAGATTCATATTGGGATGAATAATTTTAGAGGAGGTCGATCTGGAGATTCGGAGTCATCGTCATTGTTATCAGA
GCGATTGAAAGAATTGTCTTTTCAGATTAGTCGGTTAAAAACGGGTACTTCTCCTCGTGTGCATACCAAAGGGATAAATTTTGGTTCTTTACGTGCACAATATAGTGATGATCCCATTCCTGTGT
TT
TCATTTATAGGATCTACAAAACTACATCCTACGCAGGTGCCT

DNA sequencing


Why?


Identifies Organisms

How?


Dideoxy Sequencing


Introduces Biological Machines

Where?


Universities, MBL

Societal Impact?


Forensics, Insurance

DNA detective

?

DNA extraction

PCR

Gel electrophoresis

Insect
identification

ACAGATGTCTTGTAATCCGGC
CGTTGGTGGCATAGGGAAAG
GACATTTAGTGAAAGAAATTG
ATGCGATGGGTGGATCGATG
GCTTATGCTATCGATCAATCA
GGAATTCAATTTAGAGTACTT
AATAGTAGCAAAGGAGCTGC
TGTTAGAGCAACACGTGCTCA
GGCAGATAAAATATTATATCG
TCAAGCAATACGTAGTATTCT
TGAATATCAAAAATTTTTGTTG
GTTATTCA

DNA sequencing

Bioinformatics

Review of Project


How is this organism related to other species?

A

F

D

E

B

H

I

J

K

?

G

C

DNA sequences provide characters that are:



Numerous, discrete characters (A, T, C, G)


Directly comparable across species


Unlikely to change due to culture conditions


Can be sampled without ever culturing
(important for endosymbionts!)



ACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAG
GAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGACAGATGTCTTGTAATCC
GGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGT
GAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAA
CACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTA
GCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGG
GAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAG
CTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTCAATACGCGTGCTCAGGCAGATAAAATATTA

Molecular phylogenetics:


Inference of evolutionary relationships based on molecular data


Secondary structure

of 16S rRNA in
E. coli

Molecular
Phylogenetics


Step
1
. Select a DNA
region

that is
homologous
,
or similar across species
due to common ancestry.

Ribosomal RNA (rRNA)


Ideal gene for phylogenetic
studies because it :




is an essential gene that is
present in all organisms.




is a common target for
sequencing studies; large
database for comparisons.




contains sites that are
relatively conserved (stems)
and sites that are more free to
vary (loops).


Importance of
Ribosomes

in Cell Biology

Ribosomes

are part of the machinery
that synthesize cell proteins

Ribosomes

are so important that they
are ubiquitous and highly conserved

2. Amplify and

Sequence

this region across isolates….


ACAGATGTCTTGTAATCCGGCCGTTGGTGGCAT
AGGGAAAGGACATTTAGTGAAAGAAATTGATG
CGATGGGTGGATCGATGGCTTATGCTATCGATC
AATCAGGAATTCAATTTAGAGTACTTAATAGTA
GCAAAGGAGCTGCTGTTAGAGCAACACGTGCT
CAGGCAGATAAAATATTATATCGTCAAGCAATA
CGT

ACAGATGTCTTGTAATCCGGCCGTTGGTGGCAT
AGGGAAAGGACATTTAGTGAAAGAAATTGATG
CGATGGGTGGATCGATGGCTTATGCTATCGATC
AATCAGGAATTCAATTTAGAGTACTTAATAGTA
GCAAAGGAGCTGCTGTTAGAGCAACACGTGCT
CAGGCAGATAAAATATTATATCGTCAAGCAATA
CGT

ACAGATGTCTTGTAATCCGGCCGTTGGTGGCAT
AGGGAAAGGACATTTAGTGAAAGAAATTGATG
GTFTGGGTGGATCGATGGCTTATGCTATCGATC
AATCAGGAATTCAATTTAGAGTACTTAATAGTA
GCAAAGGAGCTGCTGTTAGAGCAACACGTGCT
CAGGCAGATAAAATATTATATCGTCAAGCAATA
CGT

