Bioinformatics and pathogenomics - CINF

dasypygalstockingsΒιοτεχνολογία

2 Οκτ 2013 (πριν από 4 χρόνια και 3 μήνες)

83 εμφανίσεις

“Emergency discovery” of novel antimicrobials among
known drugs in response to new and re
-
emerging
infectious threats



A. Cherkasov

UBC / VGH Infectious Diseases

artc@interchange.ubc.ca

1.
‘Binary QSAR Models for ‘Antibiotic
-
likeness’

and ‘Metabolite
-
likeness’


2. Finding potential antibiotics among common

drugs, substances



3. Attacking essential proteins in emerging

and re
-
emerging pathogens: Prospectives, Protocols


1.
‘Binary QSAR Models for ‘Antibiotic
-
likeness’

and ‘Metabolite
-
likeness’


GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCT
GCA
ATGACAAAGGTAC
CCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCT
GAG
CAGCCACAACCTA
CTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCT
TCT
GCCTTTGCTCCTG
GGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCC
CAG
GGTGAGGATGACT
CATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTT
CAT
GCATCCTCTGGAA
GATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCT
CAT
TTCGCACTCACCT
TGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAG
TAT
TCCATTGTAGCTC
TTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTC
ATG
GAGGAAGAGNGCT
CAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCA
GGG
GAATGGGCATGGA
GTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTT
TCC
TAAACTTGATGAC
CTAGGGCTAGGGGCATGTTGAATCTCAGCCTCGCCCACTGGCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCAC
AGT
CAGCTTCTAGTTC
TGTAGCCCCAGCTGCTCCTGCGGTGGAGGGAGCTACACATCAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTG
AGC
ACTGCGGGCTGAC
CTGCTCCCAACCAGGGAGATGGAGCTTCCCCCTTGAGTCGGGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGT
TGT
GGCAACTGATTGG
TGACCTGGGGGGCGTTTCTGAGCCCACAGTGCTGGCATCAGGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTG
ATT
TTGGGAGGGGAGT
TCTCTCGTAATGACACTGAGGATGCCTTCAAGTTGGGCTTCTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCA
GTG
GGCGGAGGGAGCG
GGAAGCGCGTCAGTGGGCGGAGTATTTGAGAACATTTCACAAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGA
AGC
AGCCCCAGGACCT
CCCTGGCTCAAGGAGTGACAGCGAGTTTGTCTGAGGTGAGGGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGG
AGG
CATTCAGGTGGGC
AGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGC
TCC
TCTTTGCCTTACT
CCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTC
CCC
ATGAGCCAAGACG
GCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGG
AAT
TTCAGTTCATGCA
GGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAG
TGA
CCTGATTTTTTCC
TGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTC
TGG
TTATCTGTGGCAC
ATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTT
GTG
TCTGGGGTTTATG
ATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGT
CTC
TGTTTGCTGATGC
TGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGAC
CTC
TTCTACTACAAAA
TCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCA
AGA
TCCAGCTGGAAAT
CAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTA
GGT
GCCCTTGAGCCCA
GCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGA
GGC
TGGCTGGCTGGAC
GAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAATC
TCA
GCCTCGCCCACTG
GCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCACAGTCAGCTTCTAGTTCTGTAGCCCCAGCTGCTCCTGCGGT
GGA
GGGAGCTACACAT
CAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTGAGCACTGCGGGCTGACCTGCTCCCAACCAGGGAGATGGAG
CTT
CCCCCTTGAGTCG
GGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGTTGTGGCAACTGATTGGTGACCTGGGGGGCGTTTCTGAGCC
CAC
AGTGCTGGCATCA
GGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTGATTTTGGGAGGGGAGTTCTCTCGTAATGACACTGAGGATG
CCT
TCAAGTTGGGCTT
CTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCAGTGGGCGGAGGGAGCGGGAAGCGCGTCAGTGGGCGGAGTA
TTT
GAGAACATTTCAC
AAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGAAGCAGCCCCAGGACCTCCCTGGCTCAAGGAGTGACAGCGA
GTT
TGTCTGAGGTGAG
GGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCC
GTT
GAGGCCAGGGGCA
TAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGT
GGC
AGCCAGTGCCACC
ATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGG
GAG
ACTCATGAGGCCG
TTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCAT
GGA
GCTCCCATTGGTG
GCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTA
ATT
TGCATTCCCTACC
GGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGT
GCT
TCCACATCTGTCC
AAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCA
AGG
CTGTATGTTTACA
TTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATT
TGT
CATTAGTCAACCG
GAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAG
TCA
TACACGTTCTAAC
TCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCC
ACA
TTTTCTAGCCCAC
TCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGC
TCT
GGGAGCTGGGTGT
CAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACA
CAC
TTGATGGGAGTTT
TCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGA
GCA
ATGTTGGATGAGT
GAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGA
GCC
CCTTCCAAGGGTG
GACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAA

QSAR

quantitative structure
-
activity relationships

Molecular structure

gets translated into numbers

(descriptors)