ACAGATGTCTTGTAATCCGGCCGTTGGTGGCAT
AGGGAAAGGACATTTAGTGAAAGAAATTGATG
CGATGGGTGGATCGATGGCTTATGCTATCGATC
AATTTAGAATTCAATTTAGAGTACTTAATAGTAG
CAAAGGAGCTGCTGTTAGAGCAACACGTGCTC
AGGCAGATAAAATATTATATCGTCAAGCAATAC
GT

Sequence the

PCR product

PCR

3. Estimate relationships

based on extent of DNA similarity.


ATGTTGGCAGTCCGATGTAAGC

ATGTTGGCAGTCCGATGTAAGC

ATGTTGGCAGTCCGATGTAA
C
C

A
C
G
G
T
A
GCAGTC
T
GATGTA
TC
C

A
C
G
G
T
A
GCAGTC
T
GATGTA
TC
C

A
C
G
G
T
A
GCAGTC
T
GATGTA
TC
C

C
TG
C
TGG
T
AGTC
G
TT
TGTAA
C
C

C
TG
C
TGG
T
AGTC
G
TT
TGTAA
C
C

C
TG
C
TGGCAGTC
G
G
T
TGTAA
C
C

ATG
C
TGGCAGTC
G
G
G
TGTAA
C
C

ATG
G
TGGCAGTC
G
G
G
TGT
C
A
C
C

Colored letters = different from top sequence (taxon G)

Molecular phylogeny

of taxa A
-
I.


At variable DNA positions, related
groups will tend to share the
same nucleotide.


The sheer number of characters is
helpful to distinguish the
‘phylogenetic signal’ from noise.



The elegant idea behind DNA sequencing


Technology changes quickly, but for many years we’ve used Sanger’s cool trick.

Fred Sanger

In the 1970’s, Sanger’s group discovered a fundamentally new method of
'reading' the linear DNA sequence
using special bases called
chain terminators or
dideoxynucleotides
.


This method is still in use today.




What is the basis of Sanger’s method?


Shared with Walter Gilbert and Paul Berg

Fascinating. Now how do
we
actually sequence
??



DNA Polymerase Action

Mechanism of DNA
polymerization

Dideoxy Nucleotide

Dideoxies block elongation

H

ddGTP

X

DNA Sequencing Reactions

Gel Electrophoretic
Fractionation

of Products

Fractionating DNA Molecules


DNA is negatively charged at
neutral pH

DNA will travel towards a
positive charge

DNA electrophoresed in a gel
will travel according to its chain
length


Detecting DNA

Early experiments used radio
-
isotopically labeled DNA
(primers)


Now we use fluorescently
labeled dideoxynucleotides

denaturation

Primer annealing

Product

extension

Reaction steps seems a lot like PCR,
but not quite…

Perform cycle sequencing
in PCR machine


Use of
capillaries

filled with a matrix for higher
through
-
put of sequencing reactions.

e.g. ABI 3730

1. Purify PCR
product


2. Set up sequencing
reaction


3. Perform
cycle
sequencing

4. Resolve sequence
fragments

5. Read order of
terminators (DNA
sequence)

In sum: From PCR to sequence data

Quality

of sequence data may vary, depending on:




Purity and concentration of template DNA



Presence of extra PCR bands (artifacts)



Quality of dye
-
terminators, electrophoresis matrix, and other reagents


Ideally,
look at chromatograms

and convince yourself that base
calls are robust.

DNA sequence assembly
:
Combining sequence reads to
build the entire sequence of the template DNA






PCR PRODUCT of 1,200 bp

Sequence read #1

Sequence read #2

Sequence read #3

Sequence “reads” typically range from 500
-
800 bp. Often the total DNA fragment is much longer
.