THE UNIVERSITY OF BRITISH COLUMBIA

MEDICINE INFECTIOUS DISEASES

Mathematical function

f
( Descriptors) ~ Activity


GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCT
GCA
ATGACAAAGGTAC
CCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCT
GAG
CAGCCACAACCTA
CTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCT
TCT
GCCTTTGCTCCTG
GGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCC
CAG
GGTGAGGATGACT
CATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTT
CAT
GCATCCTCTGGAA
GATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCT
CAT
TTCGCACTCACCT
TGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAG
TAT
TCCATTGTAGCTC
TTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTC
ATG
GAGGAAGAGNGCT
CAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCA
GGG
GAATGGGCATGGA
GTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTT
TCC
TAAACTTGATGAC
CTAGGGCTAGGGGCATGTTGAATCTCAGCCTCGCCCACTGGCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCAC
AGT
CAGCTTCTAGTTC
TGTAGCCCCAGCTGCTCCTGCGGTGGAGGGAGCTACACATCAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTG
AGC
ACTGCGGGCTGAC
CTGCTCCCAACCAGGGAGATGGAGCTTCCCCCTTGAGTCGGGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGT
TGT
GGCAACTGATTGG
TGACCTGGGGGGCGTTTCTGAGCCCACAGTGCTGGCATCAGGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTG
ATT
TTGGGAGGGGAGT
TCTCTCGTAATGACACTGAGGATGCCTTCAAGTTGGGCTTCTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCA
GTG
GGCGGAGGGAGCG
GGAAGCGCGTCAGTGGGCGGAGTATTTGAGAACATTTCACAAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGA
AGC
AGCCCCAGGACCT
CCCTGGCTCAAGGAGTGACAGCGAGTTTGTCTGAGGTGAGGGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGG
AGG
CATTCAGGTGGGC
AGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGC
TCC
TCTTTGCCTTACT
CCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTC
CCC
ATGAGCCAAGACG
GCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGG
AAT
TTCAGTTCATGCA
GGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAG
TGA
CCTGATTTTTTCC
TGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTC
TGG
TTATCTGTGGCAC
ATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTT
GTG
TCTGGGGTTTATG
ATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGT
CTC
TGTTTGCTGATGC
TGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGAC
CTC
TTCTACTACAAAA
TCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCA
AGA
TCCAGCTGGAAAT
CAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTA
GGT
GCCCTTGAGCCCA
GCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGA
GGC
TGGCTGGCTGGAC
GAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAATC
TCA
GCCTCGCCCACTG
GCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCACAGTCAGCTTCTAGTTCTGTAGCCCCAGCTGCTCCTGCGGT
GGA
GGGAGCTACACAT
CAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTGAGCACTGCGGGCTGACCTGCTCCCAACCAGGGAGATGGAG
CTT
CCCCCTTGAGTCG
GGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGTTGTGGCAACTGATTGGTGACCTGGGGGGCGTTTCTGAGCC
CAC
AGTGCTGGCATCA
GGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTGATTTTGGGAGGGGAGTTCTCTCGTAATGACACTGAGGATG
CCT
TCAAGTTGGGCTT
CTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCAGTGGGCGGAGGGAGCGGGAAGCGCGTCAGTGGGCGGAGTA
TTT
GAGAACATTTCAC
AAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGAAGCAGCCCCAGGACCTCCCTGGCTCAAGGAGTGACAGCGA
GTT
TGTCTGAGGTGAG
GGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCC
GTT
GAGGCCAGGGGCA
TAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGT
GGC
AGCCAGTGCCACC
ATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGG
GAG
ACTCATGAGGCCG
TTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCAT
GGA
GCTCCCATTGGTG
GCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTA
ATT
TGCATTCCCTACC
GGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGT
GCT
TCCACATCTGTCC
AAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCA
AGG
CTGTATGTTTACA
TTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATT
TGT
CATTAGTCAACCG
GAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAG
TCA
TACACGTTCTAAC
TCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCC
ACA
TTTTCTAGCCCAC
TCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGC
TCT
GGGAGCTGGGTGT
CAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACA
CAC
TTGATGGGAGTTT
TCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGA
GCA
ATGTTGGATGAGT
GAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGA
GCC
CCTTCCAAGGGTG
GACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAA

Inductive descriptors

The

relative

area

of

frontal


Screening

of

a

surface

of


atom

A

by

atom

B


(shown

as

a

green

shadow)

is



“Inductive ” QSAR Descriptors

Average Electronegativities of the Negatively/Positively Charged Atoms

Molecular (equalized) Electronegativity

Total Formal Charge

Average Atomic Hardness

Sum of Atomic Hardnesses

Average Negative/Positive Charges

Largest Positive Charge

Average Atomic Hardnesses of Negatively/Positively Charged Atoms

Hardness of the Most Positively Charged Atom

Largest Hardness among the Negatively/Positively Charged Atoms

Sum of Softnesses of Negatively Charged Atoms

Steric Effect on the Most Negatively Charged Atom

Most Negative Inductive Constant of an Atom in Molecule

Largest Positive Inductive Effect on an Atom in Molecule

The Smallest Steric Effect on a Atom in Molecule

Sum of all Negative Inductive Effects on Atoms in Molecule


…..

QSAR models for antibiotics, drugs and bacteria and human metabolites

A. Cherkasov.
J Chem Inf Model, 46, 1214 (
2006
),

E. Karakoc et al Bioinformatics, 22, e243v (
2006
)

QSAR models for antimicrobial peptides


A. Cherkasov. Current Computer
-
Aided Drug Design, 1, 21 (
2005
)

H. Jenssen et al Chem Biol Drug Des. 70, 134 (
2007
)

A hybrid QSAR/Docking approach ‘Progressive docking’ has been developed

A. Cherkasov et al, J Med Chem. 49, 7466 (
2006
)

Various low
-
micromolar to nanomolar inhibitors developed with the help of ‘inductive’
QSAR solutions

A. Cherkasov et al, J Med Chem, 48, 3203 (
2005
)

A. Cherkasov et al J Chem Inf Model, 45, 1842 (
2005
)

QSAR model for pK constants of carboxylic acids and protonated amines

A. Cherkasov et al, J Phys Chem, 107, 9695 (
2003
)

Descriptors
-
derived system for protein charge calculation

A. Cherkasov. J Chem Inf Comp Sci, 43, 2039 (
2003
)

QSAR model for dipole moments

A. Cherkasov et al, J. Mol. Struct. Theochem, 497, 115 (
2000
)

QSAR models for oxidation energies of free radicals


A Cherkasov et al, J Chem Inf Comp Sci, 40, 1222 (
2000
), 39, 1057 (
1999
), 38, 1151 (
1998
)

QSAR models for Gas Basicity of Amines

A. Cherkasov et al, J Mol Graph Model, 17, 28 (
1999
)

Predictive model for inductive substituent constants.

A. Cherkasov et al, J Phys Org Chem 11, 437 (
1998
)

QSAR MODEL FOR ANTIBIOTICS

A

mixture

of

known

antibiotics

and

non
-
antibiotics

Table 1Testing peptide classification performance. QSAR
-

predictions based on QSAR descriptors; AA
-

predictions based on amino
-
acid sequence only.