Regions of overlap

among sequence reads:




Let us piece together the linear “puzzle” of the template DNA sequence.




Often confirm base calls and improve overall add data quality.

Dideoxies block elongation

H

ddGTP

X

Illumina Next Gen Sequencing

Major sequencing centers

have facilities to sequence
multiple full genomes each year



Due to genomic research over the past decade, DNA sequencing has
become:



Increasingly automated



Higher
-
throughput



Less $$ per reaction




And (
good news
) more accessible to researchers and educators


Many public universities have DNA sequencing facilities in house.


Such facilities are usually able to run small numbers of reactions for a
cost of ~$10
-
15 per reaction, but often much less for “internal users”
with ties to the university.


Ideal situation
:

Team up with faculty at your local university to act as
facilitators.


Possible avenues

for DNA sequencing:

Even if DNA sequencing not an option for classroom labs, important to
discuss:




how DNA sequencing is performed,



how data is evaluated,



what information can be obtained from the data,



what biologically important concepts can be learned,



ethical issues surrounding its interpretation and use.


Ethical issues involving DNA sequencing


Truro:

A tranquil Cape community shaken by the murder of a young woman in
January 2002

Should police have requested DNA of every man in Truro??

Thylacine pup preserved in alcohol in
1866. Its cells could be used for
cloning. By chance this Thylacine was
stored in a jar of alcohol rather than
formalin, which would have destroyed
the DNA.

Should scientists attempt to clone the now
-
extinct Thylacine to revive
this species?? (The technology will be there eventually.)


ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGAAGCAGCTTTGGCTTCTGCTAGGATGCAATGTAATACGCTTTTGATTACTCATAATATTGATACTCT
TG
GACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACT
TAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCAAGCGTCAGTAG
A
AGATTTAATAGTTAGTGGGAACAAGATTGTTGGAGTAATTACTCCAAAATTAGGAATGAAATTTAGTGGTACGTCTGTTGTGTTGACAACCGGAACCTTTCTCAATGGTAAGATTCATATTGGGA
T
GAATAATTTTAGAGGAGGTCGATCTGGAGATTCGGAGTCATCGTCATTGTTATCAGAGCGATTGAAAGAATTGTCTTTTCAGATTAGTCGGTTAAAAACGGGTACTTCTCCTCGTGTGCATACCA
AAGGGATAAATTTTGGTTCTTTACGTGCACAATATAGTGATGATCCCATTCCTGTGTTTTCATTTATAGGATCTACAAAACTACATCCTACGCAGGTGCCTTGTTATATTACCCATACTAATAAC
AA
AACACATGAAATAGTTAGATCAAATTTATATCAGAGTCCTATGTATACAGGTTTAATAAAAGGAATAGCACCTCGGTATTGTCCATCTATAGAAGACAAAATAACTCGTTTTTCAGATCGTAATG
CT
CATCAAATTTTTTTAGAACCTGAAGGTTTGACAACACCTGAAGTATATCTTAATGGTATTTCTACTAGCTTACCTTTTTGTGTACAAATGCAAATGATTAAATCAATTCAGGGATTAGAGAATGC
TTG
TATAATTAGGCCAGGTTATGCTATTGAATACGATTTTTTTGATCCTCGTGATTTAAAATTAACATTAGAGAGTAAAATTATTTCTGGATTATTTTTTTCTGGTCAAATTAATGGTACTACTGGTT
ATG
A
AGAAGCAGCTGCCCAAGGATTATTGGCCGGAATTAATGCAGCTAGGTTTTCCAAAAATAAAGAAGGATGGTACCCTAGAAGAGATCAGGCATATTTAGGGGTGCTTGTAGATGATCTCTGTACA
CATGGAACAGAAGAACCTTATCGTATGTTTACTTCGCGTGCTGAATATCGTCTGTCTTTACGTGAGGATAATGCTGATTTAAGATTAACTGAAATCGCGCGACAGTTAGGTTTGATAGATGAGTC
A
CGGTGGAAAGCTTTTTGTTGCAAAAAAGAAAACATTGAAAAAGAACGTCAGAGATTACGTAATACTTATATTTTCCCGTATAGCTCAGATGTTGCACAATTAAATAATTTTCTTAAAACACCTTT
AA
CACATGAAACAAATGGCGAAGATCTTTTGAGAAGGCCAGAAATTAATTATAAAAAGTTATCTCAACTAAGTACTTTTAGTCCATCTATATTGGATCGTCAAGTATTCGAGCAAATTGAAATTCAA
AT
AAAATATGAAGGTTATATTCGTCATCAACAAGAAGAAATAAAGAGACATATTTATAATGAAAATACATTGTTACCGACTGATATAGATTTCAATATTGTTTCTGGATTATCTCAGGAGGTCATTG
AC
AAACTCAATAATTATAAACCTTATTCTATTGGGCAGGCTTCTCGCATTTCTGGTATCACTCCTGCGGCTATTTCTAATTTATTGGTTTGGTTAAAAAAACAAGGTTTGTTAGAGCATAATACATG
CTA
ATCTGTTGAATAATGTATTTTCTATTAATCAAGGTATTATTTAATTTCCTATATAGGGTGTTTGTGATTGTTACAATATGGAGAGAGTTGATCGTGTAGAAAACCGGTATATTTATGTCTTTTCC
AAT
AATAATTTTATAGAAATAATAATAGTAATTAGATTATTATTTTAATGGGTTTGTTATGTATGGCATTATTTTTAATATTATACGGTTGTTTATACGTATCTAAATTTGCGCTTTGAATTTTTTTG
AAA
AT
AGGATTATACTGAACTTTTAGTTGTATACAAGTGTATTATTTCATATTTTTGAATAAATATACGTGCTGTACTAATGGTTATTAATTACAAGATAAATTACTTGTCGACCGAACTATAGTTCGGT
CGT
GTGTTTGTTTCTGTAAGTTGTAACATATTATGTGAAATTTACTAATTAATTCATAGTGTCATTTTAATTCTCTTTTATTGCATTAGTATATGGTTGTGTAAAAAGAGAGAGAGTGTTCTTGTTAT