2/3 of all compounds for training

1/3 of all compounds for testing

VALIDATION:
How

the model performs on

test compounds

QSAR model for the training set

GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCT
GCA
ATGACAAAGGTAC
CCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCT
GAG
CAGCCACAACCTA
CTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCT
TCT
GCCTTTGCTCCTG
GGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCC
CAG
GGTGAGGATGACT
CATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTT
CAT
GCATCCTCTGGAA
GATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCT
CAT
TTCGCACTCACCT
TGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAG
TAT
TCCATTGTAGCTC
TTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTC
ATG
GAGGAAGAGNGCT
CAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCA
GGG
GAATGGGCATGGA
GTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTT
TCC
TAAACTTGATGAC
CTAGGGCTAGGGGCATGTTGAATCTCAGCCTCGCCCACTGGCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCAC
AGT
CAGCTTCTAGTTC
TGTAGCCCCAGCTGCTCCTGCGGTGGAGGGAGCTACACATCAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTG
AGC
ACTGCGGGCTGAC
CTGCTCCCAACCAGGGAGATGGAGCTTCCCCCTTGAGTCGGGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGT
TGT
GGCAACTGATTGG
TGACCTGGGGGGCGTTTCTGAGCCCACAGTGCTGGCATCAGGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTG
ATT
TTGGGAGGGGAGT
TCTCTCGTAATGACACTGAGGATGCCTTCAAGTTGGGCTTCTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCA
GTG
GGCGGAGGGAGCG
GGAAGCGCGTCAGTGGGCGGAGTATTTGAGAACATTTCACAAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGA
AGC
AGCCCCAGGACCT
CCCTGGCTCAAGGAGTGACAGCGAGTTTGTCTGAGGTGAGGGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGG
AGG
CATTCAGGTGGGC
AGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGC
TCC
TCTTTGCCTTACT
CCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTC
CCC
ATGAGCCAAGACG
GCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGG
AAT
TTCAGTTCATGCA
GGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAG
TGA
CCTGATTTTTTCC
TGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTC
TGG
TTATCTGTGGCAC
ATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTT
GTG
TCTGGGGTTTATG
ATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGT
CTC
TGTTTGCTGATGC
TGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGAC
CTC
TTCTACTACAAAA
TCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCA
AGA
TCCAGCTGGAAAT
CAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTA
GGT
GCCCTTGAGCCCA
GCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGA
GGC
TGGCTGGCTGGAC
GAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAATC
TCA
GCCTCGCCCACTG
GCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCACAGTCAGCTTCTAGTTCTGTAGCCCCAGCTGCTCCTGCGGT
GGA
GGGAGCTACACAT
CAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTGAGCACTGCGGGCTGACCTGCTCCCAACCAGGGAGATGGAG
CTT
CCCCCTTGAGTCG
GGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGTTGTGGCAACTGATTGGTGACCTGGGGGGCGTTTCTGAGCC
CAC
AGTGCTGGCATCA
GGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTGATTTTGGGAGGGGAGTTCTCTCGTAATGACACTGAGGATG
CCT
TCAAGTTGGGCTT
CTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCAGTGGGCGGAGGGAGCGGGAAGCGCGTCAGTGGGCGGAGTA
TTT
GAGAACATTTCAC
AAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGAAGCAGCCCCAGGACCTCCCTGGCTCAAGGAGTGACAGCGA
GTT
TGTCTGAGGTGAG
GGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCC
GTT
GAGGCCAGGGGCA
TAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGT
GGC
AGCCAGTGCCACC
ATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGG
GAG
ACTCATGAGGCCG
TTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCAT
GGA
GCTCCCATTGGTG
GCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTA
ATT
TGCATTCCCTACC
GGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGT
GCT
TCCACATCTGTCC
AAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCA
AGG
CTGTATGTTTACA
TTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATT
TGT
CATTAGTCAACCG
GAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAG
TCA
TACACGTTCTAAC
TCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCC
ACA
TTTTCTAGCCCAC
TCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGC
TCT
GGGAGCTGGGTGT
CAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACA
CAC
TTGATGGGAGTTT
TCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGA
GCA
ATGTTGGATGAGT
GAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGA
GCC
CCTTCCAAGGGTG
GACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAA

THE UNIVERSITY OF BRITISH COLUMBIA

MEDICINE INFECTIOUS DISEASES

A
number

of
QSAR

models

have been elaborated to separate individual clusters within

the dataset of
958 human therapeutics, 519 antimicrobials, 1202 drug
-
like chemicals,

as well as

1102 human
-
, 551 bacterial
-
, 2351 plant
-

and 825 fungal metabolites.

Antimicrobials

from

Drugs

Antimicrobials

from

Drug
-
likes

Distinguishing

Antimicrobials

from

all

others

Distinguishing

Antimicrobials

versus

Drugs

versus

Drug
-
likes

QSAR

model

for

Bacterial

Metabolites

Train

Test

Train

Test

Train

Test

Train

Test

Train

Test

T_P

327

130

332

140

294

124

270

89

360

139

T_N

631

248

841

342

1490

621

1486

644

792

347

F_P

49

33

7

14

32

20

17

14

39

26

F_N

33

35

30

23

66

41

108

58

48

19

SPEC

0
.
93

0
.
88

0
.
99

0
.
96

0
.
98

0
.
97

0
.
99

0
.
98

0
.
95

0
.
93

SENS

0
.
91

0
.
79

0
.
92

0
.
86

0
.
82

0
.
75

0
.
71

0
.
61

0
.
88

0
.
88

ACCU
R

0
.
92

0
.
85

0
.
97

0
.
93

0
.
95

0
.
92

0
.
93

0
.
91

0
.
93

0
.
92

PPV

0
.
87

0
.
80

0
.
98

0
.
91

0
.
90

0
.
86

0
.
94

0
.
86

0
.
90

0
.
84

NPV

0
.
95

0
.
88

0
.
97

0
.
94

0
.
96

0
.
94

0
.
93

0
.
92

0
.
94

0
.
95

THE UNIVERSITY OF BRITISH COLUMBIA

MEDICINE INFECTIOUS DISEASES

THE UNIVERSITY OF BRITISH COLUMBIA

MEDICINE INFECTIOUS DISEASES

Method

Validation

True

Posit.