TTT
C
TATTAGTACTAATTTTTTAAAAGTTGATGCAGGCACTGTCGTTCTTTTCGGATACAACATCATTGTAAGTTATATATAAAAATGATTTAGAATTTCGACATGTTAGTGACAAGTTGTATATCGAG
GTT
GTAATGTTGTATTATACAAGAACATTGTAAAATATTTATAGTATATTGCAGCCAATATTTTTTGAAAGGTGGTTTATGTCAGGAATCAAAGGCACTTCCCAAGAATATATTGGACATCATTTATA
TCA
TCTGCAATTTGATTTAAGTACTTTTTCGTTAGTGAGCTCGGAGAATACTTCTTCATTCTGGGTATTAAATGTAGATTCGATGTTTTTTTCAATATTATTGGCTACTTTATTTTTATTAATTTTCG
GTC
G
TTTGGCTACAGTGGCAACTTATGCGGTTCCCACAAAACTGCAAGTGTTTATTGAGTTAGTAATATTGTTTATTGATAGCAATGTAAAAGATATGTTTCATGGTAAAAATAAACTAATTGCGCCAT
TA
TCTATGACGGTTTTTGTTTGGATTTTTTTAATGAATACCATGGATTTATTTCCCATAGATTTATTTCCTGCTATAGCTAAATTGTTAGGATTACCTGCTTTACGTGTTGTGCCGTCTGCCGATGT
GAA
TATCACTTCTTCGCTAGCTTTAAATGTATTTGTACTTGTTATGTACTACAATATTTACGTTAATGGCGTTCATGGTTTTATTAAAGGACTGATGTATCATCCATTTAATCATCCAACATGTATTC
CTA
T
TAATTTTATTATTGAAGTTGTTAGTTTGTTATCTAAACCAGTATCACTTAGTCTTAGATTATTTGGCAATATGTATTCTGGTGAGTTGATTTTTATTTTGATATCTGGTTTATTACCATGGTGGG
GAC
A
ATGGGTTTTAAATTTACCATGGGCTATTTTTCATATTTTAGTCGTTACATTACAGGCTTTTATTTTTATGGTTTTAACGGTGATTTATTTATCTACAGCCCATGACTCCTGTTAAAATGAATCAT
GTA
A
TACAGAAGATTGCAGAGAGGTTATTATGGAACATTTAAATTTTGATATGTTATATATTGCTGCAGCAATAATGATGGGATTAGCAGCAATTGGAGCGGCTATCGGTATTGGCATCTTAGGTAGTA
A
ATTTTTAGAGGGGGCTGCACGTCAACCAGATCTCATTCCGATCCTTCGAACTCAGTTTTTTATTGTTATGGGATTGGTTGATGCAATACCAATGATTACTGTAGGTCTTGGTTTGTATGTGATGT
TT
TCTGCGGTTTAACAATGAAAATTAATTGCATGTATTTATTATATTGATTATTAAATATCAGGATTTGCGCTGTGAATCTTAATGCAACAATATTAGGTCAAACTATTTCATTTGTTTTGTTTGTT
TGG
T
TTTGTATGAAGTATGTGTGGTATCCATTTATATCTATTATTGAGAAACGCCAAAAAGAAATTTCTGATAATTTAGTTTCTGCTACTCATGCCAAAACAGAATCTGAGCGTGTCAATGCTGAAGCT
TT
GCTTTGTTTGAGACAGGCTCGGGTCAAAGCTCAAGAAATTATAAAACAAGCAAATAAATGTAAAATGCAAATAATTAATGAAGCTAAACATGAAGCTGAAAAGGAGCAAAGTAGAATTTTATCTC
AAGCGCGAGAACAGATTATTTATGAAAGAAAACGTGTTACTGACGAATTAAGAAAGCAAATTAGCGAACTTGTAATTGAGGGTACAGAGAAAGTTATAGAACATTCTATAAATGAAATGATTGAT
ATAGATCTTTTAAATAATATTATTAATACGTTGTCATATAAGGATTAGATGTCTAGTATGCTTGTGGTTGCGCGTACGTATGCTCAAGCTATATTTGATATAGCTGTAGAACAGAAAAATATAAA
CA
AGTGGAAATCAGTTCTTGATTTATTTTCTGAGATTAGTCTAAATAGACTAGTACAATCTTTATTTTTTAGATGTTTAGAACCAAAAAGATTGTCAGATATATTTATTGCTATTTGTGAAGATTAC
CAA
AAGAAACAAGTTGATACCTTCAGTAAAAATATAATCTATATTATGGCGGAAAATAATCGTTTATTATTATTACCAATTGTATTTAAAGAGTTTACTTATTTATGTTCTATATATGTTCATACTGT
AGA
A
ATAGAAATTATCTCTGCTTGGCCTTTGAAGTATAATCAGCTGAAAAAAATTACTGATATAATGGCTAAACGTTTATCTAAAACAGTGAATCCAGTACACAAAGTAGATAAAGATATATTGGCTGG
T
GTAATTATTCGTATTGGAGATACTGTGATTGATGGAAGTATACGTGGACGTATTTTTCGCTTAAATCACGTACTACAATCTTAATATTTTAACAGTAGTTAAAAGGTATAAACAAAAGATTATGC
AA
TTAAATTCAAATGAAATTTCAGATAATGGAGAAGTTATTATTAATGATTTAAAGTTATTTTATAATAAAGCTAGACAAACTAAAATTACAGAAGAACTTACAGAAATTGTTTCAGGAGCTTCTGT
AAT
ATAAACTTAAAAGATAGTTAGAGGTATAATTAATATGAGTTCTGGAAAAATTGTCCAGGTTATTGGAGCGGTGGTTGATGTTGCGTTCAATCAAGATGTGGTACCGACTGTATACCATGCACTTG
A
GGTGTAATACTTATATTTTCCCGTATAGCTCAGATGTTGCACAATTAAATAATTTTCTTAAAACACCTTTAACACATGAAACAAATGGCGAAGATCTTTTGAGAAGGCCAGAAATTAATTATAAA
AA
GTTATCTCAACTAAGTACTTTTAGTCCATCTATATTGGATCGTCAAGTATTCGAGCAAATTGAAATTCAAATAAAATATGAAGGTTATATTCGTCATCAACAAGAAGAAATAAAGAGACATATTT
AT
AATGAAAATACATTGTTACCGACTGATATAGATTTCAATATTGTTTCTGGATTATCTCAGGAGGTCATTGACAAACTCAATAATTATAAACCTTATTCTATTGGGCAGGCTTCTCGCATTTCTGG
TAT
CACTCCTGCGGCTATTTCTAATTTATTGGTTTGGTTAAAAAAACAAGGTTTGTTAGAGCATAATACATGCTAATCTGTTGAATAATGTATTTTCTATTAATCAAGGTATTATTTAATTTCCTATA
TAG
G
GTGTTTGTGATTGTTACAATATGGAGAGAGTTGATCGTGTAGAAAACCGGTATATTTATGTCTTTTCCAATAATAATTTTATAGAAATAATAATAGTAATTAGATTATTATTTTAATGGGTTTGT
TAT
GTATGGCATTATTTTTAATATTATACGGTTGTTTATACGTATCTAAATTTGCGCTTTGAATTTTTTTGAAAATAGGATTATACTGAACTTTTAGTTGTATACAAGTGTATTATTTCATATTTTTG
AAT
AA
ATATACGTGCTGTACTAATGGTTATTAATTACAAGATAAATTACTTGTCGACCGAACTATAGTTCGGTCGTGTGTTTGTTTCTGTAAGTTGTAACATATTATGTGAAATTTACTAATTAATTCAT
AGT
GTCATTTTAATTCTCTTTTATTGCATTAGTATATGGTTGTGTAAAAAGAGAGAGAGTGTTCTTGTTATTTTCTATTAGTACTAATTTTTTAAAAGTTGATGCAGGCACTGTCGTTCTTTTCGGAT
ACA
ACATCATTGTAAGTTATATATAAAAATGATTTAGAATTTCGACATGTTAGTGACAAGTTGTATATCGAGGTTGTAATGTTGTATTATACAAGAACATTGTAAAATATTTATAGTATATTGCAGCC
AAT
ATTTTTTGAAAGGTGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATT
ATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCAAGCGTCAGTAGAAGATTTAATAGTTAGTGGGAACAAGATTGTTGGAGTAATTACTCCAAAATTAGGAA
TG
AAATTTAGTGGTACGTCTGTTGTGTTGACAACCGGAACCTTTCTCAATGGTAAGATTCATATTGGGATGAATAATTTTAGAGGAGGTCGATCTGGAGATTCGGAGTCATCGTCATTGTTATCAGA
GCGATTGAAAGAATTGTCTTTTCAGATTAGTCGGTTAAAAACGGGTACTTCTCCTCGTGTGCATACCAAAGGGATAAATTTTGGTTCTTTACGTGCACAATATAGTGATGATCCCATTCCTGTGT
TT
TCATTTATAGGATCTACAAAACTACATCCTACGCAGGTGCCT

DNA sequencing


Why?


Identifies Organisms

How?


Dideoxy Sequencing


Introduces Biological Machines

Where?


Universities, MBL

Societal Impact?


Forensics, Insurance

DNA detective