TrueNegat

FalsePosit.

FalseNega
t

Spec.

Sens.

Accur

PPV

NPV

Antibacterials
versus

(Drugs + Drug
-
likes + Bacteria Metabolites + Human Metabolites)

k
NN

Training

70
%

269

2610

9

95

0.97

0.74

0.95

0.80

0.96

Testing

30
%

117

1119

8

39

0.98

0.75

0.95

0.81

0.97

LOO

400

3727

9

120

0.97

0.77

0.95

0.80

0.97

LDA

Training

70
%

364

0

2679

0

0.00

1.00

0.12

0.12

0.00

Testing

30
%

156

0

1147

0

0.00

1.00

0.12

0.12

0.00

LOO

261

3751

75

259

0.98

0.50

0.92

0.78

0.94

MLR

Training

70
%

194

564

2115

170

0.21

0.53

0.25

0.08

0.77

Testing

30
%

61

1129

18

95

0.98

0.39

0.91

0.77

0.92

LOO

279

3726

100

241

0.97

0.54

0.92

0.74

0.94

ANN

Training

70
%

294

2651

27

70

0.99

0.81

0.97

0.92

0.97

Testing

30
%

129

1132

16

27

0.99

0.83

0.97

0.89

0.98

LOO

449

3821

5

71

0.99

0.86

0.98

0.99

0.98

Bacteria Metabolites

versus

(Drugs + Drug
-
likes + Antibacterials + Human Metabolites)

k
NN

Training

70
%

311

2537

112

83

0.96

0.79

0.94

074

0.97

Testing

30
%

135

1091

44

33

0.96

0.80

0.94

0.75

0.97

LOO

455

3637

147

107

0.96

0.81

0.94

0.76

0.97

LDA

Training

70
%

240

2587

62

154

0.98

0.61

0.93

0.79

0.94

Testing

30
%

90

1088

47

78

0.96

0.54

0.90

0.66

0.93

LOO

336

3665

119

226

0.97

0.60

0.92

0.74

0.94

MLR

Training

70
%

301

2525

124

93

0.95

0.76

0.93

0.71

0.96

Testing

30
%

119

1073

62

49

0.95

0.71

0.91

0.66

0.96

LOO

406

3603

181

156

0.95

0.72

0.92

0.69

0.96

ANN

Training

70
%

338

2597

52

55

0.98

0.86

0.96

0.87

0.98

Testing

30
%

159

1076

59

10

0.95

0.94

0.95

0.73

0.99

LOO

534

3780

4

28

0.99

0.95

0.99

0.99

0.99

GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCT
GCA
ATGACAAAGGTAC
CCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCT
GAG
CAGCCACAACCTA
CTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCT
TCT
GCCTTTGCTCCTG
GGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCC
CAG
GGTGAGGATGACT
CATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTT
CAT
GCATCCTCTGGAA
GATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCT
CAT
TTCGCACTCACCT
TGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAG
TAT
TCCATTGTAGCTC
TTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTC
ATG
GAGGAAGAGNGCT
CAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCA
GGG
GAATGGGCATGGA
GTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTT
TCC
TAAACTTGATGAC
CTAGGGCTAGGGGCATGTTGAATCTCAGCCTCGCCCACTGGCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCAC
AGT
CAGCTTCTAGTTC
TGTAGCCCCAGCTGCTCCTGCGGTGGAGGGAGCTACACATCAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTG
AGC
ACTGCGGGCTGAC
CTGCTCCCAACCAGGGAGATGGAGCTTCCCCCTTGAGTCGGGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGT
TGT
GGCAACTGATTGG
TGACCTGGGGGGCGTTTCTGAGCCCACAGTGCTGGCATCAGGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTG
ATT
TTGGGAGGGGAGT
TCTCTCGTAATGACACTGAGGATGCCTTCAAGTTGGGCTTCTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCA
GTG
GGCGGAGGGAGCG
GGAAGCGCGTCAGTGGGCGGAGTATTTGAGAACATTTCACAAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGA
AGC
AGCCCCAGGACCT
CCCTGGCTCAAGGAGTGACAGCGAGTTTGTCTGAGGTGAGGGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGG
AGG
CATTCAGGTGGGC
AGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGC
TCC
TCTTTGCCTTACT
CCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTC
CCC
ATGAGCCAAGACG
GCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGG
AAT
TTCAGTTCATGCA
GGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAG
TGA
CCTGATTTTTTCC
TGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTC
TGG
TTATCTGTGGCAC
ATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTT
GTG
TCTGGGGTTTATG
ATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGT
CTC
TGTTTGCTGATGC
TGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGAC
CTC
TTCTACTACAAAA
TCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCA
AGA
TCCAGCTGGAAAT
CAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTA
GGT
GCCCTTGAGCCCA
GCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGA
GGC
TGGCTGGCTGGAC
GAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAATC
TCA
GCCTCGCCCACTG
GCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCACAGTCAGCTTCTAGTTCTGTAGCCCCAGCTGCTCCTGCGGT
GGA
GGGAGCTACACAT
CAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTGAGCACTGCGGGCTGACCTGCTCCCAACCAGGGAGATGGAG
CTT
CCCCCTTGAGTCG
GGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGTTGTGGCAACTGATTGGTGACCTGGGGGGCGTTTCTGAGCC
CAC
AGTGCTGGCATCA
GGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTGATTTTGGGAGGGGAGTTCTCTCGTAATGACACTGAGGATG
CCT
TCAAGTTGGGCTT
CTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCAGTGGGCGGAGGGAGCGGGAAGCGCGTCAGTGGGCGGAGTA
TTT
GAGAACATTTCAC
AAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGAAGCAGCCCCAGGACCTCCCTGGCTCAAGGAGTGACAGCGA
GTT
TGTCTGAGGTGAG
GGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCC
GTT
GAGGCCAGGGGCA
TAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGT
GGC
AGCCAGTGCCACC
ATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGG
GAG
ACTCATGAGGCCG
TTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCAT
GGA
GCTCCCATTGGTG
GCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTA
ATT
TGCATTCCCTACC
GGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGT
GCT
TCCACATCTGTCC
AAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCA
AGG
CTGTATGTTTACA
TTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATT
TGT
CATTAGTCAACCG
GAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAG
TCA
TACACGTTCTAAC
TCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCC
ACA
TTTTCTAGCCCAC
TCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGC
TCT
GGGAGCTGGGTGT
CAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACA
CAC
TTGATGGGAGTTT
TCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGA
GCA
ATGTTGGATGAGT
GAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGA
GCC
CCTTCCAAGGGTG
GACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAA

THE UNIVERSITY OF BRITISH COLUMBIA

MEDICINE INFECTIOUS DISEASES

Separation of various classes of substances in the
chemical space

Antibacterials

Inactive

Chemicals

General drugs

Bacterial metabolites

2. Finding potential antibiotics among common

drugs, substances




Bad Bugs Need Drugs
: IDSA, March 2006

Antimicrobial Availability Task Force

Widespread prevalence of MDR bacteria in hospitals

Few drugs in a pipeline, Urgent need for R&D

Experts Fear Increase in Drug
-
resistant
Infectious Here
:

Globe and Mail, March 2006

MRSA, a treatment
-
resistant form of
bacteria that spreads through direct
contact, is called a greater threat to public
health than SARS or bird flu.

The Boston
Globe, August 21, 2006



Resistance mechanisms are very effective

(specific toward the existing antibiotics)







Resistance mechanisms are very effective

(specific toward the existing antibiotics)





Lateral gene transfer…



Resistance mechanisms are very effective

(specific toward the existing antibiotics)





Lateral gene transfer…

Active transport…



Resistance mechanisms are very effective

(specific toward the existing antibiotics)





Lateral gene transfer…

Active transport…

Resistant mutations…



Resistance mechanisms are very effective

(specific toward the existing antibiotics)





BUT ‘off
-
target’ bacterial inhibition by non
-
antibiotics
might still work…


Lateral gene transfer…

Active transport…

Resistant mutations…



Resistance mechanisms are very effective

(specific toward the existing antibiotics)





BUT ‘off
-
target’ bacterial inhibition by non
-
antibiotics
might still work…
NEED TO FIND SUCH AB
-
LIKE DRUGS


Lateral gene transfer…

Active transport…

Resistant mutations…

GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCT
GCA
ATGACAAAGGTAC
CCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCT
GAG
CAGCCACAACCTA
CTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCT
TCT
GCCTTTGCTCCTG
GGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCC
CAG
GGTGAGGATGACT
CATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTT
CAT
GCATCCTCTGGAA
GATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCT
CAT
TTCGCACTCACCT
TGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAG
TAT
TCCATTGTAGCTC
TTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTC
ATG
GAGGAAGAGNGCT
CAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCA
GGG
GAATGGGCATGGA
GTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTT
TCC
TAAACTTGATGAC
CTAGGGCTAGGGGCATGTTGAATCTCAGCCTCGCCCACTGGCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCAC
AGT
CAGCTTCTAGTTC
TGTAGCCCCAGCTGCTCCTGCGGTGGAGGGAGCTACACATCAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTG
AGC
ACTGCGGGCTGAC
CTGCTCCCAACCAGGGAGATGGAGCTTCCCCCTTGAGTCGGGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGT
TGT
GGCAACTGATTGG
TGACCTGGGGGGCGTTTCTGAGCCCACAGTGCTGGCATCAGGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTG
ATT
TTGGGAGGGGAGT
TCTCTCGTAATGACACTGAGGATGCCTTCAAGTTGGGCTTCTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCA
GTG
GGCGGAGGGAGCG
GGAAGCGCGTCAGTGGGCGGAGTATTTGAGAACATTTCACAAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGA
AGC
AGCCCCAGGACCT
CCCTGGCTCAAGGAGTGACAGCGAGTTTGTCTGAGGTGAGGGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGG
AGG
CATTCAGGTGGGC
AGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGC
TCC
TCTTTGCCTTACT
CCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTC
CCC
ATGAGCCAAGACG
GCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGG
AAT
TTCAGTTCATGCA
GGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAG
TGA
CCTGATTTTTTCC
TGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTC
TGG
TTATCTGTGGCAC
ATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTT
GTG
TCTGGGGTTTATG
ATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGT
CTC
TGTTTGCTGATGC
TGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGAC
CTC
TTCTACTACAAAA
TCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCA
AGA
TCCAGCTGGAAAT
CAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTA
GGT
GCCCTTGAGCCCA
GCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGA
GGC
TGGCTGGCTGGAC
GAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAATC
TCA
GCCTCGCCCACTG
GCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCACAGTCAGCTTCTAGTTCTGTAGCCCCAGCTGCTCCTGCGGT
GGA
GGGAGCTACACAT
CAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTGAGCACTGCGGGCTGACCTGCTCCCAACCAGGGAGATGGAG
CTT
CCCCCTTGAGTCG
GGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGTTGTGGCAACTGATTGGTGACCTGGGGGGCGTTTCTGAGCC
CAC
AGTGCTGGCATCA
GGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTGATTTTGGGAGGGGAGTTCTCTCGTAATGACACTGAGGATG
CCT
TCAAGTTGGGCTT
CTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCAGTGGGCGGAGGGAGCGGGAAGCGCGTCAGTGGGCGGAGTA
TTT
GAGAACATTTCAC
AAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGAAGCAGCCCCAGGACCTCCCTGGCTCAAGGAGTGACAGCGA
GTT
TGTCTGAGGTGAG
GGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCC
GTT
GAGGCCAGGGGCA
TAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGT
GGC
AGCCAGTGCCACC
ATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGG
GAG
ACTCATGAGGCCG
TTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCAT
GGA
GCTCCCATTGGTG
GCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTA
ATT
TGCATTCCCTACC
GGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGT
GCT
TCCACATCTGTCC
AAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCA
AGG
CTGTATGTTTACA
TTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATT
TGT
CATTAGTCAACCG
GAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAG
TCA
TACACGTTCTAAC
TCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCC
ACA
TTTTCTAGCCCAC
TCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGC
TCT
GGGAGCTGGGTGT
CAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACA
CAC
TTGATGGGAGTTT
TCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGA
GCA
ATGTTGGATGAGT
GAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGA
GCC
CCTTCCAAGGGTG
GACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAA

THE UNIVERSITY OF BRITISH COLUMBIA

MEDICINE INFECTIOUS DISEASES

GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCT
GCA
ATGACAAAGGTAC
CCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCT
GAG
CAGCCACAACCTA
CTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCT
TCT
GCCTTTGCTCCTG
GGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCC
CAG
GGTGAGGATGACT
CATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTT
CAT
GCATCCTCTGGAA
GATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCT
CAT
TTCGCACTCACCT
TGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAG
TAT
TCCATTGTAGCTC
TTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTC
ATG
GAGGAAGAGNGCT
CAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCA
GGG
GAATGGGCATGGA
GTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTT
TCC
TAAACTTGATGAC
CTAGGGCTAGGGGCATGTTGAATCTCAGCCTCGCCCACTGGCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCAC
AGT
CAGCTTCTAGTTC
TGTAGCCCCAGCTGCTCCTGCGGTGGAGGGAGCTACACATCAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTG
AGC
ACTGCGGGCTGAC
CTGCTCCCAACCAGGGAGATGGAGCTTCCCCCTTGAGTCGGGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGT
TGT
GGCAACTGATTGG
TGACCTGGGGGGCGTTTCTGAGCCCACAGTGCTGGCATCAGGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTG
ATT
TTGGGAGGGGAGT
TCTCTCGTAATGACACTGAGGATGCCTTCAAGTTGGGCTTCTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCA
GTG
GGCGGAGGGAGCG
GGAAGCGCGTCAGTGGGCGGAGTATTTGAGAACATTTCACAAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGA
AGC
AGCCCCAGGACCT
CCCTGGCTCAAGGAGTGACAGCGAGTTTGTCTGAGGTGAGGGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGG
AGG
CATTCAGGTGGGC
AGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGC
TCC
TCTTTGCCTTACT
CCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTC
CCC
ATGAGCCAAGACG
GCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGG
AAT
TTCAGTTCATGCA
GGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAG
TGA
CCTGATTTTTTCC
TGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTC
TGG
TTATCTGTGGCAC
ATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTT
GTG
TCTGGGGTTTATG
ATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGT
CTC
TGTTTGCTGATGC
TGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGAC
CTC
TTCTACTACAAAA
TCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCA
AGA
TCCAGCTGGAAAT
CAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTA
GGT
GCCCTTGAGCCCA
GCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGA
GGC
TGGCTGGCTGGAC
GAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAATC
TCA
GCCTCGCCCACTG
GCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCACAGTCAGCTTCTAGTTCTGTAGCCCCAGCTGCTCCTGCGGT
GGA
GGGAGCTACACAT
CAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTGAGCACTGCGGGCTGACCTGCTCCCAACCAGGGAGATGGAG
CTT
CCCCCTTGAGTCG
GGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGTTGTGGCAACTGATTGGTGACCTGGGGGGCGTTTCTGAGCC
CAC
AGTGCTGGCATCA
GGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTGATTTTGGGAGGGGAGTTCTCTCGTAATGACACTGAGGATG
CCT
TCAAGTTGGGCTT
CTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCAGTGGGCGGAGGGAGCGGGAAGCGCGTCAGTGGGCGGAGTA
TTT
GAGAACATTTCAC
AAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGAAGCAGCCCCAGGACCTCCCTGGCTCAAGGAGTGACAGCGA
GTT
TGTCTGAGGTGAG
GGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCC
GTT
GAGGCCAGGGGCA
TAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGT
GGC
AGCCAGTGCCACC
ATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGG
GAG
ACTCATGAGGCCG
TTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCAT
GGA
GCTCCCATTGGTG
GCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTA
ATT
TGCATTCCCTACC
GGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGT
GCT
TCCACATCTGTCC
AAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCA
AGG
CTGTATGTTTACA
TTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATT
TGT
CATTAGTCAACCG
GAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAG
TCA
TACACGTTCTAAC
TCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCC
ACA
TTTTCTAGCCCAC
TCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGC
TCT
GGGAGCTGGGTGT
CAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACA
CAC
TTGATGGGAGTTT
TCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGA
GCA
ATGTTGGATGAGT
GAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGA
GCC
CCTTCCAAGGGTG
GACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAA

THE UNIVERSITY OF BRITISH COLUMBIA

MEDICINE INFECTIOUS DISEASES

MERCK Database scaning

GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCT
GCA
ATGACAAAGGTAC
CCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCT
GAG
CAGCCACAACCTA
CTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCT
TCT
GCCTTTGCTCCTG
GGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCC
CAG
GGTGAGGATGACT
CATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTT
CAT
GCATCCTCTGGAA
GATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCT
CAT
TTCGCACTCACCT
TGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAG
TAT
TCCATTGTAGCTC
TTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTC
ATG
GAGGAAGAGNGCT
CAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCA
GGG
GAATGGGCATGGA
GTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTT
TCC
TAAACTTGATGAC
CTAGGGCTAGGGGCATGTTGAATCTCAGCCTCGCCCACTGGCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCAC
AGT
CAGCTTCTAGTTC
TGTAGCCCCAGCTGCTCCTGCGGTGGAGGGAGCTACACATCAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTG
AGC
ACTGCGGGCTGAC
CTGCTCCCAACCAGGGAGATGGAGCTTCCCCCTTGAGTCGGGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGT
TGT
GGCAACTGATTGG
TGACCTGGGGGGCGTTTCTGAGCCCACAGTGCTGGCATCAGGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTG
ATT
TTGGGAGGGGAGT
TCTCTCGTAATGACACTGAGGATGCCTTCAAGTTGGGCTTCTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCA
GTG
GGCGGAGGGAGCG
GGAAGCGCGTCAGTGGGCGGAGTATTTGAGAACATTTCACAAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGA
AGC
AGCCCCAGGACCT
CCCTGGCTCAAGGAGTGACAGCGAGTTTGTCTGAGGTGAGGGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGG
AGG
CATTCAGGTGGGC
AGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGC
TCC
TCTTTGCCTTACT
CCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTC
CCC
ATGAGCCAAGACG
GCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGG
AAT
TTCAGTTCATGCA
GGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAG
TGA
CCTGATTTTTTCC
TGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTC
TGG
TTATCTGTGGCAC
ATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTT
GTG
TCTGGGGTTTATG
ATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGT
CTC
TGTTTGCTGATGC
TGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGAC
CTC
TTCTACTACAAAA
TCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCA
AGA
TCCAGCTGGAAAT
CAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTA
GGT
GCCCTTGAGCCCA
GCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGA
GGC
TGGCTGGCTGGAC
GAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAATC
TCA
GCCTCGCCCACTG
GCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCACAGTCAGCTTCTAGTTCTGTAGCCCCAGCTGCTCCTGCGGT
GGA
GGGAGCTACACAT
CAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTGAGCACTGCGGGCTGACCTGCTCCCAACCAGGGAGATGGAG
CTT
CCCCCTTGAGTCG
GGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGTTGTGGCAACTGATTGGTGACCTGGGGGGCGTTTCTGAGCC
CAC
AGTGCTGGCATCA
GGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTGATTTTGGGAGGGGAGTTCTCTCGTAATGACACTGAGGATG
CCT
TCAAGTTGGGCTT
CTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCAGTGGGCGGAGGGAGCGGGAAGCGCGTCAGTGGGCGGAGTA
TTT
GAGAACATTTCAC
AAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGAAGCAGCCCCAGGACCTCCCTGGCTCAAGGAGTGACAGCGA
GTT
TGTCTGAGGTGAG
GGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCC
GTT
GAGGCCAGGGGCA
TAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGT
GGC
AGCCAGTGCCACC
ATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGG
GAG
ACTCATGAGGCCG
TTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCAT
GGA
GCTCCCATTGGTG
GCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTA
ATT
TGCATTCCCTACC
GGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGT
GCT
TCCACATCTGTCC
AAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCA
AGG
CTGTATGTTTACA
TTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATT
TGT
CATTAGTCAACCG
GAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAG
TCA
TACACGTTCTAAC
TCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCC
ACA
TTTTCTAGCCCAC
TCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGC
TCT
GGGAGCTGGGTGT
CAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACA
CAC
TTGATGGGAGTTT
TCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGA
GCA
ATGTTGGATGAGT
GAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGA
GCC
CCTTCCAAGGGTG
GACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAA

THE UNIVERSITY OF BRITISH COLUMBIA

MEDICINE INFECTIOUS DISEASES

MERCK Database scaning

CONFIRMED

CONFIRMED

CONFIRMED



3. Attacking essential proteins in emerging

and re
-
emerging pathogens: Prospectives, Protocols


GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCT
GCA
ATGACAAAGGTAC
CCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCT
GAG
CAGCCACAACCTA
CTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCT
TCT
GCCTTTGCTCCTG
GGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCC
CAG
GGTGAGGATGACT
CATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTT
CAT
GCATCCTCTGGAA
GATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCT
CAT
TTCGCACTCACCT
TGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAG
TAT
TCCATTGTAGCTC
TTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTC
ATG
GAGGAAGAGNGCT
CAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCA
GGG
GAATGGGCATGGA
GTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTT
TCC
TAAACTTGATGAC
CTAGGGCTAGGGGCATGTTGAATCTCAGCCTCGCCCACTGGCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCAC
AGT
CAGCTTCTAGTTC
TGTAGCCCCAGCTGCTCCTGCGGTGGAGGGAGCTACACATCAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTG
AGC
ACTGCGGGCTGAC
CTGCTCCCAACCAGGGAGATGGAGCTTCCCCCTTGAGTCGGGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGT
TGT
GGCAACTGATTGG
TGACCTGGGGGGCGTTTCTGAGCCCACAGTGCTGGCATCAGGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTG
ATT
TTGGGAGGGGAGT
TCTCTCGTAATGACACTGAGGATGCCTTCAAGTTGGGCTTCTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCA
GTG
GGCGGAGGGAGCG
GGAAGCGCGTCAGTGGGCGGAGTATTTGAGAACATTTCACAAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGA
AGC
AGCCCCAGGACCT
CCCTGGCTCAAGGAGTGACAGCGAGTTTGTCTGAGGTGAGGGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGG
AGG
CATTCAGGTGGGC
AGAGTCAGGGAGACTCATGAGGCCGTTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGC
TCC
TCTTTGCCTTACT
CCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTC
CCC
ATGAGCCAAGACG
GCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGG
AAT
TTCAGTTCATGCA
GGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAG
TGA
CCTGATTTTTTCC
TGCTTTTCAAGGCTGTATGTTTACATTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTC
TGG
TTATCTGTGGCAC
ATTTGTATTTGTCATTAGTCAACCGGAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTT
GTG
TCTGGGGTTTATG
ATCACACAGTCATACACGTTCTAACTCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGT
CTC
TGTTTGCTGATGC
TGATGATCCACATTTTCTAGCCCACTCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGAC
CTC
TTCTACTACAAAA
TCCTAAAGCTCTGGGAGCTGGGTGTCAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCA
AGA
TCCAGCTGGAAAT
CAGTGAACACACTTGATGGGAGTTTTCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTA
GGT
GCCCTTGAGCCCA
GCTTTGGGAGCAATGTTGGATGAGTGAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGA
GGC
TGGCTGGCTGGAC
GAGTCAGGAGCCCCTTCCAAGGGTGGACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAATC
TCA
GCCTCGCCCACTG
GCGCTGGACTTGGTACACAGGGTGGGGCAAAGTGGGTACTGGATCCTGATCATCCCTATCCCTGGGGTGTGGCTTCTTGCTGCACAGTCAGCTTCTAGTTCTGTAGCCCCAGCTGCTCCTGCGGT
GGA
GGGAGCTACACAT
CAGGCTCTGACCCCCTCCAGGTGGGGCCTTCGCGTGAGGGGAGTCAGCACGCATCAGCAGCTGGGCCCAGGGAGTTGCCCCACTGAGCACTGCGGGCTGACCTGCTCCCAACCAGGGAGATGGAG
CTT
CCCCCTTGAGTCG
GGCTGCTGAAGGGGGGTAGGGGATGGAAACAGTGCGTTTGCAGGAGTAAGGGTGCAGTTGGGTCCCTGCGAGAAAATGTCTCAGTTGTGGCAACTGATTGGTGACCTGGGGGGCGTTTCTGAGCC
CAC
AGTGCTGGCATCA
GGACTCAGGTGTGAGGTGCCCCAGACCCTCCCCTTGCCAGTAATTAGCTGATGGCTCGGTGATGCCCAGGGTGAAGGAAGACTTGATTTTGGGAGGGGAGTTCTCTCGTAATGACACTGAGGATG
CCT
TCAAGTTGGGCTT
CTGGCATGTTCTGCCCTCGCTCCCCTTCTGTAGTCACCTTGGCCCTCGTGTTGCTGAGCTGTGTGTGGGAGCGGGAAGCGCGTCAGTGGGCGGAGGGAGCGGGAAGCGCGTCAGTGGGCGGAGTA
TTT
GAGAACATTTCAC
AAGCCGCTGTTGAGGTTCAGAATCAACCAGCAGATACAGAAACATATTTCGGAGCGTGGGGACCCTTGGGTGAGCTGCCACATGAAGCAGCCCCAGGACCTCCCTGGCTCAAGGAGTGACAGCGA
GTT
TGTCTGAGGTGAG
GGCACAGGCCTGGCGAAGCCTCGTGTGTGGGTGAGACCTGCCCGACCCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGGGAGACTCATGAGGCC
GTT
GAGGCCAGGGGCA
TAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGT
GGC
AGCCAGTGCCACC
ATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGCCAGTGCCTTACCCGAGGAGCTACTGGCCCAGTGGGGGAGGCATTCAGGTGGGCAGAGTCAGG
GAG
ACTCATGAGGCCG
TTGAGGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGATGCTCCTCTTTGCCTTACTCCTAGCCAT
GGA
GCTCCCATTGGTG
GCAGCCAGTGCCACCATCGCGCTCAGTGTAAGTATCATTCCCTCTCACTGTCCTGGAGAGGACGAGAATTCCACCTGGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTA
ATT
TGCATTCCCTACC
GGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGT
GCT
TCCACATCTGTCC
AAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGGTTGTCACATTCTGAGCAGCCACAACCTACTGCATCCCATGTAGAAGTGGAAGTGACCTGATTTTTTCCTGCTTTTCA
AGG
CTGTATGTTTACA
TTTGCCTCCAATCATTCCTATGGGAATTCCTTGGGAGTCTAACTTGGAGATTTTGTTTCTTCTGCCTTTGCTCCTGGGGGCTTAATCACTTCTGTGCCTCTGGTTATCTGTGGCACATTTGTATT
TGT
CATTAGTCAACCG
GAGACTCGGGGTCTGAGTGGAGGGTATGTCCCCCTCCAGTGATGGTTTCTGTTGGCTTCCCAGGGTGAGGATGACTCATGACCACTTGCAAGTGGTTTTTGTGTCTGGGGTTTATGATCACACAG
TCA
TACACGTTCTAAC
TCCAGACTGACTGTTGAGAAAGCCTCTGGGTAAGGGAATTCCTGGGAAACACACTGTTTTCATGCATCCTCTGGAAGATGAGGCCTGAAGTTACCAGGGTCTCTGTTTGCTGATGCTGATGATCC
ACA
TTTTCTAGCCCAC
TCTGCTTCTCTGACACCTTTAGTCTTGAGGATCCATGNTCTGTGAAGGAATCCAAGCTCTCATTTCGCACTCACCTTGGCCCTGGCTCTGTCTCCAGGACCTCTTCTACTACAAAATCCTAAAGC
TCT
GGGAGCTGGGTGT
CAACCTGTGCCCGAGGAAATCATACAGTTACTGTGGACTTTCCAGTTTGCTGTCTTCTAGTATTCCATTGTAGCTCTTGGGTATTTTCCCATCCACCCCAAGATCCAGCTGGAAATCAGTGAACA
CAC
TTGATGGGAGTTT
TCCTGCATGTGCTCTGGGCATTGACAGTAGAAGGGTGTTCAGAATGTCTGCTGTGCCCTCATGGAGGAAGAGNGCTCAGTGTACATGCTCTGGGTCAGTAGGTGCCCTTGAGCCCAGCTTTGGGA
GCA
ATGTTGGATGAGT
GAAGGAGGGATCCAGGGCAAAGCAGGCACGACAGAGTGGAGACGGCGCTGCTGGCTCTCAGGGGAATGGGCATGGAGTGGGTAGGAGATCCACCTAAGGAGGCTGGCTGGCTGGACGAGTCAGGA
GCC
CCTTCCAAGGGTG
GACACTGACAGGCCCCCAGTCTTGGTCTCCTGCATGCCAGAGGTACCAGCCCATCTTTTTTCCTAAACTTGATGACCTAGGGCTAGGGGCATGTTGAA

PINs

Jeong, H., Mason, S. P., Barabasi, A. L., & Oltvai, Z. N. (2001). Lethality and centrality in protein networks. Nature, 411,
41
-
42.


In most protein interaction networks (PINs), there the majority of proteins
participate in few interactions while the vast number of interactions occur
through few essential ‘HUB’ proteins.

PINs are resistant to
random attack, but very
vulnerable when it comes
to ‘intelligent’ removal of
the hubs




Canadian Institute of Health Research (CIHR)





UBC/VHHSC






Genome Canada; Genome BC

Acknowledgements:

“Emergency discovery” of novel antimicrobials among
known drugs in response to new and re
-
emerging
infectious threats



A. Cherkasov

UBC / VGH Infectious Diseases

artc@interchange.ubc.ca


Approved DRUGS re
-
profiled into:

“FIRST
-
LINE DEFENCE” Antibiotics

Tropical
-

and other 3rd world Anti
-
infectives

Orphan therapeutics